The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046565	Methylococcus sp. IM1 chromosome, complete genome	3371031	4961	46798	3371031	transposase,protease	Burkholderia_virus(42.86%)	35	NA	NA
WP_169601138.1|4961_5297_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169601139.1|5438_6614_+	sulfotransferase	NA	NA	NA	NA	NA
WP_169601140.1|6761_7712_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	49.5	7.3e-75
WP_169601143.1|8090_9219_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.1	2.6e-15
WP_169601145.1|9344_10295_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	49.7	1.0e-76
WP_169601147.1|10580_11710_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.1	2.0e-15
WP_169601149.1|11958_13187_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	80.1	1.6e-130
WP_169601151.1|13185_13488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169601153.1|13484_14237_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169601155.1|14233_14569_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169601157.1|14844_16455_-	surface-associated protein	NA	NA	NA	NA	NA
WP_169604515.1|16495_18787_-	cytochrome C peroxidase	NA	NA	NA	NA	NA
WP_169601159.1|19210_19873_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_169601161.1|19942_21109_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_169601163.1|21102_23319_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_169601165.1|23668_24259_+	HNH endonuclease	NA	A0A248SKR4	Salicola_phage	45.6	4.9e-37
WP_169601168.1|24271_25735_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_169601170.1|25741_26752_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_169601172.1|27029_27458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169601174.1|27500_29849_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_169601176.1|29856_30702_-	EEP domain-containing protein	NA	NA	NA	NA	NA
WP_169604516.1|30710_31355_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_169604517.1|31462_32071_-	cytochrome c4	NA	NA	NA	NA	NA
WP_169601178.1|32247_32880_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_169601181.1|33020_34286_-	alpha-amylase	NA	NA	NA	NA	NA
WP_169604518.1|34292_35852_-	glycogen synthase	NA	NA	NA	NA	NA
WP_169601183.1|36595_38671_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_169604519.1|38728_41170_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_169601185.1|41126_41939_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_169604520.1|42035_42779_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_169601187.1|42762_43521_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_169601189.1|43517_43943_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_169601192.1|44385_45201_+	tetratricopeptide repeat protein	NA	A0A1X9SH79	Bradyrhizobium_phage	34.4	2.7e-09
WP_169601194.1|45217_45856_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_169601196.1|46036_46798_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP046565	Methylococcus sp. IM1 chromosome, complete genome	3371031	387000	413106	3371031	transposase,protease,coat,tRNA	Pseudomonas_phage(66.67%)	23	NA	NA
WP_169601729.1|387000_387963_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_169601731.1|387959_388949_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_169601733.1|388991_389690_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_169601735.1|389849_390122_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_169601737.1|390301_391012_+|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_169601739.1|391018_391735_-	HugZ family protein	NA	NA	NA	NA	NA
WP_169601741.1|392216_392489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169601743.1|392769_393312_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_169601745.1|393340_394072_+	molecular chaperone	NA	NA	NA	NA	NA
WP_169601747.1|394055_396482_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_169604552.1|396523_396991_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_169601749.1|397132_398176_+	peptide chain release factor 2	NA	W8EDB3	Pseudomonas_phage	31.1	3.2e-07
WP_169601751.1|398180_399671_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.6	9.0e-88
WP_169601753.1|399729_400584_-	quinoprotein dehydrogenase-associated putative ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_169601755.1|400747_402607_-	methanol/ethanol family PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_169604553.1|403074_403971_+	quinoprotein relay system zinc metallohydrolase 2	NA	NA	NA	NA	NA
WP_169601757.1|404018_404831_+	quinoprotein dehydrogenase-associated SoxYZ-like carrier	NA	NA	NA	NA	NA
WP_169601759.1|404831_406922_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_169601761.1|407142_407904_+	methane monooxygenase/ammonia monooxygenase subunit C	NA	NA	NA	NA	NA
WP_169601763.1|408161_408419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169601765.1|408500_410633_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	80.4	8.0e-114
WP_169601766.1|410689_411598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169601768.1|411792_413106_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP046565	Methylococcus sp. IM1 chromosome, complete genome	3371031	830104	838114	3371031	protease	Lake_Baikal_phage(50.0%)	9	NA	NA
WP_169602483.1|830104_831373_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.0	9.5e-131
WP_169602485.1|831766_832978_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_169602487.1|833018_833438_+	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	80.6	2.9e-52
WP_169602489.1|833454_833856_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.9	2.5e-24
WP_169602491.1|833882_834206_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	45.8	9.2e-22
WP_169602493.1|834217_834751_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_169602495.1|834750_836610_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	37.0	2.9e-96
WP_169602497.1|836612_836951_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_169602499.1|836959_838114_+	homocitrate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.0	2.1e-07
>prophage 5
NZ_CP046565	Methylococcus sp. IM1 chromosome, complete genome	3371031	2435712	2444593	3371031		Escherichia_phage(50.0%)	7	NA	NA
WP_169603774.1|2435712_2439213_-	DNA polymerase III subunit alpha	NA	A0A0K1Y906	Streptomyces_phage	38.8	3.0e-211
WP_169603775.1|2439630_2440536_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	3.0e-22
WP_169603776.1|2440532_2441090_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.0	5.2e-49
WP_169603777.1|2441086_2441974_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.3	4.1e-96
WP_169603778.1|2441970_2443044_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	47.7	3.5e-86
WP_169603779.1|2443049_2443853_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_169603780.1|2443849_2444593_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.9	2.4e-17
>prophage 6
NZ_CP046565	Methylococcus sp. IM1 chromosome, complete genome	3371031	2844642	2855996	3371031		Erysipelothrix_phage(66.67%)	7	NA	NA
WP_169604096.1|2844642_2847846_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B253	Erysipelothrix_phage	44.2	6.8e-250
WP_169604097.1|2847842_2848667_+	DUF4391 domain-containing protein	NA	A0A2K5B254	Erysipelothrix_phage	20.2	1.3e-06
WP_169604721.1|2848713_2849154_+	GxxExxY protein	NA	E5ER30	Bathycoccus_sp._RCC1105_virus	35.3	1.9e-06
WP_169604098.1|2849150_2851217_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	38.6	1.2e-109
WP_169604099.1|2851216_2852422_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	25.8	2.7e-18
WP_169604722.1|2852433_2853030_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_169604100.1|2853026_2855996_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	41.6	7.8e-192
>prophage 7
NZ_CP046565	Methylococcus sp. IM1 chromosome, complete genome	3371031	2933713	3017920	3371031	transposase,protease,tRNA,integrase	Burkholderia_virus(13.33%)	79	2958800:2958842	2994537:2994579
WP_169604163.1|2933713_2934997_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.9	1.3e-132
WP_169604164.1|2935094_2935733_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.3	1.7e-56
WP_169604165.1|2935744_2937067_-	trigger factor	NA	NA	NA	NA	NA
WP_169604166.1|2937398_2938292_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_169604167.1|2938288_2938921_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_169604168.1|2938965_2939367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169604169.1|2939415_2939901_+	cytochrome P460 family protein	NA	NA	NA	NA	NA
WP_169604170.1|2940244_2940715_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_169604171.1|2940740_2941202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169604172.1|2941233_2941680_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_169604173.1|2941679_2942390_-	DUF2959 domain-containing protein	NA	NA	NA	NA	NA
WP_169604174.1|2942469_2942949_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_169604175.1|2942929_2943838_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_169604176.1|2943856_2944288_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_169604177.1|2944950_2946402_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_169604178.1|2946679_2947809_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.1	1.0e-14
WP_169604179.1|2947865_2948021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169604180.1|2948017_2948425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169604181.1|2948435_2949575_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_169604182.1|2949741_2950461_+	response regulator	NA	W8CYM9	Bacillus_phage	37.3	4.7e-34
WP_169604727.1|2950979_2951813_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_169604183.1|2951927_2952308_-	YciI family protein	NA	NA	NA	NA	NA
WP_169604184.1|2952555_2952885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169604185.1|2953654_2954482_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.1	1.5e-15
WP_169604186.1|2954621_2955167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169604187.1|2955474_2955642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169604188.1|2955748_2956699_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	50.5	5.4e-78
WP_169604189.1|2956823_2957141_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_169603917.1|2957175_2958201_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	29.9	4.7e-19
WP_169604728.1|2958396_2958813_+	hypothetical protein	NA	NA	NA	NA	NA
2958800:2958842	attL	AAATGTCTTTGTGATCATATGGTTATCATTGGAAGCAACTCTA	NA	NA	NA	NA
WP_169604190.1|2958926_2959145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169602699.1|2959274_2960324_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	30.5	3.8e-40
WP_169604729.1|2960473_2960998_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_169604191.1|2961195_2962731_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_169604192.1|2962749_2964303_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_169604730.1|2964313_2965843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169604731.1|2965887_2969109_-	DUF2309 domain-containing protein	NA	NA	NA	NA	NA
WP_169604193.1|2969183_2970650_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_169604732.1|2970780_2972283_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_169604194.1|2972284_2973733_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	27.8	1.6e-49
WP_169604195.1|2973742_2974603_-	methylenetetrahydrofolate dehydrogenase	NA	NA	NA	NA	NA
WP_169604196.1|2974745_2975369_+	cyclodeaminase/cyclohydrolase family protein	NA	NA	NA	NA	NA
WP_169604197.1|2976503_2976734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169604733.1|2977195_2978089_+	cyclase family protein	NA	NA	NA	NA	NA
WP_169604198.1|2979206_2980364_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.7	4.6e-23
WP_169604199.1|2980447_2981161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169604200.1|2981185_2981344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169604734.1|2981501_2982035_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169604201.1|2982031_2983306_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_169604202.1|2983500_2983911_+	GFA family protein	NA	NA	NA	NA	NA
WP_169604203.1|2984396_2985878_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	34.9	1.2e-79
WP_169604735.1|2987031_2987742_+	DUF2490 domain-containing protein	NA	NA	NA	NA	NA
WP_169604204.1|2987890_2988409_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	51.4	6.4e-41
WP_169604736.1|2988441_2989806_-	MFS transporter	NA	NA	NA	NA	NA
WP_169604205.1|2990109_2992938_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.5	9.7e-301
WP_169604206.1|2993121_2993379_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_169604207.1|2993798_2994431_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_169604208.1|2994844_2995564_+	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
2994537:2994579	attR	TAGAGTTGCTTCCAATGATAACCATATGATCACAAAGACATTT	NA	NA	NA	NA
WP_169604209.1|2995584_2995938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169604210.1|2995957_2996194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169604211.1|2996311_2996860_-	maturase	NA	NA	NA	NA	NA
WP_169604212.1|2998024_2998339_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_169604737.1|2998331_2998640_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169604213.1|2999165_2999540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169604214.1|3001178_3002552_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_169604215.1|3002544_3003990_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_169604216.1|3004017_3004839_-	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.8	6.4e-11
WP_169604217.1|3004893_3008703_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_169604218.1|3008814_3010269_-	ribonuclease G	NA	NA	NA	NA	NA
WP_169604219.1|3010265_3010874_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_169604220.1|3010882_3011350_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_169604221.1|3011359_3012457_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_169604222.1|3012533_3012905_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_169604738.1|3012919_3013651_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_169604223.1|3013680_3014718_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.0	7.2e-76
WP_169604224.1|3014911_3015472_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_169604225.1|3016060_3016246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169604226.1|3016232_3016544_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_169604227.1|3017215_3017920_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP046565	Methylococcus sp. IM1 chromosome, complete genome	3371031	3252899	3261274	3371031		Bacillus_virus(16.67%)	6	NA	NA
WP_169604421.1|3252899_3253685_+	MBL fold metallo-hydrolase	NA	G3MAC9	Bacillus_virus	31.6	6.1e-27
WP_169604422.1|3253706_3254078_-	response regulator	NA	Q6XLV6	Feldmannia_irregularis_virus	35.2	5.1e-08
WP_169604760.1|3254089_3255805_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.1	3.7e-37
WP_169604423.1|3256467_3258048_+	response regulator	NA	W8CYM9	Bacillus_phage	33.1	1.5e-11
WP_169604424.1|3258101_3259088_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A2H4N7Z5	Lake_Baikal_phage	31.8	6.9e-20
WP_169604425.1|3259192_3261274_+	universal stress protein	NA	A9YVW0	Ostreococcus_tauri_virus	30.9	1.3e-36
>prophage 9
NZ_CP046565	Methylococcus sp. IM1 chromosome, complete genome	3371031	3297207	3327921	3371031	transposase,integrase	Stenotrophomonas_phage(33.33%)	21	3295392:3295406	3305278:3305292
3295392:3295406	attL	CGCTGGCCGAGCACC	NA	NA	NA	NA
WP_169604459.1|3297207_3298434_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	55.8	2.3e-121
WP_169604460.1|3300446_3300575_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_169604763.1|3300620_3301061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169604461.1|3302233_3303001_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_169604462.1|3302993_3304250_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_169604764.1|3304246_3305317_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
3305278:3305292	attR	GGTGCTCGGCCAGCG	NA	NA	NA	NA
WP_169604463.1|3305696_3306932_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	1.3e-12
WP_169604464.1|3306928_3307756_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_169604765.1|3307789_3308206_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_169604465.1|3308208_3308706_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_169604466.1|3308841_3309300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169604467.1|3309364_3310330_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_169604468.1|3310340_3311555_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_169604469.1|3311842_3313144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169604470.1|3313973_3316208_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_169604471.1|3316809_3321570_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_169604766.1|3322101_3322584_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_169604472.1|3324144_3325833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169603871.1|3325927_3326425_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_169604767.1|3326427_3326844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169604473.1|3326970_3327921_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	49.4	2.7e-77
