The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051636	Avibacterium paragallinarum strain ADL-AP17 chromosome, complete genome	2415699	257969	279069	2415699	integrase	Mannheimia_phage(44.44%)	33	255979:256030	282214:282265
255979:256030	attL	GACCAATCCCGACTTTCGTTTGAAAGTGGGTATATCCTAAATTAAAGGGCGG	NA	NA	NA	NA
WP_035689252.1|257969_258866_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	49.7	2.9e-73
WP_051128140.1|258925_259321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051128139.1|259317_259635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689249.1|259721_260201_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	53.5	1.4e-39
WP_046097549.1|260188_260821_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	68.6	1.0e-77
WP_035689246.1|260817_261597_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	62.1	9.8e-86
WP_035689276.1|261607_262549_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	48.0	1.2e-45
WP_035689243.1|263427_263703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046097548.1|263724_264033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168939906.1|264126_264663_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	67.2	3.1e-22
WP_017806446.1|265335_265557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807323.1|265571_265742_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_136711940.1|266060_266357_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	58.3	2.5e-26
WP_017807324.1|266357_266648_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	47.7	1.1e-13
WP_017807325.1|266794_267568_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_017807326.1|267569_268055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807327.1|268054_268708_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	70.1	1.0e-67
WP_017807328.1|268845_269052_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168939907.1|269557_269965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046097539.1|270074_270845_+	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	45.4	1.3e-45
WP_035689420.1|270841_271648_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	62.0	3.3e-28
WP_165381618.1|271671_272328_+	hypothetical protein	NA	A0A0M3LS65	Mannheimia_phage	42.2	4.4e-39
WP_052716788.1|272436_273072_+	DUF1367 family protein	NA	A0A2I7RNU5	Vibrio_phage	29.6	3.8e-19
WP_035689367.1|273072_273357_+	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	80.6	2.0e-36
WP_035689370.1|273682_274033_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	42.1	6.2e-16
WP_035689371.1|274032_274395_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_035689374.1|274639_275644_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	24.4	3.8e-05
WP_017807323.1|275941_276112_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_017806446.1|276126_276348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035660437.1|276604_276922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017807508.1|276925_277183_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	53.6	2.0e-11
WP_051128146.1|277163_277871_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_046097210.1|278103_279069_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	39.0	3.6e-61
282214:282265	attR	CCGCCCTTTAATTTAGGATATACCCACTTTCAAACGAAAGTCGGGATTGGTC	NA	NA	NA	NA
>prophage 2
NZ_CP051636	Avibacterium paragallinarum strain ADL-AP17 chromosome, complete genome	2415699	285938	292418	2415699	integrase	Mannheimia_phage(25.0%)	10	280907:280922	293415:293430
280907:280922	attL	GATCACATCAATAACA	NA	NA	NA	NA
WP_035688053.1|285938_286439_+	siphovirus Gp157 family protein	NA	A0A0E3U2R8	Fusobacterium_phage	35.5	3.8e-14
WP_035688055.1|286449_287337_+	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	55.9	1.3e-57
WP_035688057.1|287336_287816_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	52.8	2.1e-38
WP_035688059.1|287824_288073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035688062.1|288115_288430_+	hypothetical protein	NA	X2CY11	Brucella_phage	40.2	3.6e-07
WP_035688065.1|288452_288635_-	hypothetical protein	NA	Q19US2	Mannheimia_phage	52.6	4.0e-06
WP_035688068.1|288944_289154_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	58.1	6.1e-11
WP_035688071.1|289668_290331_+	KilA-N domain-containing protein	NA	D0UIM5	Aggregatibacter_phage	43.2	6.5e-14
WP_051128099.1|290574_291171_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_035688073.1|291398_292418_+|integrase	site-specific integrase	integrase	Q7Y5X7	Haemophilus_phage	88.2	2.3e-175
293415:293430	attR	TGTTATTGATGTGATC	NA	NA	NA	NA
>prophage 3
NZ_CP051636	Avibacterium paragallinarum strain ADL-AP17 chromosome, complete genome	2415699	1464830	1487798	2415699		Mannheimia_phage(52.63%)	37	NA	NA
WP_081637566.1|1464830_1465730_-	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	72.1	5.5e-48
WP_035689183.1|1466074_1466293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081637567.1|1466285_1467512_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	49.3	5.0e-44
WP_046097530.1|1467734_1468013_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_026138622.1|1468022_1468316_+	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	48.7	4.7e-09
WP_017807426.1|1468425_1469088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807425.1|1469077_1469719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689190.1|1469792_1470389_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	43.4	9.6e-33
WP_035689209.1|1470713_1471151_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	71.0	8.5e-55
WP_035689193.1|1471159_1471753_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	56.8	6.4e-53
WP_035689196.1|1471749_1472589_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	48.9	4.4e-68
WP_035689199.1|1472581_1473394_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	45.6	1.1e-15
WP_035689202.1|1473390_1474164_-	Rha family transcriptional regulator	NA	A0A2D0YGX8	Vibrio_phage	42.0	6.6e-42
WP_035689204.1|1474210_1474672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046097532.1|1474720_1474942_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	44.6	3.2e-10
WP_046097533.1|1475041_1475707_+	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	77.0	2.0e-71
WP_156127790.1|1476313_1476718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689467.1|1476720_1477161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017807323.1|1477520_1477691_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_017806446.1|1477705_1477927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168939906.1|1478599_1479136_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	67.2	3.1e-22
WP_046097548.1|1479229_1479538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689243.1|1479559_1479835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689276.1|1480713_1481655_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	48.0	1.2e-45
WP_035689246.1|1481665_1482445_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	62.1	9.8e-86
WP_046097549.1|1482441_1483074_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	68.6	1.0e-77
WP_035689249.1|1483061_1483541_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	53.5	1.4e-39
WP_051128139.1|1483627_1483945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051128140.1|1483941_1484337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689252.1|1484396_1485293_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	49.7	2.9e-73
WP_035689255.1|1485289_1485499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017807560.1|1485514_1485712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689257.1|1485714_1486044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051128141.1|1486159_1486663_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	32.5	1.6e-12
WP_035689260.1|1486655_1486889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689262.1|1486964_1487249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689265.1|1487315_1487798_+	methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	72.3	7.7e-65
>prophage 4
NZ_CP051636	Avibacterium paragallinarum strain ADL-AP17 chromosome, complete genome	2415699	1678783	1765614	2415699	tRNA,plate,holin,tail,terminase,transposase,capsid	Haemophilus_phage(23.94%)	105	NA	NA
WP_046097356.1|1678783_1679269_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_035687040.1|1679464_1680610_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_017807042.1|1680624_1681428_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_017807041.1|1681710_1682529_+	DNA ligase	NA	A0A1X9VNU1	Mimivirus	29.4	3.6e-30
WP_035687043.1|1682939_1684169_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_035687045.1|1684198_1686229_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_035695974.1|1686546_1688223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124994873.1|1688212_1689760_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.3	4.0e-22
WP_046097314.1|1689762_1690491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168939946.1|1690862_1692035_+	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	56.2	1.6e-116
WP_168939947.1|1692024_1693461_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.8	1.2e-17
WP_035688629.1|1693567_1694734_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_046097312.1|1694743_1695886_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_035688630.1|1695885_1696683_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_035688632.1|1696679_1697327_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	1.9e-10
WP_124994912.1|1697999_1698251_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_035688634.1|1698747_1699374_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	34.4	5.7e-12
WP_035688639.1|1699373_1699799_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	41.3	3.3e-19
WP_017807028.1|1699791_1700475_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	48.9	1.1e-53
WP_017807029.1|1700649_1700973_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_035685198.1|1702612_1704292_-|tail	tail fiber protein	tail	Q7Y5S2	Haemophilus_phage	36.3	1.5e-11
WP_017805938.1|1704301_1704916_-	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	35.8	9.0e-18
WP_035685201.1|1704924_1706361_-|plate	baseplate J/gp47 family protein	plate	E5AGC3	Erwinia_phage	29.8	1.7e-43
WP_017805941.1|1706353_1706719_-	hypothetical protein	NA	D4N458	Pseudomonas_phage	36.9	1.1e-10
WP_017805942.1|1706715_1707387_-|plate	phage baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	33.8	5.6e-21
WP_035685202.1|1707379_1708345_-	hypothetical protein	NA	M4SNA5	Psychrobacter_phage	30.9	3.5e-24
WP_017805944.1|1708322_1708655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168939948.1|1708762_1709605_-	phage antirepressor N-terminal domain-containing protein	NA	A0A0M3LR56	Mannheimia_phage	71.8	2.3e-48
WP_168939949.1|1709930_1711082_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	30.3	6.2e-36
WP_035685204.1|1711213_1711807_-	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	26.5	1.3e-08
WP_017805948.1|1711896_1712079_+	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	47.5	1.4e-06
WP_017805949.1|1712122_1712542_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A2H4JFV9	uncultured_Caudovirales_phage	46.4	9.4e-27
WP_017805950.1|1712579_1714838_-	tape measure protein	NA	K7RVL7	Vibrio_phage	29.4	1.5e-33
WP_017805951.1|1714834_1714987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017805952.1|1715022_1715508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017805953.1|1715507_1715936_-	DUF3277 family protein	NA	A0A2H4P8K8	Pseudomonas_phage	38.3	4.6e-21
WP_017805954.1|1715987_1717061_-	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	35.5	5.3e-66
WP_017805955.1|1717047_1717557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017805956.1|1717558_1717918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035685207.1|1717917_1718376_-	hypothetical protein	NA	D0UII8	Aggregatibacter_phage	29.0	2.2e-08
WP_017805958.1|1718359_1718713_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_017805960.1|1718943_1719897_-	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	37.6	3.6e-50
WP_017805961.1|1719970_1720387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035685209.1|1720398_1721454_-	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	40.5	3.9e-53
WP_017805963.1|1721541_1721976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035685212.1|1723098_1724406_-	DUF1073 domain-containing protein	NA	A0A2K9V3H1	Faecalibacterium_phage	31.4	3.3e-46
WP_046097305.1|1724408_1725758_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	59.0	5.4e-148
WP_017806476.1|1725738_1726266_-|terminase	terminase small subunit	terminase	E5AGA2	Erwinia_phage	43.2	2.4e-19
WP_168939950.1|1726276_1726531_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	56.8	2.3e-20
WP_168939980.1|1726514_1726727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168939979.1|1726695_1727058_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_168939951.1|1727017_1727425_-	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	64.4	1.5e-45
WP_017807585.1|1727417_1727750_-|holin	phage holin, lambda family	holin	A0A2D1GNJ3	Pseudomonas_phage	36.8	4.1e-09
WP_130239081.1|1727904_1728222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017807600.1|1728309_1728822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689440.1|1729005_1729410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035689442.1|1729400_1730006_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	44.9	2.3e-34
WP_035689454.1|1730314_1730968_+	hypothetical protein	NA	D0UIM5	Aggregatibacter_phage	37.6	1.2e-31
WP_168939952.1|1731005_1731431_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	62.1	3.5e-45
WP_103853787.1|1731420_1731648_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	42.6	1.5e-07
WP_168939953.1|1731647_1732325_-	hypothetical protein	NA	A0A1P8DTF3	Proteus_phage	35.7	1.1e-27
WP_168939954.1|1732324_1733062_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	45.1	5.0e-47
WP_046097539.1|1733058_1733829_-	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	45.4	1.3e-45
WP_082082238.1|1733938_1734346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035689502.1|1734393_1734687_-	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	79.2	1.6e-36
WP_035689499.1|1734709_1734910_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	44.6	1.0e-07
WP_035689497.1|1735029_1735788_+	helix-turn-helix domain-containing protein	NA	Q76H56	Enterobacteria_phage	26.1	6.5e-18
WP_017807600.1|1735964_1736477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046097541.1|1736742_1737285_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	34.9	2.5e-19
WP_017807585.1|1737388_1737721_+|holin	phage holin, lambda family	holin	A0A2D1GNJ3	Pseudomonas_phage	36.8	4.1e-09
WP_168939951.1|1737713_1738121_+	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	64.4	1.5e-45
WP_168939979.1|1738080_1738443_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_168939980.1|1738411_1738624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168939950.1|1738607_1738862_+	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	56.8	2.3e-20
WP_115615517.1|1738872_1739385_+|terminase	terminase small subunit	terminase	A0A0M3LSU1	Mannheimia_phage	59.8	1.2e-44
WP_046097804.1|1739365_1740715_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	58.3	3.0e-143
WP_046097263.1|1740711_1742028_+	DUF1073 domain-containing protein	NA	D0UIJ6	Aggregatibacter_phage	52.8	5.1e-119
WP_168939955.1|1741948_1743346_+|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	45.1	6.5e-56
WP_168939956.1|1743348_1743630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168939957.1|1743697_1744819_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	60.2	7.0e-85
WP_017807108.1|1744818_1745271_+	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	52.7	3.6e-32
WP_035688838.1|1745283_1746186_+	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	62.8	3.0e-102
WP_017807106.1|1746194_1746545_+	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	51.7	2.4e-23
WP_035688835.1|1746541_1746985_+	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	49.6	3.3e-30
WP_017807104.1|1746981_1747329_+	hypothetical protein	NA	Q776V7	Haemophilus_phage	47.9	4.0e-23
WP_051052690.1|1747252_1747765_+	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	50.6	1.0e-35
WP_168939958.1|1747768_1749271_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	74.9	3.9e-216
WP_017807101.1|1749280_1749709_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	78.2	7.3e-59
WP_017807100.1|1749711_1750137_+	hypothetical protein	NA	Q776V6	Haemophilus_phage	56.2	3.6e-34
WP_051128129.1|1750266_1752201_+|tail	phage tail tape measure protein	tail	D0UII2	Aggregatibacter_phage	48.2	4.7e-04
WP_035688832.1|1752203_1752551_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	55.3	8.1e-24
WP_081637560.1|1752534_1752789_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	55.8	1.4e-17
WP_035688830.1|1752856_1753618_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	53.5	3.0e-63
WP_035688827.1|1753621_1753924_+	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	56.8	6.1e-28
WP_082082221.1|1753899_1754739_+	replication initiation protein	NA	A0A1V0E006	Clostridioides_phage	35.7	2.2e-14
WP_103846642.1|1755923_1756772_+	hemin receptor	NA	NA	NA	NA	NA
WP_017806206.1|1756734_1757331_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_017806205.1|1757333_1758041_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_035688856.1|1758387_1758714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130231609.1|1759884_1760721_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	71.5	3.7e-115
WP_081637559.1|1760717_1761365_+|plate	baseplate protein	plate	D0UIH7	Aggregatibacter_phage	60.8	7.6e-68
WP_081637558.1|1761361_1761712_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	66.7	8.6e-42
WP_035688818.1|1761762_1762893_+|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	66.6	7.7e-140
WP_046097796.1|1762892_1763471_+	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	67.9	1.2e-72
WP_046097262.1|1763475_1765614_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	37.1	7.6e-64
