The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	91911	231243	2486079	integrase,transposase	Pseudomonas_phage(12.5%)	105	90475:90491	233578:233593
90475:90491	attL	CGCCGAAGGTGGCGTTG	NA	NA	NA	NA
WP_168787402.1|91911_92352_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	49.5	6.2e-21
90475:90491	attL	CGCCGAAGGTGGCGTTG	NA	NA	NA	NA
WP_168787403.1|92306_92759_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B0Z042	Pseudomonas_phage	70.5	4.7e-56
WP_168787404.1|93413_93842_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	61.2	3.9e-44
93600:93616	attR	CAACGCCACCTTCGGCG	NA	NA	NA	NA
WP_168787405.1|93911_94211_+	hypothetical protein	NA	NA	NA	NA	NA
93600:93616	attR	CAACGCCACCTTCGGCG	NA	NA	NA	NA
WP_168787406.1|94188_95750_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	32.7	7.9e-10
WP_168787407.1|95848_96646_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	30.0	6.6e-21
WP_168787408.1|97197_98604_-	amino acid permease	NA	NA	NA	NA	NA
WP_168787409.1|99567_100281_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	27.5	8.8e-09
WP_168787410.1|101115_102414_-	lactonase family protein	NA	NA	NA	NA	NA
WP_168787411.1|103138_103687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787412.1|103698_105300_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_168788926.1|105330_106734_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_168787413.1|106846_108019_+	porin	NA	NA	NA	NA	NA
WP_168787414.1|108897_110121_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_168787415.1|110205_111627_+	hopanoid biosynthesis associated radical SAM protein HpnJ	NA	NA	NA	NA	NA
WP_168787416.1|111626_112487_+	hopanoid biosynthesis-associated protein HpnK	NA	NA	NA	NA	NA
WP_168787417.1|112483_113488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787418.1|113853_116253_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_168787419.1|117889_118387_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168787420.1|118557_120030_+	MFS transporter	NA	NA	NA	NA	NA
WP_168788927.1|120245_121514_+	amidohydrolase	NA	NA	NA	NA	NA
WP_168787421.1|121510_122170_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_168787422.1|122211_122547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787423.1|123702_124482_+	acetoacetate decarboxylase	NA	NA	NA	NA	NA
WP_168787424.1|124509_125292_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_168787425.1|125303_126653_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_168788928.1|126960_127212_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787307.1|127573_128020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788929.1|128576_129425_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_168787426.1|129887_130556_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168787427.1|130915_132130_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_168788930.1|132419_133610_-	porin	NA	NA	NA	NA	NA
WP_168787428.1|133694_134993_-	lactonase family protein	NA	NA	NA	NA	NA
WP_168787429.1|135083_136412_-	cytochrome c	NA	NA	NA	NA	NA
WP_168787430.1|136421_138200_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_168787431.1|138199_138940_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_168787432.1|139050_139515_-	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_168787433.1|140333_141770_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_168787434.1|141772_142780_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_168788931.1|142801_142954_+	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_168787435.1|143120_143501_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_168788932.1|144731_145226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787436.1|145236_146841_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_168788933.1|146933_148289_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_168787437.1|148355_149531_+	porin	NA	NA	NA	NA	NA
WP_168787438.1|149675_150128_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168787439.1|150134_152186_+	FUSC family protein	NA	NA	NA	NA	NA
WP_168787440.1|152208_152418_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_168787441.1|152414_153308_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_168787442.1|153304_154777_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_168787443.1|155550_156636_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168787444.1|156641_156884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787370.1|157177_158383_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.0	3.0e-118
WP_168788925.1|158406_158823_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	69.9	2.0e-53
WP_168787445.1|159015_159981_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_168787446.1|160618_161809_-	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
WP_168787447.1|162368_162914_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_168787448.1|162918_163098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787449.1|163326_164961_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_168787450.1|164982_165513_-	sorbitol dehydrogenase	NA	NA	NA	NA	NA
WP_168787451.1|165525_167112_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_168787452.1|167214_167427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788934.1|167777_168971_-	porin	NA	NA	NA	NA	NA
WP_168787453.1|169806_170526_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_168787454.1|170562_172332_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_168787455.1|172337_173615_+	cytochrome c	NA	NA	NA	NA	NA
WP_168787456.1|174366_174981_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_168787457.1|176583_176877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787458.1|176886_177618_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	32.0	2.6e-16
WP_168787459.1|177770_178052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787460.1|178184_178589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787461.1|180060_180921_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_063496755.1|180934_181135_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_168787462.1|181124_183335_-	FUSC family protein	NA	NA	NA	NA	NA
WP_168787463.1|183346_184999_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_168787464.1|185155_186121_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787465.1|188156_189242_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168787466.1|189642_190767_-	porin	NA	NA	NA	NA	NA
WP_168787467.1|191232_192258_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.6	2.1e-48
WP_168787468.1|192401_192668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787469.1|193083_194202_+|transposase	transposase	transposase	A0A0H3UZC2	Geobacillus_virus	35.5	4.4e-23
WP_168787386.1|194335_195367_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168787470.1|195735_196005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788935.1|196260_197157_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_168787471.1|197564_198941_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_168787472.1|199911_200931_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168787473.1|202648_204370_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_168787474.1|205751_206909_+	porin	NA	NA	NA	NA	NA
WP_168787475.1|208144_208651_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787476.1|208708_209569_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_168787477.1|209582_209783_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_168787478.1|209772_211980_-	FUSC family protein	NA	NA	NA	NA	NA
WP_168787479.1|211993_213523_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_168787480.1|213713_214658_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787481.1|215357_217445_-	FUSC family protein	NA	NA	NA	NA	NA
WP_168787482.1|218580_218886_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_168787483.1|218926_219127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787484.1|219210_219489_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	57.3	3.1e-18
WP_168787485.1|219710_220724_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168787486.1|221102_222347_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	27.7	1.3e-07
WP_168787487.1|222343_223279_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787488.1|225004_225958_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787489.1|226270_227224_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	67.0	4.8e-119
WP_168787490.1|228003_229257_-|integrase	tyrosine-type recombinase/integrase	integrase	D6PIF1	uncultured_phage	26.0	9.4e-06
WP_168787491.1|230220_231243_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	7.6e-38
233578:233593	attR	ACCGGGCGAATCCAGC	NA	NA	NA	NA
>prophage 3
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	254247	304785	2486079	integrase,transposase	Helicobacter_phage(28.57%)	46	255498:255513	269026:269041
WP_168787507.1|254247_254676_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	61.2	5.1e-44
WP_168788940.1|254721_255816_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	30.5	2.0e-20
255498:255513	attL	GAACGCGAAAGCGCTG	NA	NA	NA	NA
WP_168787508.1|256766_258755_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.8	7.4e-37
WP_168787370.1|259117_260323_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.0	3.0e-118
WP_168788925.1|260346_260763_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	69.9	2.0e-53
WP_168787509.1|261388_261661_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_168787510.1|261737_262916_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	29.2	2.3e-06
WP_168787308.1|263962_264103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787309.1|264302_264446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788941.1|264581_265142_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_168787511.1|265138_266236_-	dimethyl sulfone monooxygenase SfnG	NA	NA	NA	NA	NA
WP_168787512.1|266264_266846_-	FMN reductase	NA	NA	NA	NA	NA
WP_168787513.1|267148_268351_-	monooxygenase	NA	NA	NA	NA	NA
WP_168787514.1|268347_269508_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
269026:269041	attR	CAGCGCTTTCGCGTTC	NA	NA	NA	NA
WP_168788942.1|269901_271101_+	monooxygenase	NA	NA	NA	NA	NA
WP_168787515.1|271097_272213_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787516.1|272573_272822_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787310.1|272948_273278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787517.1|273444_274713_-	amidohydrolase	NA	NA	NA	NA	NA
WP_168787518.1|274807_276271_-	MFS transporter	NA	NA	NA	NA	NA
WP_168787311.1|276405_276591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787519.1|276753_277242_+	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168787520.1|277471_278023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787521.1|278058_279444_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_168787522.1|279672_281550_-	3-hydroxybenzoate 4-monooxygenase	NA	NA	NA	NA	NA
WP_168787523.1|282396_283574_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	52.4	1.4e-43
WP_168787524.1|283944_284733_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_168787525.1|284729_285611_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168787526.1|285613_286411_-	DUF4118 domain-containing protein	NA	NA	NA	NA	NA
WP_168787527.1|286629_287436_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168788943.1|287963_289514_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_168787528.1|289944_290139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787529.1|290937_292005_+	lipase	NA	NA	NA	NA	NA
WP_168787530.1|292392_292743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787531.1|293446_293911_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_168787532.1|294415_294715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787533.1|294727_295810_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168787312.1|296315_296561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787534.1|296503_296641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787535.1|296752_296971_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_168787536.1|296964_297330_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_168787537.1|299068_300202_+	aminomethyl transferase family protein	NA	NA	NA	NA	NA
WP_168788944.1|300266_300797_+	glycine cleavage system protein R	NA	NA	NA	NA	NA
WP_168787538.1|300932_302570_+	APC family permease	NA	NA	NA	NA	NA
WP_168787539.1|302974_303517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787386.1|303753_304785_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	323282	391751	2486079	integrase,transposase	Wolbachia_phage(25.0%)	44	367254:367313	391741:392844
WP_168787387.1|323282_324665_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	35.8	3.3e-76
WP_168787555.1|326343_327810_-	ATP-binding domain-containing protein	NA	A0A126DN25	Acinetobacter_phage	32.3	1.2e-60
WP_168787556.1|328213_329263_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168787557.1|330877_332011_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_168787558.1|333779_334292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787559.1|334612_334828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787560.1|335124_337185_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_168787561.1|337191_339234_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_168787562.1|339279_340620_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_168787563.1|340635_341085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787564.1|341135_342965_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.8	3.6e-131
WP_168787565.1|342973_344203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787566.1|344301_345663_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	32.5	6.6e-29
WP_168787386.1|345886_346918_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168787567.1|350742_351315_-	phasin family protein	NA	NA	NA	NA	NA
WP_168787568.1|352624_352897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787313.1|352940_353480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787569.1|353857_354598_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_168787570.1|354625_355006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787571.1|355393_355918_-	phasin family protein	NA	NA	NA	NA	NA
WP_168787572.1|358898_359936_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168787573.1|360194_360380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787574.1|360635_360941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787575.1|361310_362240_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_168787576.1|362577_362721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787387.1|363120_364503_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	35.8	3.3e-76
WP_168787577.1|364705_365920_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	53.2	4.9e-116
WP_168788947.1|366122_366341_+	hypothetical protein	NA	NA	NA	NA	NA
367254:367313	attL	GGGCGGCCTCAAATCTGAAGTGCAACACCGTTTCGTATAAGGTGTTGCGATGCACGAAAG	NA	NA	NA	NA
WP_168787491.1|367302_368325_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	7.6e-38
WP_168787578.1|368440_369016_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_168787579.1|369049_370282_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168787580.1|370448_371675_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_168787581.1|374313_376611_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_168787582.1|376911_377943_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168787583.1|379159_379507_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168787584.1|379600_380155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787585.1|380597_381797_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	53.3	7.9e-111
WP_168787586.1|382016_383342_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	42.8	2.0e-94
WP_168787386.1|383597_384629_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168787587.1|384896_385037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787588.1|385033_386632_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_168788948.1|386681_388211_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	1.7e-17
WP_168787589.1|388770_390333_-|transposase	transposase	transposase	Q9MBP7	Staphylococcus_prophage	21.8	6.2e-07
WP_168787491.1|390728_391751_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	7.6e-38
391741:392844	attR	CTTTCGTGCATCGCAACACCTTATACGAAACGGTGTTGCACTTCAGATTTGAGGCCGCCCTATATCAGGTATGGCATTTTAATCAAGAACCGGAATTGATTCAACAAACTTGTAACTCACGACACCGCTATAGGCAACTGCTCCCGCGTGTAGGTCTTTTCAAAGAAGTGCATTTTCTTGATTCATTCCGACAATACCTTGTCATGCGCCGCCCCAGCCTTATGATGAACTGTATAAGGCCTCATACTCGCTCCATCTAGGACTATTTGAGGGGGAGTCGATGGCGAGCTTGTATCCCTCAACGGTTTATCGGCAGGTCCGCCTGTGCCGCTTTTTTACGTTATGAAGCAGGTGCAAGCGGGACAAAAAAATTTTGTTGCGTTAAGCCGGAAAACTAGGTTTCGGGGCTGCGAAATATGCTTGTGCTGCTCAATGGAGAAGGCGCGAAAAAGCCTTGCGCAAGGCATCGTCTAGGTGCTGACGCGCCTGCACTATCAGCTCAATGTGATGCTGCCGTGCGTGCGGTGGTATCTTGGCTACTCGCTTAGTTCGTTAGTTTTGAGTTGGAAGAAATGATAGCCGGGCGTGGTATCGAGGCCGGTCATCCGACGGTGCTTCGATGGATGTCTTCCGCACAGCACTAGTACTCCTTGACATAATAAGTATTCCTTACATATTAGACTTTGTTTTGACAAATTTAGGTTGCCCCCGACAGAACAAAAAAACAACTCCTCTTTTCTCTTTGCGAAATTACTTGACCGCTACAAGGAAATCCCACATTGTTGTTTAAGAATTTTCACTTTGTCTAGTCTCGCACTGGATGTGAAATCTAAGTCTTTTTTAATTGCGTATTCCCGCGCGTACCGAGGCGATGTTTTCTTGCGATGAACATGATGGTCGAAGTGCGAGAGACCTGAGCGCTTGAGGCGAACACAAGTTGAGCAGTTCGACAAAAACGTTTGGCGGGAGAAGCCAACGCGGAGAGAAGAATGGATGTGCAGCACGGAAGAACGCGACCGGCGTTGCCAAACCTGCTTGCGGACTTGCTGGACGTGATGCGCGTCATCCGCGGGGCACTGGCGGCATCGCACGAGCGATCTGAAA	NA	NA	NA	NA
>prophage 5
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	397150	476689	2486079	integrase,transposase	Escherichia_phage(14.29%)	54	454418:454432	478902:478916
WP_168787386.1|397150_398182_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168788949.1|398244_399555_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.9	5.2e-116
WP_168787594.1|399577_399994_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	2.1e-47
WP_168787595.1|400435_400624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787596.1|401147_401738_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_168787597.1|402208_402658_+	hypothetical protein	NA	A0A077SL42	Escherichia_phage	53.2	3.4e-30
WP_168787598.1|405251_406613_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	31.7	1.9e-28
WP_168787599.1|406673_408491_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	47.5	2.3e-146
WP_168787600.1|410783_411716_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168787601.1|411778_412900_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_168787602.1|413184_414567_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_168788950.1|415147_416200_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168788951.1|416618_417071_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_168787603.1|417080_419360_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_168788952.1|419383_420517_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.3	6.3e-25
WP_168787604.1|420524_421763_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	26.4	1.4e-25
WP_168787605.1|421759_423049_+	flippase	NA	NA	NA	NA	NA
WP_168787606.1|423041_424226_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_168787607.1|424222_425506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787608.1|425558_426614_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_168787609.1|426708_427458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787610.1|427473_428220_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_168787611.1|428575_429481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787612.1|430833_432039_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_168787613.1|432047_432926_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F6SJK8	Mycobacterium_phage	27.2	3.4e-10
WP_168787614.1|433226_434465_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	30.1	2.2e-07
WP_168787615.1|434461_435406_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787616.1|436215_437604_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787617.1|438297_439605_+	group II intron reverse transcriptase/maturase	NA	H7BVN0	unidentified_phage	24.9	1.5e-09
WP_168787618.1|440537_441419_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.1	6.5e-70
WP_168787619.1|441411_442008_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168787620.1|443830_444121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788953.1|445368_445641_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_168787621.1|445658_446606_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.9	1.9e-06
WP_168787622.1|447390_447765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787623.1|447761_447989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788954.1|448797_450318_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	25.4	1.4e-08
WP_168787624.1|450322_450643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787625.1|450639_451224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787626.1|451755_452688_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_168787627.1|454394_455036_+	hypothetical protein	NA	NA	NA	NA	NA
454418:454432	attL	GCTCCTCGCCCGGCA	NA	NA	NA	NA
WP_168787628.1|455280_456000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787629.1|456511_457243_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_168787630.1|457389_458523_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_168787631.1|458946_460242_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_168787632.1|460525_464191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787633.1|464253_464490_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168787634.1|464524_465247_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.9	2.7e-37
WP_168787635.1|465596_466643_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_168787636.1|467662_468538_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_168787637.1|468912_470214_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_168787314.1|471624_472809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787638.1|472820_474647_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_168787639.1|475255_476689_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
478902:478916	attR	TGCCGGGCGAGGAGC	NA	NA	NA	NA
>prophage 6
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	485841	551048	2486079	integrase,transposase	Stx2-converting_phage(14.29%)	48	487462:487478	554858:554874
WP_168787650.1|485841_486183_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	48.6	9.1e-12
WP_168787651.1|486689_486950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787652.1|487000_487399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787653.1|487391_488870_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
487462:487478	attL	CGGCGCGCGCGCTCGGG	NA	NA	NA	NA
WP_168788955.1|488880_489648_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.6	6.7e-47
WP_168787654.1|489669_489909_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_168787655.1|489902_490316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787656.1|491346_493410_-	recombinase family protein	NA	NA	NA	NA	NA
WP_168788956.1|494461_494860_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_168788957.1|495106_495424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788959.1|495408_495573_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168788958.1|495614_497144_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	48.8	1.8e-131
WP_168787657.1|497146_497740_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_168787523.1|498666_499843_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	52.4	1.4e-43
WP_168787658.1|501289_502825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787659.1|508600_508735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787660.1|509089_510670_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_168787661.1|510903_511638_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.0	3.6e-21
WP_168787662.1|512748_514272_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_168787663.1|514268_518249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787664.1|518306_518504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787665.1|518841_519633_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_168787666.1|519732_520191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787667.1|520663_522025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787668.1|522555_522741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787669.1|522753_523845_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_168787612.1|524122_525328_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_168787613.1|525336_526215_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F6SJK8	Mycobacterium_phage	27.2	3.4e-10
WP_168787670.1|526502_527501_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168787615.1|527497_528442_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787671.1|528438_529677_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	30.1	2.2e-07
WP_168787672.1|529729_530518_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	26.3	5.4e-15
WP_168787673.1|531049_534391_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_168787674.1|534565_536272_-	fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	22.5	7.8e-19
WP_168787675.1|536501_536810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787676.1|537069_538200_+	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	41.2	9.2e-69
WP_168787677.1|538653_539091_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	4.7e-05
WP_168788960.1|539449_539950_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_168787678.1|540060_540933_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_168787679.1|541054_541756_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_168787680.1|542172_542556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787681.1|543310_543865_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168787682.1|543960_544665_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168787683.1|544848_545700_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	39.4	2.9e-43
WP_168787684.1|545911_546661_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_168787685.1|546964_547768_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168787686.1|547760_549362_+	response regulator	NA	W8CYF6	Bacillus_phage	30.5	1.9e-22
WP_168787687.1|550070_551048_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	46.3	1.1e-70
554858:554874	attR	CCCGAGCGCGCGCGCCG	NA	NA	NA	NA
>prophage 7
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	573995	629063	2486079	holin,transposase	Thermobifida_phage(25.0%)	43	NA	NA
WP_168787702.1|573995_574370_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_168787703.1|574474_574771_-	CsbD family protein	NA	NA	NA	NA	NA
WP_168787704.1|576883_577192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787705.1|579688_580078_-	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_168787706.1|580364_580580_+	CsbD family protein	NA	NA	NA	NA	NA
WP_168787707.1|581033_582152_+|transposase	transposase	transposase	A0A0R8V9X2	Thermobifida_phage	35.6	5.8e-23
WP_168788966.1|582241_583027_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_168787708.1|582989_583367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787709.1|583454_583838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787710.1|584083_584551_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_168787711.1|584575_584983_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	30.0	7.3e-08
WP_168787712.1|585020_585239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787713.1|586778_587498_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.8	1.8e-46
WP_168787714.1|587522_587858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787715.1|588720_589326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787716.1|589446_589764_-	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
WP_168787717.1|589763_590006_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_168787718.1|590637_590808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787719.1|591316_592249_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_168787720.1|595910_596081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787721.1|596461_597586_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_168788967.1|597631_598132_-	universal stress protein	NA	NA	NA	NA	NA
WP_168787722.1|602064_602667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787723.1|603057_604713_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_168787724.1|604779_604944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787725.1|605408_605549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787726.1|607022_607427_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_168787727.1|607339_607888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787728.1|608332_608779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787315.1|608902_609061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787729.1|609914_610238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787730.1|612369_612726_-	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_168787316.1|614164_614329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787731.1|614325_614766_+	ester cyclase	NA	NA	NA	NA	NA
WP_168787732.1|615023_616061_+	NAD-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_168787733.1|617732_618875_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_168787734.1|618871_619816_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	3.3e-19
WP_168787735.1|619812_620757_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_168787736.1|620753_621455_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787737.1|622285_622513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787738.1|625459_626593_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_168787739.1|626874_627685_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_168787740.1|627767_629063_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	636117	707872	2486079	integrase,transposase	Mycobacterium_phage(33.33%)	55	634560:634578	702720:702738
634560:634578	attL	CTCGACGGCGATCGCGTCG	NA	NA	NA	NA
WP_168787746.1|636117_636837_-|transposase	IS6 family transposase	transposase	A0A0N9SKD3	Staphylococcus_phage	36.8	5.2e-33
WP_168788969.1|637154_637934_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	25.4	2.7e-11
WP_168787747.1|637952_639101_-	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_168787748.1|639100_640204_-	dimethyl sulfone monooxygenase SfnG	NA	NA	NA	NA	NA
WP_168787749.1|640232_640814_-	FMN reductase	NA	NA	NA	NA	NA
WP_168787750.1|642181_643426_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_168788970.1|644476_644752_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_168787751.1|644748_645072_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_168787752.1|645687_646911_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168787753.1|648461_650786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788971.1|650778_651270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787754.1|651347_651851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787755.1|652197_652344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787756.1|652602_653508_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787757.1|653668_655114_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_168788972.1|655280_656159_+	DMT family transporter	NA	NA	NA	NA	NA
WP_168787758.1|656338_657289_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_168787759.1|657285_657678_+	VOC family protein	NA	NA	NA	NA	NA
WP_168787760.1|657679_658138_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_168787761.1|658137_659358_+	CoA transferase	NA	NA	NA	NA	NA
WP_168787762.1|659357_660191_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_168787763.1|660209_660998_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_168787764.1|661075_662437_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_168787765.1|664921_665224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787766.1|665223_666054_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.9	7.1e-34
WP_168787472.1|667300_668320_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168787767.1|671243_671774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787768.1|672870_673164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787769.1|673764_674448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787770.1|674459_675176_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_168787771.1|675559_675832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787772.1|676139_676394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787773.1|677412_678795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787774.1|679041_680268_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_168787775.1|680367_681324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788973.1|681561_682425_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_168787776.1|684278_684731_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168788974.1|684837_686058_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.6	8.4e-100
WP_168787777.1|686686_690325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787778.1|690334_691381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787779.1|692567_693092_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_168787317.1|693911_694394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787780.1|694362_695049_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_168788975.1|695304_695871_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168788976.1|696448_696919_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787318.1|697526_697928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787781.1|697924_698491_+	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_168787782.1|698631_699375_+	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_168787783.1|699777_700023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787784.1|700096_700246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787785.1|700296_701742_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_168787786.1|703466_703811_-	hypothetical protein	NA	NA	NA	NA	NA
702720:702738	attR	CTCGACGGCGATCGCGTCG	NA	NA	NA	NA
WP_168787787.1|703968_705237_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.2	2.4e-102
WP_168787788.1|705308_705650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787361.1|706894_707872_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	49.8	2.6e-80
>prophage 9
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	739756	806768	2486079	integrase,transposase	Mycobacterium_phage(25.0%)	52	774700:774717	807187:807204
WP_168788923.1|739756_740731_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	33.0	3.6e-45
WP_168787816.1|741529_741727_+	DUF2970 domain-containing protein	NA	NA	NA	NA	NA
WP_168787817.1|742557_742869_+	High potential iron-sulfur protein	NA	NA	NA	NA	NA
WP_168787818.1|743256_743457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788981.1|743945_744140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787819.1|746486_746819_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_168787820.1|747007_747658_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_168787821.1|747727_749146_-	purine-cytosine permease-like transporter	NA	NA	NA	NA	NA
WP_168788982.1|749163_750213_-	porin	NA	NA	NA	NA	NA
WP_168787822.1|750487_750991_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_168787823.1|751052_751406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787824.1|751420_752626_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_168787825.1|752679_754029_-	acetamidase	NA	NA	NA	NA	NA
WP_168787826.1|754298_755741_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_168787827.1|755883_756213_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_168787828.1|756221_757244_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_168787829.1|757272_757551_+	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_168787830.1|757609_758131_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	36.3	6.0e-07
WP_168787319.1|758577_758925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787831.1|759040_759370_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_168787832.1|759376_760381_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_168787833.1|760468_761125_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_168787834.1|761380_762712_+	acetamidase	NA	NA	NA	NA	NA
WP_168787835.1|762947_764201_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_168787836.1|764200_764542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787837.1|764551_765031_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_168787838.1|765108_766593_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_168787839.1|767068_768511_+	purine-cytosine permease-like transporter	NA	NA	NA	NA	NA
WP_168788983.1|769234_769951_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	32.3	5.7e-24
WP_168787840.1|770136_771054_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787841.1|771275_773111_+	sulfatase-like hydrolase/transferase	NA	A0A1V0SA98	Catovirus	22.2	4.6e-25
WP_168787842.1|774566_774782_-	hypothetical protein	NA	NA	NA	NA	NA
774700:774717	attL	TGCGTCCCGTCGCGAAGT	NA	NA	NA	NA
WP_168787843.1|775207_775528_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_168787844.1|776066_777371_-	group II intron reverse transcriptase/maturase	NA	H7BVN0	unidentified_phage	29.6	3.1e-07
WP_168787845.1|779515_780448_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787846.1|781893_782298_+	DoxX family protein	NA	NA	NA	NA	NA
WP_168787847.1|782332_783385_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168787787.1|784701_785970_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.2	2.4e-102
WP_168787848.1|786177_786996_+	dioxygenase	NA	NA	NA	NA	NA
WP_168787849.1|787155_787575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787774.1|789523_790750_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_168787850.1|791851_792286_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168787851.1|792710_793343_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168787852.1|793858_794017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787853.1|794813_795083_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_168787854.1|796187_797159_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168787787.1|797990_799259_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.2	2.4e-102
WP_168787855.1|799875_800367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787856.1|802109_802502_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_168787857.1|802555_803389_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_168787858.1|804291_805554_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.4	1.1e-59
WP_168787859.1|806474_806768_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
807187:807204	attR	TGCGTCCCGTCGCGAAGT	NA	NA	NA	NA
>prophage 10
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	886615	990708	2486079	transposase	Burkholderia_virus(18.18%)	82	NA	NA
WP_168787907.1|886615_887635_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168787908.1|887884_889039_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168787909.1|889647_890661_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168787910.1|891301_892237_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787911.1|892314_893721_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	NA	NA	NA	NA
WP_168787912.1|893707_894877_+	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_168788993.1|894938_896270_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	37.0	8.4e-61
WP_168788994.1|899218_899401_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168787913.1|899704_900907_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_168787914.1|901555_902737_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_168787915.1|902790_902997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787916.1|903021_903993_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787917.1|904124_905759_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168787918.1|905751_907368_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	32.0	3.3e-35
WP_168787919.1|907389_908049_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_168787920.1|908164_909013_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_168787921.1|909119_910286_-	extradiol dioxygenase	NA	NA	NA	NA	NA
WP_168787922.1|910362_911253_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168787923.1|911309_912536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787924.1|912585_913080_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_168788995.1|913411_914554_-	porin	NA	NA	NA	NA	NA
WP_168787925.1|914683_916045_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_168787787.1|917024_918293_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.2	2.4e-102
WP_168787926.1|918503_919550_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168788923.1|919577_920552_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	33.0	3.6e-45
WP_168787927.1|922532_923426_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_168787928.1|924416_925940_-	succinate CoA transferase	NA	NA	NA	NA	NA
WP_168787929.1|926108_927023_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787930.1|927609_927918_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_168788996.1|928060_928486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787931.1|929144_929708_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_168787932.1|929808_930435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787933.1|930852_931245_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_168788923.1|932419_933394_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	33.0	3.6e-45
WP_168787934.1|933544_934261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787935.1|934260_934449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787936.1|934565_935684_-	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	3.0e-27
WP_168787937.1|935725_936979_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_168787938.1|937060_938746_-	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_168787939.1|938803_939829_-	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168787940.1|940025_940901_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787941.1|941069_941786_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.5	1.6e-45
WP_168788955.1|942449_943217_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.6	6.7e-47
WP_168787653.1|943227_944706_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_168787652.1|944698_945097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787651.1|945147_945408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787942.1|945965_947039_-	porin	NA	NA	NA	NA	NA
WP_168787943.1|947119_948115_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_168787944.1|948125_948872_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_168787945.1|948877_950266_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_168787946.1|950293_951313_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_168787947.1|951370_951694_-	DUF4387 domain-containing protein	NA	NA	NA	NA	NA
WP_168787948.1|951695_953063_-	DUF1446 domain-containing protein	NA	NA	NA	NA	NA
WP_168787949.1|953203_954607_-	MFS transporter	NA	NA	NA	NA	NA
WP_168787950.1|954716_955241_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168787321.1|955429_955669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788997.1|959479_960100_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_168787951.1|960366_961104_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168787952.1|961031_961775_-	arylmalonate decarboxylase	NA	NA	NA	NA	NA
WP_168787953.1|961893_962760_+	isocitrate lyase/PEP mutase family protein	NA	NA	NA	NA	NA
WP_168787954.1|962756_964160_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_168787955.1|964152_964770_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_168788998.1|965014_965422_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_168787956.1|965473_966256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787957.1|966260_966587_+	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_168787958.1|966662_967979_+	MFS transporter	NA	NA	NA	NA	NA
WP_168788999.1|968201_969395_+	porin	NA	NA	NA	NA	NA
WP_168787959.1|969839_970364_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168789000.1|970332_970878_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168787960.1|971973_972216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787961.1|972243_972522_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	58.4	9.0e-18
WP_168787962.1|973317_974700_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_168787963.1|974882_975671_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_168789001.1|977871_978492_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_168787964.1|978920_980093_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_168787965.1|980545_981799_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_168787966.1|982003_982393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787967.1|982527_984963_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_168787968.1|984937_986341_-	metallophosphatase	NA	NA	NA	NA	NA
WP_168789002.1|987374_988337_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_168787969.1|988348_989131_+	DUF3380 domain-containing protein	NA	D2JTA3	Pseudomonas_phage	45.1	5.7e-33
WP_168787970.1|990006_990708_-|transposase	IS6 family transposase	transposase	A0A0N9SKD3	Staphylococcus_phage	40.2	9.2e-35
>prophage 11
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	1010718	1061177	2486079	integrase,transposase,holin	Mycobacterium_phage(25.0%)	41	1000382:1000397	1037727:1037742
1000382:1000397	attL	CCTCCTGGTTCAGGGC	NA	NA	NA	NA
WP_168787983.1|1010718_1011378_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	32.6	9.6e-26
WP_168787984.1|1011482_1012502_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168787985.1|1012982_1013999_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_007588886.1|1015032_1015773_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.8	1.2e-11
WP_168787986.1|1015860_1016727_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168787987.1|1016945_1017392_+	VOC family protein	NA	NA	NA	NA	NA
WP_137957868.1|1017514_1018600_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168787988.1|1019106_1019307_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_168787989.1|1019547_1020366_-	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	32.9	6.6e-08
WP_168787612.1|1021517_1022723_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_168787613.1|1022731_1023610_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F6SJK8	Mycobacterium_phage	27.2	3.4e-10
WP_168787990.1|1023871_1024315_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787991.1|1024494_1025754_+|integrase	tyrosine-type recombinase/integrase	integrase	R4TQT9	Mycobacterium_phage	27.4	1.6e-05
WP_168787992.1|1025750_1026698_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787993.1|1026690_1027707_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168789004.1|1027843_1028275_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787994.1|1028560_1029991_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_168787995.1|1030464_1030947_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_168787996.1|1031042_1031369_-	ester cyclase	NA	NA	NA	NA	NA
WP_168787406.1|1031680_1033241_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	32.7	7.9e-10
WP_168787997.1|1033694_1035053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787322.1|1035555_1035816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787998.1|1035970_1037101_-	sensor histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	39.4	2.0e-63
WP_168789005.1|1037292_1039677_+	PAS domain S-box protein	NA	NA	NA	NA	NA
1037727:1037742	attR	CCTCCTGGTTCAGGGC	NA	NA	NA	NA
WP_168787999.1|1039956_1040118_-	cold-shock protein	NA	NA	NA	NA	NA
WP_168789006.1|1040167_1040623_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_168788000.1|1043980_1044433_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_168788001.1|1044457_1044865_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_168788002.1|1045071_1045635_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_168788003.1|1046126_1046330_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	68.7	4.1e-20
WP_168789007.1|1046526_1046757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788004.1|1047141_1047717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787694.1|1047758_1047995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788005.1|1048073_1048391_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_168788006.1|1049134_1050013_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168788007.1|1050145_1051201_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168788008.1|1053927_1054224_+	CsbD family protein	NA	NA	NA	NA	NA
WP_168788009.1|1054327_1054702_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_168789008.1|1054749_1055007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788010.1|1059492_1060209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788011.1|1061030_1061177_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	1191474	1253852	2486079	transposase	Escherichia_phage(40.0%)	51	NA	NA
WP_168788094.1|1191474_1192194_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.8	2.0e-45
WP_168788095.1|1192356_1193571_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_168789022.1|1194149_1195352_+	NnrS family protein	NA	NA	NA	NA	NA
WP_168788096.1|1195680_1199505_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_168788097.1|1199501_1201043_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.2	1.8e-19
WP_168788098.1|1201043_1201733_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_168788099.1|1201801_1202488_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_168788100.1|1202503_1203301_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_168789023.1|1203397_1204654_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_168788101.1|1204713_1205124_+	ribonucleotide reductase subunit alpha	NA	NA	NA	NA	NA
WP_168788102.1|1205321_1206476_+	cytochrome P450	NA	NA	NA	NA	NA
WP_168788103.1|1207410_1207761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168789024.1|1207789_1208029_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_168788104.1|1208094_1208247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787787.1|1208310_1209579_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.2	2.4e-102
WP_168788105.1|1209738_1210263_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_168788106.1|1210391_1210739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788107.1|1211164_1213477_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_168788108.1|1214274_1214457_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_168787985.1|1215639_1216656_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168788343.1|1217133_1218153_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168788109.1|1219740_1220241_-	universal stress protein	NA	NA	NA	NA	NA
WP_168788110.1|1220770_1220956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788111.1|1221588_1221906_-	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_168788112.1|1222263_1222446_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_168788113.1|1222491_1224309_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_168788114.1|1224406_1225405_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168789025.1|1225462_1226746_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_168789026.1|1226805_1227186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788115.1|1227316_1227931_-	heme-copper oxidase subunit III	NA	NA	NA	NA	NA
WP_168788116.1|1227908_1229900_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_168789027.1|1229926_1230922_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_168788117.1|1230936_1232595_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_168788118.1|1232584_1233250_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_168788119.1|1233242_1234241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788120.1|1234215_1235322_-	mandelate racemase	NA	NA	NA	NA	NA
WP_168788121.1|1235326_1237174_-	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_168788122.1|1240282_1241050_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.7	4.0e-23
WP_168788123.1|1241088_1241802_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_168788124.1|1241798_1242488_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
WP_168788125.1|1242609_1243383_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168788126.1|1244377_1245505_+	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_168788127.1|1245774_1246098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788128.1|1246411_1247104_-	VIT family protein	NA	NA	NA	NA	NA
WP_168788129.1|1247113_1247689_-	cytochrome b	NA	NA	NA	NA	NA
WP_168788130.1|1248028_1249375_+	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_168788131.1|1249836_1250076_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_168788083.1|1250075_1250393_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
WP_168788132.1|1250513_1251062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788133.1|1251266_1252199_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_168787406.1|1252291_1253852_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	32.7	7.9e-10
>prophage 13
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	1280638	1361420	2486079	integrase,transposase	Escherichia_phage(25.0%)	59	1293887:1293903	1369424:1369440
WP_168788156.1|1280638_1281724_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168788157.1|1281805_1282495_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_168788158.1|1282716_1282983_-	UDP-glucose 4-epimerase	NA	NA	NA	NA	NA
WP_168788159.1|1283034_1284075_-	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.9	9.6e-12
WP_168788160.1|1284247_1284994_-	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_168788161.1|1285165_1285624_-	universal stress protein	NA	NA	NA	NA	NA
WP_168789031.1|1285686_1286034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788162.1|1286392_1287511_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_168788163.1|1287476_1288307_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_012427417.1|1293479_1293728_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
1293887:1293903	attL	GAATGATGCCGATCACG	NA	NA	NA	NA
WP_168788164.1|1294689_1295007_-	AtpZ/AtpI family protein	NA	NA	NA	NA	NA
WP_168788165.1|1295003_1295462_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_168788166.1|1297091_1297529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788167.1|1297551_1298064_-	flavodoxin	NA	NA	NA	NA	NA
WP_168788168.1|1298370_1298610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788169.1|1300247_1301159_+	carbamate kinase	NA	NA	NA	NA	NA
WP_168787326.1|1301316_1301502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788170.1|1301611_1302448_+	universal stress protein	NA	NA	NA	NA	NA
WP_168788171.1|1302490_1302994_+	universal stress protein	NA	NA	NA	NA	NA
WP_168788172.1|1302990_1303818_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	25.7	5.6e-07
WP_168789032.1|1303929_1304403_-	universal stress protein	NA	NA	NA	NA	NA
WP_168788173.1|1304775_1306830_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_168788174.1|1306826_1307474_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_168788175.1|1308014_1308860_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168788176.1|1309167_1310199_+	nitroreductase	NA	NA	NA	NA	NA
WP_168788177.1|1310226_1310502_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_168789033.1|1311004_1311295_+	cytochrome C	NA	NA	NA	NA	NA
WP_168788178.1|1311341_1311716_+	DUF3564 domain-containing protein	NA	NA	NA	NA	NA
WP_168788179.1|1311752_1312229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788180.1|1312327_1313044_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.0	4.2e-43
WP_168788181.1|1313272_1314508_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_168788182.1|1314554_1316807_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168788183.1|1317083_1317641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788184.1|1320388_1322155_+	recombinase family protein	NA	E9P5U5	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	40.7	2.3e-106
WP_168788185.1|1322445_1322733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788186.1|1322785_1323118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787656.1|1323643_1325707_-	recombinase family protein	NA	NA	NA	NA	NA
WP_168788187.1|1327805_1328192_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	59.8	5.4e-29
WP_168789034.1|1329863_1330316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788188.1|1330602_1331415_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_168789035.1|1331483_1332056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788189.1|1332085_1333771_-	S8/S53 family peptidase	NA	NA	NA	NA	NA
WP_168788190.1|1333814_1335425_-	peptidase S1	NA	NA	NA	NA	NA
WP_168789036.1|1339330_1340164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788191.1|1340721_1341111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788192.1|1341879_1342257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168789037.1|1343763_1345287_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_168788193.1|1345279_1346080_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.1	1.0e-29
WP_168788194.1|1346142_1347312_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_168788195.1|1347787_1348192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788196.1|1349086_1349794_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_168789038.1|1349837_1351193_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_168788197.1|1351199_1354349_+	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	25.8	2.9e-88
WP_168788198.1|1355217_1355778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788199.1|1356342_1356747_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788200.1|1356743_1358267_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_168788201.1|1358368_1358617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788202.1|1358613_1360149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787787.1|1360151_1361420_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.2	2.4e-102
1369424:1369440	attR	CGTGATCGGCATCATTC	NA	NA	NA	NA
>prophage 14
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	1396767	1541677	2486079	integrase,transposase	Wolbachia_phage(16.67%)	109	1431303:1431340	1552103:1552118
WP_168788227.1|1396767_1397052_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168788228.1|1397608_1397863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788229.1|1398151_1399621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788230.1|1399672_1400068_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_168788231.1|1400067_1400280_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168787327.1|1400426_1400735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788232.1|1400866_1401892_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168788233.1|1403023_1403302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788234.1|1403995_1405324_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_168788235.1|1405505_1405895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788236.1|1407316_1407646_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788237.1|1407642_1408584_-	DnaJ domain-containing protein	NA	A0A1V0SBY2	Catovirus	41.4	1.2e-13
WP_168788238.1|1409040_1409595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787328.1|1411177_1411873_+	DUF1343 domain-containing protein	NA	NA	NA	NA	NA
WP_168787329.1|1411906_1412335_+	DUF1343 domain-containing protein	NA	NA	NA	NA	NA
WP_168788239.1|1412677_1412899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788240.1|1414228_1415197_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168788241.1|1418042_1418912_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168788242.1|1418996_1420241_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_168788243.1|1420340_1421357_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	35.4	9.6e-49
WP_168788244.1|1421370_1422312_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	35.1	6.8e-33
WP_168788245.1|1422336_1423143_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_168788246.1|1423161_1424112_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_168788247.1|1424113_1425964_-	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_168788248.1|1426213_1427026_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_168787386.1|1427293_1428325_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
1431303:1431340	attL	GCCCTGAAGGACGGTGCTTCACGCGCACATTGGTGAAG	NA	NA	NA	NA
WP_168788249.1|1431461_1432394_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
1431303:1431340	attL	GCCCTGAAGGACGGTGCTTCACGCGCACATTGGTGAAG	NA	NA	NA	NA
WP_168788250.1|1432408_1433158_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_168789040.1|1433295_1434141_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_168788251.1|1434150_1435779_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_168788252.1|1435983_1437222_-	CoA transferase	NA	NA	NA	NA	NA
WP_168788253.1|1437228_1438416_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_168789041.1|1438540_1439452_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788254.1|1440222_1441038_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168788255.1|1441432_1442398_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_168788256.1|1442453_1442996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788257.1|1443100_1443655_+	VOC family protein	NA	NA	NA	NA	NA
WP_168788258.1|1443760_1444600_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168788259.1|1444748_1446122_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_168788260.1|1446477_1447278_+	2-oxo-hepta-3-ene-1,7-dioic acid hydratase	NA	NA	NA	NA	NA
WP_168788261.1|1447380_1448244_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168788262.1|1448249_1449101_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_168788263.1|1449165_1450437_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_168788264.1|1450668_1451235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788265.1|1452715_1452967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168789042.1|1453561_1453792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788266.1|1454697_1455033_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_168788267.1|1455983_1456883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788268.1|1457155_1457374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788269.1|1457370_1458135_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	2.0e-35
WP_168788270.1|1459043_1459406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788271.1|1461280_1463161_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_168788272.1|1463157_1464615_-|integrase	site-specific integrase	integrase	A0A2H4J165	uncultured_Caudovirales_phage	28.2	2.5e-34
WP_168788273.1|1464683_1465673_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.1	6.5e-26
WP_168788274.1|1465885_1466155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788275.1|1466869_1467061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788276.1|1467795_1468542_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_168788277.1|1468750_1469020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788278.1|1470210_1470579_+	hypothetical protein	NA	NA	NA	NA	NA
1469046:1469083	attR	CTTCACCAATGTGCGCGTGAAGCACCGTCCTTCAGGGC	NA	NA	NA	NA
WP_168787330.1|1470896_1471049_+	hypothetical protein	NA	NA	NA	NA	NA
1469046:1469083	attR	CTTCACCAATGTGCGCGTGAAGCACCGTCCTTCAGGGC	NA	NA	NA	NA
WP_168789043.1|1471231_1472635_-	MFS transporter	NA	NA	NA	NA	NA
WP_168788279.1|1473631_1474708_-	porin	NA	NA	NA	NA	NA
WP_168787465.1|1476659_1477745_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168789044.1|1478282_1478555_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_168788280.1|1479222_1480605_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	35.8	3.3e-76
WP_168788281.1|1480760_1482005_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	57.2	1.1e-128
WP_168787387.1|1482089_1483472_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	35.8	3.3e-76
WP_168787386.1|1483654_1484686_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168788282.1|1485613_1485796_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_168788283.1|1486488_1488192_+	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	40.5	3.2e-105
WP_168788284.1|1488441_1488867_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_168788285.1|1488866_1489160_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_168788286.1|1489582_1490317_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	32.3	4.5e-24
WP_168788287.1|1490429_1491962_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_168788288.1|1491958_1492363_-	DUF4345 domain-containing protein	NA	NA	NA	NA	NA
WP_168788289.1|1492366_1492747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788290.1|1492746_1493238_-	DUF1772 domain-containing protein	NA	NA	NA	NA	NA
WP_168788291.1|1493234_1494119_-	acetoacetate decarboxylase family protein	NA	NA	NA	NA	NA
WP_168788292.1|1494145_1495165_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168788293.1|1499586_1499883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788294.1|1499937_1500171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788295.1|1500178_1501162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788296.1|1501169_1501559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787361.1|1502165_1503143_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	49.8	2.6e-80
WP_168788297.1|1503506_1506443_-	choice-of-anchor D domain-containing protein	NA	NA	NA	NA	NA
WP_168788298.1|1506799_1508176_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_168788299.1|1508178_1511694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788300.1|1512622_1514464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788301.1|1514603_1515620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788302.1|1516878_1517856_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_168788303.1|1517887_1519873_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_168788304.1|1519869_1520505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787361.1|1523409_1524387_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	49.8	2.6e-80
WP_168788305.1|1524577_1526401_+	recombinase family protein	NA	NA	NA	NA	NA
WP_168788306.1|1526761_1526929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788307.1|1527295_1528228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788308.1|1528430_1530293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168789045.1|1530349_1530898_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168788309.1|1531060_1531663_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_168789046.1|1532166_1532772_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	42.0	3.8e-37
WP_168788310.1|1532787_1533681_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168789047.1|1533755_1534052_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	47.5	3.0e-11
WP_168788311.1|1534096_1534510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787491.1|1534853_1535876_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	7.6e-38
WP_168789048.1|1535913_1536132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788312.1|1536190_1536982_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	58.3	9.3e-76
WP_168788313.1|1538047_1539304_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168788314.1|1539300_1540686_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168788315.1|1540672_1541677_+|integrase	site-specific integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	21.5	3.8e-05
1552103:1552118	attR	CAGATCCCGCGCTGCC	NA	NA	NA	NA
>prophage 15
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	1620287	1653195	2486079	transposase	Stx2-converting_phage(60.0%)	28	NA	NA
WP_168788374.1|1620287_1621010_+|transposase	IS6 family transposase	transposase	A0A0N9SKD3	Staphylococcus_phage	41.8	2.8e-34
WP_168788375.1|1621540_1622521_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_168788376.1|1624152_1624518_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_168788377.1|1624514_1624811_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_168788378.1|1625841_1626633_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168788379.1|1626709_1627474_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.3	7.0e-20
WP_168788380.1|1627612_1628557_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168789058.1|1630946_1631267_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_168788381.1|1631483_1632272_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168788382.1|1632538_1633336_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168788383.1|1633524_1634466_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788384.1|1636525_1636927_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_168788385.1|1636970_1637894_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168788386.1|1637981_1638818_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168789059.1|1638864_1639347_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168788387.1|1639480_1639909_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_168788388.1|1640138_1641089_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788389.1|1641292_1642600_+	epoxide hydrolase	NA	NA	NA	NA	NA
WP_168788390.1|1642702_1643755_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168788391.1|1644270_1644744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168789060.1|1645102_1645777_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_168788392.1|1645659_1646505_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_168788393.1|1646873_1647314_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	36.8	2.8e-13
WP_168788394.1|1647319_1647610_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.0	2.6e-31
WP_168788395.1|1647640_1649227_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.8	1.8e-131
WP_168787557.1|1649722_1650856_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_168787739.1|1651006_1651817_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_168787740.1|1651899_1653195_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	1725935	1813772	2486079	integrase,transposase	Mycobacterium_phage(26.67%)	76	1791417:1791438	1805946:1805967
WP_168787653.1|1725935_1727414_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_168787652.1|1727406_1727805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787651.1|1727855_1728116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788440.1|1728689_1730318_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	23.7	5.7e-19
WP_168788441.1|1730343_1730688_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_168788442.1|1730687_1731404_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_168788443.1|1731405_1731966_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168788444.1|1731984_1732833_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_168788445.1|1732843_1733824_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_168788446.1|1734005_1735325_-	MFS transporter	NA	NA	NA	NA	NA
WP_168788447.1|1735478_1736534_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_168788448.1|1736740_1737742_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788449.1|1738860_1739358_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_168788450.1|1739360_1741091_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_168789069.1|1741066_1741510_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_168789070.1|1742009_1743134_-	porin	NA	NA	NA	NA	NA
WP_168789071.1|1743330_1746030_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_168788451.1|1746266_1747208_+	universal stress protein	NA	NA	NA	NA	NA
WP_168788452.1|1747334_1747709_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_168789072.1|1748207_1749209_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788453.1|1749454_1751257_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_168788454.1|1752198_1752369_-	DNA-binding protein HU	NA	NA	NA	NA	NA
WP_168788455.1|1752454_1752649_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168788456.1|1752959_1754723_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_168788457.1|1755005_1755329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788458.1|1755764_1756121_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_168788459.1|1756214_1757246_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_168788460.1|1757671_1757902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788461.1|1758063_1759080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788462.1|1759504_1760536_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788463.1|1761942_1763007_+	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	53.6	1.0e-101
WP_168788464.1|1763043_1763463_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788465.1|1763522_1764695_-	amidohydrolase	NA	NA	NA	NA	NA
WP_168789073.1|1764784_1766212_-	amidase family protein	NA	NA	NA	NA	NA
WP_168788466.1|1766298_1767378_-	porin	NA	NA	NA	NA	NA
WP_168788467.1|1767509_1768838_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	39.6	3.0e-79
WP_168788468.1|1768967_1769924_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788469.1|1770945_1771401_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_168789074.1|1771397_1771868_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_168788470.1|1771940_1772504_+	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_168788471.1|1772569_1774177_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168788472.1|1774232_1775303_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_168788473.1|1775367_1776282_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_168788474.1|1776283_1777162_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.6e-12
WP_168788475.1|1777158_1777941_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	2.5e-20
WP_168788476.1|1778487_1778682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788477.1|1778804_1779071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788478.1|1779335_1780511_+	porin	NA	NA	NA	NA	NA
WP_168788479.1|1781070_1781640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788480.1|1781937_1782396_-	hypothetical protein	NA	F8TUL1	EBPR_podovirus	33.6	6.7e-10
WP_168789075.1|1784199_1785420_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_168788481.1|1785546_1785909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788482.1|1785905_1787792_-|integrase	integrase	integrase	A0A2H4J185	uncultured_Caudovirales_phage	24.8	2.0e-36
WP_168788483.1|1787788_1789669_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_168788484.1|1789665_1791114_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1791417:1791438	attL	CTTATCTACCCAGCGATATAAG	NA	NA	NA	NA
WP_168787612.1|1791794_1793000_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_168787613.1|1793008_1793887_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F6SJK8	Mycobacterium_phage	27.2	3.4e-10
WP_168788485.1|1794174_1794618_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168788486.1|1794797_1795103_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168787361.1|1795143_1796121_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	49.8	2.6e-80
WP_168789076.1|1796296_1797226_+|integrase	tyrosine-type recombinase/integrase	integrase	R4TQT9	Mycobacterium_phage	27.4	1.2e-05
WP_168787992.1|1797222_1798170_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787993.1|1798162_1799179_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168788487.1|1799179_1799851_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168787615.1|1799847_1800792_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168788488.1|1800788_1801976_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	30.1	2.1e-07
WP_168787361.1|1802003_1802981_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	49.8	2.6e-80
WP_168787613.1|1803496_1804375_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F6SJK8	Mycobacterium_phage	27.2	3.4e-10
WP_168787612.1|1804383_1805589_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_168788489.1|1806155_1807331_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
1805946:1805967	attR	CTTATCTACCCAGCGATATAAG	NA	NA	NA	NA
WP_168789077.1|1808119_1808368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788490.1|1808785_1809055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788491.1|1809514_1810873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788492.1|1811345_1811804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168789078.1|1812160_1813069_-	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	56.8	1.0e-102
WP_168788493.1|1813010_1813772_-|transposase	IS6 family transposase	transposase	A0A0N9SKD3	Staphylococcus_phage	39.5	3.8e-34
>prophage 17
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	2034528	2120020	2486079	integrase,transposase	Mycobacterium_phage(30.0%)	64	2039143:2039202	2049736:2049869
WP_168788315.1|2034528_2035533_-|integrase	site-specific integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	21.5	3.8e-05
WP_168788314.1|2035519_2036905_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168788313.1|2036901_2038158_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2039143:2039202	attL	GCGGCACTATGTACCCTTCCGGGTTATGTCTTGTAGCCGCGTGATAGCGCGTATTCCCGG	NA	NA	NA	NA
WP_168787614.1|2039276_2040515_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	30.1	2.2e-07
WP_168787615.1|2040511_2041456_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168788487.1|2041452_2042124_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168787993.1|2042124_2043141_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168787992.1|2043133_2044081_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787991.1|2044077_2045337_-|integrase	tyrosine-type recombinase/integrase	integrase	R4TQT9	Mycobacterium_phage	27.4	1.6e-05
WP_168787774.1|2045545_2046772_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_168788651.1|2046813_2047485_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168787615.1|2047481_2048426_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787614.1|2048422_2049661_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	30.1	2.2e-07
WP_168788652.1|2050009_2051551_+	acetolactate synthase large subunit	NA	NA	NA	NA	NA
2049736:2049869	attR	CCGGGAATACGCGCTATCACGCGGCTACAAGACATAACCCGGAAGGGTACATAGTGCCGCTTATCTACCCAGCGATATAAGCGTCACACCACCGCCAACGCTCGGTCAGCATACCGACGAGGTGCTCGCATCGC	NA	NA	NA	NA
WP_168788653.1|2051614_2052523_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168788654.1|2052576_2053020_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_168788655.1|2054786_2055083_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_168788656.1|2055150_2055921_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168788657.1|2056335_2057736_+	GntP family permease	NA	NA	NA	NA	NA
WP_168788658.1|2057806_2058988_+	porin	NA	NA	NA	NA	NA
WP_168788659.1|2060264_2061404_+	pimeloyl-CoA dehydrogenase small subunit	NA	NA	NA	NA	NA
WP_168788660.1|2061436_2062186_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_168788661.1|2062213_2063149_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_168789096.1|2063450_2063708_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168788662.1|2064824_2064995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168787361.1|2066708_2067686_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	49.8	2.6e-80
WP_168788663.1|2068480_2069473_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168788664.1|2069598_2070372_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.2	6.9e-07
WP_168789097.1|2070411_2071257_-	oxidoreductase	NA	NA	NA	NA	NA
WP_168787491.1|2071855_2072878_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	7.6e-38
WP_168788665.1|2075573_2076113_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788666.1|2076127_2077063_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788667.1|2077229_2078276_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_168788668.1|2078348_2079047_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_168788669.1|2079080_2079722_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_168788670.1|2081117_2082188_-	porin	NA	NA	NA	NA	NA
WP_168788671.1|2082338_2083361_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_168788672.1|2083357_2085835_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.4e-13
WP_168788673.1|2085850_2087074_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168788674.1|2087555_2087840_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_168789098.1|2087942_2088365_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168789099.1|2088803_2089748_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_168788675.1|2089981_2091031_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_168788676.1|2091051_2091561_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_168788677.1|2091612_2092722_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_168788678.1|2092936_2094295_+	MFS transporter	NA	NA	NA	NA	NA
WP_168788679.1|2094454_2094835_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_168789100.1|2096030_2096579_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	35.6	4.1e-06
WP_168788680.1|2096591_2096855_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168788681.1|2097013_2098105_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168788682.1|2098287_2098914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788683.1|2099201_2100641_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_168788684.1|2101989_2102370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788685.1|2102636_2103152_+	carboxylesterase family protein	NA	A0A0M4JT58	Mollivirus	48.8	1.5e-13
WP_168788686.1|2103418_2104207_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_168788687.1|2104295_2106059_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_168788688.1|2106535_2107627_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168788689.1|2109245_2110379_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_168788690.1|2111585_2112248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788691.1|2112917_2113055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788692.1|2113252_2113537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788693.1|2114000_2115473_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_168788694.1|2117724_2118480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168787994.1|2118589_2120020_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	2128932	2165876	2486079	transposase	Salmonella_phage(14.29%)	29	NA	NA
WP_168788697.1|2128932_2129235_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	61.8	4.9e-25
WP_168788698.1|2129538_2129850_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_168788699.1|2129870_2130110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788700.1|2130299_2131313_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168788701.1|2131402_2132200_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	1.9e-31
WP_168789101.1|2132244_2133087_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_168787361.1|2133928_2134906_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	49.8	2.6e-80
WP_168788702.1|2135738_2136413_+	response regulator	NA	B5LWA6	Feldmannia_species_virus	28.3	3.0e-06
WP_168788703.1|2136607_2137735_+	porin	NA	NA	NA	NA	NA
WP_168788704.1|2137846_2139586_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.0	5.5e-12
WP_168788705.1|2140552_2140924_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_168788706.1|2140920_2141439_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_168788093.1|2142224_2142476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788092.1|2142572_2144210_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_168789021.1|2144303_2145269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788091.1|2145480_2146932_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.5	4.5e-76
WP_168788090.1|2147214_2148165_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168788089.1|2148268_2149306_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_168788088.1|2149347_2150898_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	6.2e-15
WP_168788707.1|2150884_2152135_-	ROK family protein	NA	NA	NA	NA	NA
WP_168788708.1|2152591_2153050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788709.1|2155595_2155868_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168787985.1|2156905_2157922_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168788343.1|2158399_2159419_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168788710.1|2160119_2160566_-	VOC family protein	NA	NA	NA	NA	NA
WP_168788711.1|2160684_2161245_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168789102.1|2161757_2162819_+	asparaginase	NA	NA	NA	NA	NA
WP_168787994.1|2163095_2164526_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_168788712.1|2164853_2165876_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	2216850	2248631	2486079	integrase,transposase	Mycobacterium_phage(50.0%)	24	2216721:2216746	2223626:2223651
2216721:2216746	attL	CACTATGTACCCTTCCGGGTTATGTC	NA	NA	NA	NA
WP_168787614.1|2216850_2218089_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	30.1	2.2e-07
WP_168787615.1|2218085_2219030_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168788487.1|2219026_2219698_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168787993.1|2219698_2220715_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168787992.1|2220707_2221655_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787991.1|2221651_2222911_-|integrase	tyrosine-type recombinase/integrase	integrase	R4TQT9	Mycobacterium_phage	27.4	1.6e-05
WP_168788485.1|2223090_2223534_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168788750.1|2224933_2226271_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.4	2.5e-36
2223626:2223651	attR	GACATAACCCGGAAGGGTACATAGTG	NA	NA	NA	NA
WP_168788689.1|2226422_2227556_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_168787739.1|2227766_2228578_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_168787740.1|2228730_2230026_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_168788751.1|2230469_2231345_+	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_168788752.1|2231588_2231942_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_168788753.1|2232068_2233880_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_168788754.1|2235453_2235765_-	High potential iron-sulfur protein	NA	NA	NA	NA	NA
WP_168788755.1|2235850_2236201_-	cytochrome c	NA	NA	NA	NA	NA
WP_168789104.1|2236211_2237450_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168788756.1|2237737_2238622_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788757.1|2238646_2239735_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_168788758.1|2241241_2242819_-	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_168788759.1|2242867_2244532_+	trehalose synthase	NA	NA	NA	NA	NA
WP_168788760.1|2245159_2246482_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_168788399.1|2246681_2247635_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	67.5	8.2e-119
WP_168787739.1|2247820_2248631_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	2277654	2340157	2486079	integrase,transposase	Escherichia_phage(14.29%)	57	2323052:2323111	2349424:2350952
WP_168787653.1|2277654_2279133_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_168788955.1|2279143_2279911_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.6	6.7e-47
WP_168788776.1|2280120_2280933_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168788777.1|2284018_2284723_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_168788778.1|2284719_2285589_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_168788779.1|2285621_2286674_-|transposase	transposase	transposase	I4AZM3	Saccharomonospora_phage	39.3	3.5e-30
WP_168788780.1|2286763_2288053_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_168788781.1|2288045_2288867_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_168788782.1|2289085_2290108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788783.1|2290104_2290572_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_168789105.1|2291045_2291360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788784.1|2291356_2293078_+	pilus assembly protein PilN	NA	NA	NA	NA	NA
WP_168788785.1|2293205_2293583_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_168788786.1|2293586_2295305_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_168788787.1|2295313_2297224_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_168788788.1|2297227_2298268_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_168788789.1|2298552_2299056_+	prepilin type IV pili	NA	NA	NA	NA	NA
WP_168788790.1|2299074_2300187_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_168788791.1|2300188_2300668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788792.1|2300677_2301964_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_168788793.1|2301976_2302588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788794.1|2302757_2303777_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_168788795.1|2304073_2304436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788796.1|2304475_2304628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788797.1|2304656_2305853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788798.1|2305883_2307164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788799.1|2307391_2308075_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_168788800.1|2308768_2309152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788801.1|2309256_2309691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788802.1|2309699_2310515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168789106.1|2310529_2311105_+	single-stranded DNA-binding protein	NA	I6NRL7	Burkholderia_virus	64.2	3.4e-51
WP_168788803.1|2311379_2312495_+	zinc-binding protein	NA	Q7M2A8	Enterobacteria_phage	37.2	1.3e-09
WP_168788804.1|2312590_2312806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788805.1|2312941_2313133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788806.1|2313246_2313564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788807.1|2313590_2314592_-	PRTRC system protein D	NA	NA	NA	NA	NA
WP_168788808.1|2315762_2316932_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788809.1|2317025_2317673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788810.1|2318151_2318391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788811.1|2318512_2319019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788812.1|2319083_2319296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788813.1|2319617_2319851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788814.1|2320030_2320528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788815.1|2320675_2321005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788816.1|2321521_2321755_-	hypothetical protein	NA	NA	NA	NA	NA
2323052:2323111	attL	ATGCTGCCCGCAACATTCTCGCGGTCGGACGTGACCGCCTCGCAGGAGGAATCCCCGCCC	NA	NA	NA	NA
WP_168787386.1|2323276_2324308_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168788817.1|2325999_2326416_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_168787335.1|2329280_2329433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788818.1|2329413_2329674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168789004.1|2329969_2330401_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787991.1|2330595_2331855_+|integrase	tyrosine-type recombinase/integrase	integrase	R4TQT9	Mycobacterium_phage	27.4	1.6e-05
WP_168787992.1|2331851_2332799_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787993.1|2332791_2333808_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168788819.1|2334813_2335812_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168787487.1|2335808_2336744_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168787486.1|2336740_2337985_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	27.7	1.3e-07
WP_168788820.1|2338903_2340157_-|integrase	tyrosine-type recombinase/integrase	integrase	D6PIF1	uncultured_phage	26.0	9.4e-06
2349424:2350952	attR	ATGCTGCCCGCAACATTCTCGCGGTCGGACGTGACCGCCTCGCAGGAGGAATCCCCGCCCTTTCCGCGCAAGCGGCAGTCGGTCACGACTGAGGGCGGGGAGATGGTATGAACACCTCCCTCCCCTCGGGGAAGTGCCAGGGCCGAAAGGGGCTCTCGCTTGACCGATGGCATCGATGTGCCAAAGTGAAAGTTCCACGAGTCACTTGAGGTAAGGAGAGCCCAAATGAATGCTACGACATATGGTCTGGATATCGCAAAGGCCGTGTTTCAAATGTACTGGGTAGATGGACAAAGTGGCGAGATCTGTAGTCGAAAATTCCGTCGTGAACAGCTGATCCGGTTTCTCGCAACCCGGGCACCAGGAAAGGTGGCGCTGGAGGCATGCGGAGGGGCGCACTGGTGGGCGCGAAAAATCCAGAGTCTCGGACATCAGGTGGTGTTGTTGCATGCGAAATACGTGCGTCCGTTCGTCAAAACCAACAAGACGGATGCGGCAGACGCCCAGGCGATCTGGACGGCGGCCCAGCAACCCGGGATGCGAACTGTGGCGATCAAGAGCGTAGACCAGCAAGCCATCCTGAGCCTGCACCGCATCCGGTCGGGCCTGGTGGCGACACGAACCCGCGAAACCAATCAGATTCGCGGGTTGCTTGCGGAATATGGACTGTACTTCCGATATGGCCGCAAGGCGCTCATGAATGAGCTCAAGGCACGTATGGCCGAGATAGAAGAGGTCGTGCCGCAGCTTGTCTGGCGGGCGTTGTTGCGTCAGCTCGAACAGCTCCAGCAGGTCGAGCAGGGGATTGACGAAGCCGAGCGGGAAAATCTGCAGTGGCTGAAATCCAGTCCCCAGGCAAAAACGCTCGATGACATAGCCGGCGTGGGTCCATTGACAGCCACAGCCACTGTTGCGGTCATGGGCTCGCCAAAGGCATTTCGCTCCGGACGCGCATTTGCGGCGAGTATCGGCCTGGTACCCCGTCAGAGTGGGACTGGGGGCAACGTCAGACTCGGCGGCATCAGCAAAAGGGGTGACCCCTATCTGAGACAGCTATTGATCCATGGCGCGCGAATGGTCGTGACCCATTCCAAACAACGTCCCCAGTGGGTAGAAGCGTTGCTGAAACGGCGTCCGGTCAATGTGGTGGTGGTCGCGTTGGCCAACAAGATGGCACGAACGGCGTGGGCGTTGCTCGCGCATAACCGGTCTTATGAGCGGGAATTTGTGAGCGAGCGACCAGCCGTCGCGGTATAGATTGAAACGATGAGTCTTTGAACACAGGAGTTGCGCAGAGCAAGGGTAACGTGTGATGGCAAACCAGGTCGGACCGTGGAAACGCAAACCTGATGACGTCCATGGGCGTGAAGCCCGCCGTGGGAGATGAGGTCGTTTCCAGCAGATTCCATCAAGGCCAGCGGGCACCGTCTCGCAATGAAGGTCGGATATAAGACTGCAACCGCTTCTGCTAGCCAAAACATCAACCCCCTGCCTTGCGGAACGGGAGGTGTTCATATAAGGACGTCAAG	NA	NA	NA	NA
>prophage 21
NZ_CP051514	Paraburkholderia aromaticivorans strain AR20-38 chromosome 1, complete sequence	2486079	2362521	2425384	2486079	transposase	Salmonella_phage(28.57%)	58	NA	NA
WP_168787774.1|2362521_2363748_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_168788841.1|2363786_2363948_+	PRTRC system protein C	NA	NA	NA	NA	NA
WP_168788842.1|2363940_2364156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788843.1|2364167_2365175_+	PRTRC system protein F	NA	NA	NA	NA	NA
WP_168788844.1|2365193_2365916_+	PRTRC system protein B	NA	NA	NA	NA	NA
WP_168788845.1|2365912_2366551_+	PRTRC system protein A	NA	NA	NA	NA	NA
WP_168788846.1|2366550_2367357_+	PRTRC system ThiF family protein	NA	NA	NA	NA	NA
WP_168788847.1|2367353_2367560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788848.1|2367597_2367891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788849.1|2367994_2369080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788850.1|2369579_2370053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168789108.1|2370142_2370535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788851.1|2370543_2371026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788852.1|2371636_2372122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788853.1|2372575_2372902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788854.1|2373028_2373400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788855.1|2373705_2374248_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_168787617.1|2375672_2376980_+	group II intron reverse transcriptase/maturase	NA	H7BVN0	unidentified_phage	24.9	1.5e-09
WP_168788856.1|2377358_2377589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168789109.1|2378657_2379716_+	ATP-binding protein	NA	E9NIF8	Enterobacter_phage	31.0	3.7e-27
WP_168789110.1|2379826_2380756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788857.1|2380763_2382050_+	hypothetical protein	NA	M4SNG8	Pseudoalteromonas_phage	25.3	2.5e-30
WP_168788858.1|2382344_2383400_+	CpaF family protein	NA	NA	NA	NA	NA
WP_168788859.1|2383413_2383779_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_168788860.1|2383788_2384109_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_168788861.1|2384122_2386591_+	type IV secretion system protein VirB4	NA	NA	NA	NA	NA
WP_168788862.1|2386601_2387357_+	DUF4141 domain-containing protein	NA	NA	NA	NA	NA
WP_168788863.1|2387393_2388455_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_168788864.1|2388527_2389718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788865.1|2389810_2391013_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_168788866.1|2391009_2392878_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_168788867.1|2392883_2393402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788868.1|2393358_2393619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788869.1|2393611_2394214_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_168788870.1|2395406_2395727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788871.1|2395935_2396844_+	ATPase	NA	NA	NA	NA	NA
WP_168788872.1|2396849_2398580_+	ATP-dependent helicase	NA	S5M596	Bacillus_phage	25.0	1.2e-30
WP_168788873.1|2398693_2398876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788874.1|2399016_2399187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788875.1|2399560_2400079_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_168788876.1|2400231_2401290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788877.1|2401367_2401961_-	DUF1845 domain-containing protein	NA	NA	NA	NA	NA
WP_168788878.1|2402701_2404099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788879.1|2404387_2405746_+	metallophosphatase family protein	NA	NA	NA	NA	NA
WP_168788880.1|2405826_2406363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168788881.1|2406350_2408672_+	SMC family ATPase	NA	NA	NA	NA	NA
WP_168787386.1|2409080_2410112_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168789111.1|2410500_2411058_+	hypothetical protein	NA	A0A1B2LRT6	Wolbachia_phage	42.3	2.8e-10
WP_168788882.1|2411032_2411392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788883.1|2413274_2413520_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168788884.1|2413516_2413915_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_168788885.1|2414177_2415392_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	54.0	5.2e-118
WP_168788886.1|2415630_2417013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168788887.1|2417603_2417888_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_168788888.1|2417875_2418178_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_168787386.1|2421244_2422276_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_168788949.1|2422338_2423649_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	53.9	5.2e-116
WP_168788889.1|2424001_2425384_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP051515	Paraburkholderia aromaticivorans strain AR20-38 chromosome 2, complete sequence	3638240	1854141	1865423	3638240	tail,plate	Bacillus_phage(50.0%)	11	NA	NA
WP_168790607.1|1854141_1857078_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_168790608.1|1857074_1857491_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_168790609.1|1857567_1858215_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_168790610.1|1858211_1859282_-	phage late control D family protein	NA	NA	NA	NA	NA
WP_168790611.1|1859278_1860004_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168790612.1|1859994_1860957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168790613.1|1861693_1861933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168790614.1|1862693_1863125_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_168790615.1|1863304_1863673_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_168790616.1|1863669_1864116_-|tail	phage tail protein	tail	J9PV93	Bacillus_phage	38.2	1.7e-21
WP_168790617.1|1864130_1865423_-|tail	phage tail sheath family protein	tail	A0A1C3NFK8	Phage_NCTB	27.3	8.5e-10
>prophage 1
NZ_CP051516	Paraburkholderia aromaticivorans strain AR20-38 chromosome 3, complete sequence	4573438	148402	155929	4573438	integrase	Streptococcus_phage(33.33%)	9	138117:138131	160062:160076
138117:138131	attL	TCGTGCTCGAACCGG	NA	NA	NA	NA
WP_168792291.1|148402_149032_-	exonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	39.4	2.8e-35
WP_168792292.1|149028_149673_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.2	2.0e-20
WP_168792293.1|150280_150913_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	58.3	3.8e-19
WP_168792294.1|151040_151919_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.6	3.6e-36
WP_168795688.1|151998_152421_+	YraN family protein	NA	NA	NA	NA	NA
WP_168792295.1|152636_153224_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	34.8	6.1e-16
WP_168792296.1|153250_154048_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_168792297.1|154044_154395_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_168792298.1|154711_155929_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	55.6	9.5e-120
160062:160076	attR	TCGTGCTCGAACCGG	NA	NA	NA	NA
>prophage 2
NZ_CP051516	Paraburkholderia aromaticivorans strain AR20-38 chromosome 3, complete sequence	4573438	567950	577302	4573438		Hokovirus(16.67%)	7	NA	NA
WP_168792630.1|567950_569903_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	48.8	1.5e-146
WP_168792631.1|570169_571309_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	6.3e-25
WP_168792632.1|571334_573251_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	35.1	8.1e-49
WP_168792633.1|573589_574405_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	29.6	3.1e-34
WP_168792634.1|574444_575125_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	28.1	3.3e-05
WP_168792635.1|575121_575670_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_168792636.1|575718_577302_-	polynucleotide adenylyltransferase PcnB	NA	A0A172Q0J1	Acinetobacter_phage	30.6	2.6e-16
>prophage 3
NZ_CP051516	Paraburkholderia aromaticivorans strain AR20-38 chromosome 3, complete sequence	4573438	1088421	1107911	4573438	terminase,tail,portal	uncultured_Caudovirales_phage(22.22%)	15	NA	NA
WP_168793014.1|1088421_1091121_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	44.0	2.6e-93
WP_168793015.1|1091359_1092142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793016.1|1092393_1093149_+	hypothetical protein	NA	A0A291AUT0	Sinorhizobium_phage	35.0	9.7e-22
WP_168793017.1|1093363_1094011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793018.1|1093958_1096031_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	35.9	1.0e-97
WP_168795729.1|1096033_1096237_+	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	44.3	5.8e-06
WP_168793019.1|1096238_1097708_+|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	38.0	4.0e-80
WP_168793020.1|1097778_1099842_+	peptidase U35	NA	A0A076G7Y9	Pseudoalteromonas_phage	32.9	5.6e-64
WP_168793021.1|1099907_1100237_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_168793022.1|1100233_1100545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793023.1|1100541_1100973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793024.1|1101029_1101959_+	hypothetical protein	NA	G8EY04	Synechococcus_phage	38.8	1.3e-49
WP_168793025.1|1102038_1102368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793026.1|1102469_1102757_+	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	36.0	6.3e-06
WP_168793027.1|1102790_1107911_+|tail	phage tail tape measure protein	tail	L7P7M2	Pseudomonas_phage	29.5	9.1e-31
>prophage 4
NZ_CP051516	Paraburkholderia aromaticivorans strain AR20-38 chromosome 3, complete sequence	4573438	1808488	1851532	4573438	terminase,plate,portal,tail,head,capsid,tRNA	Burkholderia_virus(22.22%)	59	NA	NA
WP_168793553.1|1808488_1809490_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_168793554.1|1809747_1810566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793555.1|1810610_1811738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168793556.1|1811796_1812024_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_168793557.1|1812685_1812946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793558.1|1812960_1813914_-	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	60.0	8.5e-108
WP_168793559.1|1813946_1814540_+	hypothetical protein	NA	Q8W6Q5	Burkholderia_virus	36.8	1.3e-08
WP_168793560.1|1814576_1815290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793561.1|1815315_1815663_-	DUF4031 domain-containing protein	NA	A0A291LA06	Bordetella_phage	77.9	4.0e-39
WP_168793562.1|1815661_1816393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168792180.1|1816524_1816845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168793563.1|1816987_1818937_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_168793564.1|1818954_1819383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168792181.1|1819628_1820186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168793565.1|1820359_1821097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168793566.1|1821101_1821371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168793567.1|1821379_1821580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168793568.1|1821678_1821930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793569.1|1822447_1823056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168793570.1|1823131_1823398_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	48.4	1.8e-07
WP_168793571.1|1823489_1823669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168793572.1|1823730_1824015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168793573.1|1824205_1824607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793574.1|1824603_1824792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793575.1|1824803_1824959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793576.1|1824960_1825239_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168793577.1|1825273_1825804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793578.1|1825800_1826991_+	hypothetical protein	NA	C5IHL2	Burkholderia_virus	59.4	1.8e-30
WP_168793579.1|1826987_1827212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168795764.1|1827454_1827796_+	DUF1064 domain-containing protein	NA	H2DE79	Erwinia_phage	59.6	1.0e-26
WP_168793580.1|1827822_1828059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793581.1|1828071_1828419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168795765.1|1828577_1828877_+	hypothetical protein	NA	Q3HR02	Burkholderia_phage	49.4	7.9e-20
WP_168793582.1|1828869_1829484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793583.1|1829664_1830285_+	DNA-binding protein	NA	Q3HR05	Burkholderia_phage	42.3	1.3e-32
WP_168793584.1|1830366_1831563_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_168793585.1|1831740_1832058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168793586.1|1832307_1832562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793587.1|1832546_1833224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793588.1|1833371_1834082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793589.1|1834074_1836168_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	31.9	2.6e-85
WP_168793590.1|1836173_1836443_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_168793591.1|1836442_1838095_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	32.9	5.3e-73
WP_168793592.1|1838091_1838976_+	S49 family peptidase	NA	A0A1I9KF73	Aeromonas_phage	39.7	9.5e-53
WP_168793593.1|1839344_1839650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793594.1|1839691_1840348_+|head	head decoration protein	head	NA	NA	NA	NA
WP_168793595.1|1840418_1841456_+|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	41.2	4.4e-65
WP_168793596.1|1841457_1841775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793597.1|1841771_1842326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168793598.1|1842336_1842603_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_168793599.1|1842603_1844118_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	47.4	4.8e-105
WP_168793600.1|1844182_1844566_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_168793601.1|1844569_1844875_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_168793602.1|1844981_1846814_+	hypothetical protein	NA	Q6UIY6	Burkholderia_virus	32.1	2.4e-05
WP_168793603.1|1846810_1848247_+	DNA circulation family protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	24.8	1.9e-10
WP_168793604.1|1848250_1849321_+	hypothetical protein	NA	B5TK72	Pseudomonas_phage	32.7	1.4e-42
WP_168793605.1|1849317_1849917_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_168793606.1|1849913_1850369_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.7	2.9e-21
WP_168793607.1|1850368_1851532_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	30.5	6.0e-23
>prophage 5
NZ_CP051516	Paraburkholderia aromaticivorans strain AR20-38 chromosome 3, complete sequence	4573438	3691644	3705637	4573438	protease	Salmonella_phage(12.5%)	11	NA	NA
WP_168795020.1|3691644_3692091_+	dUTP diphosphatase	NA	S4TNT3	Salmonella_phage	63.3	1.6e-45
WP_168795021.1|3692490_3695001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168795022.1|3695067_3697365_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.6	4.2e-169
WP_012434130.1|3697361_3697676_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	7.6e-13
WP_007180614.1|3698228_3698435_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	2.4e-23
WP_168795023.1|3698632_3699448_-	hypothetical protein	NA	Q98453	Paramecium_bursaria_Chlorella_virus	34.8	8.2e-35
WP_168795024.1|3699752_3701009_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	66.7	1.4e-12
WP_168795025.1|3701342_3701912_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011489640.1|3702367_3702562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168795026.1|3702707_3703214_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	40.2	2.5e-13
WP_168795027.1|3703531_3705637_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	1.0e-60
