The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	5196	33650	5024521	holin,lysis,portal,plate,tRNA,head,terminase,capsid,tail	Escherichia_phage(43.33%)	36	NA	NA
WP_000038193.1|5196_6231_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	2.1e-200
WP_073470713.1|6230_8003_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_073470712.1|8176_9031_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	97.2	2.8e-134
WP_001719219.1|9089_10163_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.4	2.5e-201
WP_073470711.1|10166_10910_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	97.6	1.9e-123
WP_000988628.1|11009_11519_+|head	head completion/stabilization protein	head	Q858W4	Yersinia_virus	100.0	3.0e-91
WP_000846399.1|11518_11722_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|11725_12007_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144093.1|12006_12504_+	glycoside hydrolase family 104 protein	NA	Q7Y4E4	Escherichia_virus	100.0	6.2e-94
WP_001605748.1|12518_12944_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	1.7e-60
WP_000040681.1|12931_13357_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	100.0	1.0e-68
WP_032239003.1|13464_13932_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.8	4.8e-80
WP_021578878.1|13924_14377_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	4.5e-75
WP_073470709.1|14448_15234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021525814.1|15317_15953_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	8.5e-112
WP_000127164.1|15949_16297_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121470.1|16301_17210_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	3.4e-162
WP_001285325.1|17202_17733_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_168848233.1|17743_20062_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.6	3.7e-213
WP_073470708.1|20065_20593_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	1.4e-91
WP_073470707.1|20594_20876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073470706.1|21078_21411_+	protein flxA	NA	NA	NA	NA	NA
WP_001286709.1|21861_23052_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_073470705.1|23064_23583_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	98.8	1.6e-92
WP_001031303.1|23639_23915_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|23947_24067_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_168848234.1|24059_26507_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.7	0.0e+00
WP_073470703.1|26521_27001_+|tail	phage tail protein	tail	O64315	Escherichia_phage	97.5	1.3e-83
WP_001747944.1|27000_28164_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	2.4e-205
WP_000468308.1|28245_28464_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|28737_30099_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001220181.1|30201_30498_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|30499_30796_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001298852.1|31004_31337_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|31527_32250_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|32246_33650_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 2
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	147512	226793	5024521	holin,transposase,portal,plate,head,terminase,capsid,tail,integrase	Escherichia_phage(23.08%)	96	137845:137859	182505:182519
137845:137859	attL	ATTAAAAGAAATAAA	NA	NA	NA	NA
WP_000091777.1|147512_148541_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	55.0	1.6e-96
WP_076796145.1|148540_148756_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	69.0	7.9e-22
WP_000916333.1|148965_149148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139496453.1|149147_149717_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	1.8e-36
WP_168848245.1|149713_151933_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.5	2.6e-99
WP_139496451.1|151963_152293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165370301.1|153239_153653_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	68.1	7.1e-43
WP_000846364.1|153721_153919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139496450.1|153978_154455_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.1e-23
WP_000943913.1|154494_154719_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	56.8	1.1e-18
WP_139496449.1|154721_155786_+	replication protein RepO	NA	C8CGZ1	Staphylococcus_phage	53.9	7.7e-33
WP_139496474.1|155794_157192_+	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	45.5	1.3e-99
WP_000192614.1|157230_157632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001002789.1|157861_158086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000466604.1|158273_158495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089638956.1|158767_159562_+	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	74.6	2.8e-48
WP_001237643.1|159739_160663_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_097341278.1|161171_161972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085456282.1|163143_163749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|163758_164247_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001559328.1|164814_165093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264586.1|165211_165853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|166004_166184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057009.1|166261_166858_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.6	3.0e-71
WP_000717782.1|166854_167148_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.6	5.0e-35
WP_139496447.1|167147_167819_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	31.9	2.0e-15
WP_001294589.1|167931_168315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|168314_168587_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_139496446.1|168586_169066_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	1.3e-61
WP_071791986.1|169407_169686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264476.1|169682_169976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139496445.1|170291_170537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139496444.1|170909_171476_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	42.9	3.8e-31
WP_139496473.1|171462_173328_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	2.2e-192
WP_059245267.1|173324_173558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139496443.1|173554_175126_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.5	3.9e-190
WP_139496442.1|175125_176433_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	55.1	4.7e-109
WP_052424403.1|176432_176762_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	38.4	2.6e-08
WP_168848246.1|176820_177855_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	57.1	3.5e-107
WP_039264474.1|177885_178293_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_168848247.1|178289_178670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168848248.1|178701_179382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139496440.1|179378_179915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264469.1|179895_180798_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_047621011.1|180800_181142_+|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.8e-20
WP_039264467.1|181138_182059_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.4	7.0e-67
WP_139496439.1|182061_182688_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	43.9	7.0e-26
182505:182519	attR	ATTAAAAGAAATAAA	NA	NA	NA	NA
WP_001559300.1|183639_183873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168848249.1|183878_185372_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	34.3	3.4e-71
WP_039264464.1|185389_185902_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000444666.1|185914_186196_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_139496437.1|186304_187945_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	27.0	5.4e-17
WP_047621042.1|187980_188370_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	40.3	5.3e-16
WP_168848250.1|188348_188591_-	superinfection immunity protein	NA	M4MA40	Vibrio_phage	46.9	1.8e-06
WP_047621003.1|188607_188820_+|tail	tail protein X	tail	NA	NA	NA	NA
WP_139496435.1|188823_189867_+	late control protein	NA	R9TNM7	Vibrio_phage	29.3	1.3e-32
WP_168848251.1|189872_190880_+|tail	phage tail protein	tail	A0A0A0RQF3	Escherichia_phage	29.1	8.4e-05
WP_001079074.1|191858_192389_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001007759.1|192731_193382_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240105.1|193638_194274_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000730130.1|194274_195279_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|195387_195801_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|195933_196605_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_168848252.1|196604_197963_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_168848253.1|198069_198921_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_168848254.1|199511_200726_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.5	4.0e-102
WP_168848255.1|201291_201657_+	permease	NA	NA	NA	NA	NA
WP_054626318.1|201696_202392_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157252.1|202458_203877_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	4.0e-101
WP_000785994.1|203857_204328_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
WP_001212228.1|204316_205237_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|205409_206327_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009306.1|206405_206588_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_021293342.1|206730_208425_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000491501.1|208421_209237_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|209534_209762_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_071524607.1|209870_210113_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103994.1|210156_210780_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000983976.1|211069_211855_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|211863_212133_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253450.1|212142_212880_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_021562270.1|212879_213245_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_139496433.1|213247_213661_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|213657_214662_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133124.1|214666_215131_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620091.1|215235_216363_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807587.1|216359_216803_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213294.1|216821_218195_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282706.1|218194_218881_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|218873_219869_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_139496432.1|219861_221520_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274292.1|221734_222049_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070441.1|222382_222715_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000734031.1|222883_223435_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879833.1|223444_224242_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000826451.1|225629_226793_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	8.9e-200
>prophage 3
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	246369	279874	5024521	holin,integrase,portal,plate,head,terminase,capsid,tail	Enterobacteria_phage(81.58%)	45	245307:245366	279981:280101
245307:245366	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078920.1|246369_246510_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|246701_246962_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001317900.1|247251_248391_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_021525649.1|248790_249900_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	4.8e-195
WP_029364402.1|250057_251242_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	7.3e-226
WP_000290450.1|251241_251754_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_029364400.1|251808_252168_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	3.5e-54
WP_000333494.1|252176_252332_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_168848257.1|252318_255126_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.7	0.0e+00
WP_000979954.1|255138_255627_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_168848258.1|255747_256158_-|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	78.9	4.3e-24
WP_168848259.1|256157_258041_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	54.0	9.9e-84
WP_029364295.1|258037_258646_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	75.9	2.4e-87
WP_001111925.1|258638_259535_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.3	7.1e-157
WP_000213447.1|259538_259889_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271927.1|259885_260467_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.5	7.7e-104
WP_000356367.1|260463_261099_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	98.6	2.0e-113
WP_000920602.1|261091_261559_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	5.9e-86
WP_000780572.1|261696_262104_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000072327.1|262100_262493_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|262489_262813_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864913.1|262815_263016_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	2.3e-31
WP_168848260.1|263015_263510_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
WP_168848261.1|263612_264413_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	1.4e-124
WP_001055112.1|264458_265511_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
WP_168848262.1|265534_266365_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.5	2.4e-146
WP_000613781.1|266526_268278_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_000087812.1|268277_269324_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_032267970.1|270802_273586_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.2	0.0e+00
WP_000564228.1|273582_273972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447282.1|273968_274586_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104296.1|274597_274897_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	2.8e-41
WP_000153707.1|274893_275160_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985163.1|275156_275360_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	1.9e-25
WP_168848263.1|275383_275800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021654.1|275892_276006_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000514277.1|276002_276245_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159462.1|276256_276535_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_029364413.1|276545_276896_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.7	2.5e-49
WP_000014504.1|276917_277121_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|277192_277330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|277419_277824_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290349.1|277839_278490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|278519_278867_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|278872_279874_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
279981:280101	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTT	NA	NA	NA	NA
>prophage 4
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	603049	657845	5024521	lysis,portal,head,terminase,capsid,tail	Enterobacteria_phage(33.33%)	72	NA	NA
WP_050940319.1|603049_605476_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.0e-213
WP_001307224.1|605674_605980_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|606087_606798_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|606800_607361_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|607395_607737_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|607871_608198_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_168848287.1|608403_609618_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	8.2e-47
WP_000836057.1|609629_610649_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001389342.1|610706_610835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|610836_612117_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_000005552.1|612151_612403_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_021511903.1|612475_614947_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|615040_615232_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|615228_615417_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|615816_615981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168848288.1|615984_616203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379578.1|616362_616518_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000381212.1|616686_617094_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_168848289.1|617174_617402_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_168848290.1|617385_617907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054509.1|617887_618853_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
WP_168848291.1|618893_619316_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.3	1.7e-63
WP_001374839.1|619312_619669_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	4.8e-40
WP_000955176.1|620975_621158_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	1.7e-12
WP_001317460.1|623113_623446_-	protein flxA	NA	NA	NA	NA	NA
WP_168848292.1|623648_623954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|623978_624218_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|624217_624505_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|624576_624732_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|624948_625200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|625266_625545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168848293.1|625546_626596_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	2.2e-112
WP_001047135.1|626609_627362_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|627639_627729_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|627783_627996_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|628296_628512_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|629265_629481_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189915.1|629485_629797_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|629793_630327_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|630323_630821_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|631184_631397_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|631407_631596_+	cold-shock protein	NA	NA	NA	NA	NA
WP_168848530.1|631598_631664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|631743_631899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|632070_632244_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|632395_632806_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|632863_633097_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453611.1|633485_634031_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_053879349.1|634005_635931_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|635927_636134_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001349645.1|636130_637732_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	3.5e-311
WP_000123317.1|637712_639032_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
WP_168848294.1|639041_639374_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	9.3e-54
WP_000063254.1|639429_640455_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_000158854.1|640494_640893_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	89.4	1.8e-56
WP_000752996.1|640904_641258_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_000975111.1|641269_641848_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	3.9e-79
WP_000683128.1|641844_642240_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001360166.1|642247_642988_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.2	5.0e-132
WP_000479206.1|643003_643426_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	81.4	6.1e-58
WP_000459458.1|643407_643842_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_168848295.1|643834_646414_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.1	0.0e+00
WP_000847331.1|646410_646740_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152624.1|646739_647438_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
WP_000194780.1|647443_648187_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_168848296.1|648123_648756_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	1.9e-95
WP_168848297.1|648816_652215_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.8	0.0e+00
WP_001230359.1|652281_652881_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_168848298.1|652945_656251_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	68.2	8.2e-275
WP_168848299.1|656522_657113_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	5.6e-25
WP_000836768.1|657429_657663_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|657731_657845_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
>prophage 5
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	1183523	1235320	5024521	integrase,transposase	Escherichia_phage(11.11%)	36	1177690:1177708	1232898:1232916
1177690:1177708	attL	TTGGAGAAGCGCAGAAAAA	NA	NA	NA	NA
WP_065304412.1|1183523_1184504_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	4.4e-184
WP_065304411.1|1185216_1185912_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_050019109.1|1185904_1187332_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102105.1|1187342_1188062_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000683099.1|1188136_1189834_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000545263.1|1190264_1191818_+	L-lactate permease	NA	NA	NA	NA	NA
WP_000227970.1|1192572_1193649_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000716410.1|1198194_1199691_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_000108760.1|1199790_1200717_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001313183.1|1200746_1201058_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001313182.1|1201119_1201323_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000523728.1|1201328_1201844_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000813683.1|1201907_1203338_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_001099190.1|1203334_1204612_-	MFS transporter	NA	NA	NA	NA	NA
WP_000433621.1|1204666_1206793_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_000053329.1|1206886_1207897_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	28.3	5.1e-18
WP_001354443.1|1208322_1209309_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.9	1.4e-166
WP_034167421.1|1209399_1210188_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	75.7	3.0e-90
WP_020219278.1|1210238_1210652_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_071961403.1|1210653_1211979_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_020219276.1|1211971_1213990_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_168848331.1|1213998_1216419_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_086598315.1|1217004_1218399_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.1	1.3e-19
WP_077625517.1|1218400_1219369_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	1.3e-180
WP_000005572.1|1219760_1221047_-	McrC family protein	NA	NA	NA	NA	NA
WP_039025853.1|1221039_1223097_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	2.9e-36
WP_001013334.1|1223869_1224295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270989.1|1224291_1224675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063082222.1|1225046_1225640_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_065304406.1|1226848_1228672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001349431.1|1228772_1229021_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000164162.1|1229036_1230602_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000279862.1|1230825_1232034_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.2	6.5e-44
WP_000611858.1|1232581_1233568_-	hypothetical protein	NA	NA	NA	NA	NA
1232898:1232916	attR	TTGGAGAAGCGCAGAAAAA	NA	NA	NA	NA
WP_000627403.1|1233564_1234056_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_085948468.1|1234158_1235320_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 6
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	1403570	1489418	5024521	protease,lysis,integrase,transposase,portal,tRNA,plate,head,terminase,capsid,tail	Salmonella_phage(61.82%)	94	1412843:1412857	1489566:1489580
WP_001241678.1|1403570_1404275_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1404559_1404778_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1405462_1407739_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1407769_1408090_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_001596797.1|1408876_1409158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001504098.1|1409160_1409646_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	66.9	3.9e-48
WP_063085899.1|1409902_1411816_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	56.9	1.4e-213
WP_001475270.1|1411908_1412082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126661.1|1412445_1412868_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
1412843:1412857	attL	CCGTAAGCCGCTATC	NA	NA	NA	NA
WP_000125509.1|1412864_1413110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000710150.1|1413397_1415215_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	1.5e-129
WP_001261491.1|1415211_1415511_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_097404659.1|1415517_1415838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072250137.1|1415830_1416739_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001206971.1|1416749_1416959_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	69.6	3.4e-17
WP_021533365.1|1417378_1418617_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.5	4.5e-125
WP_000410785.1|1419021_1419246_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_001594926.1|1419318_1421265_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|1421261_1422377_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001309384.1|1422533_1423484_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599806.1|1423480_1425139_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|1425565_1426261_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|1426754_1427654_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|1427797_1429450_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_032178971.1|1429461_1430430_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|1430562_1432281_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|1432317_1433319_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|1433329_1434760_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|1434858_1435872_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_063069787.1|1435868_1436699_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	4.3e-07
WP_001160737.1|1436695_1437019_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|1437144_1437660_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1437877_1438606_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|1438623_1439355_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001684.1|1439361_1440078_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|1440077_1440746_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_000399648.1|1440885_1441866_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001295905.1|1442316_1443048_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149703.1|1443222_1444350_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|1444390_1444879_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|1444938_1445784_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093862.1|1445780_1446734_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996018.1|1446743_1447877_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126084.1|1447971_1449084_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1449434_1449911_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1449998_1450901_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_168848343.1|1450961_1451684_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|1451667_1451955_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|1452114_1452372_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|1452401_1452779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|1453048_1454734_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|1454969_1455188_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_089069159.1|1455278_1456379_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	4.9e-176
WP_089560395.1|1456375_1456861_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.4e-66
WP_097565893.1|1456857_1459935_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000763311.1|1459927_1460047_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281016.1|1460061_1460364_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_001207660.1|1460418_1460934_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046131.1|1460943_1462116_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	3.9e-203
WP_039000732.1|1462222_1462636_-|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	74.3	1.5e-21
WP_168848344.1|1462635_1464555_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	46.2	1.4e-80
WP_072664297.1|1464551_1465157_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	1.3e-109
WP_000268294.1|1465149_1466058_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_038999997.1|1466044_1466404_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_097565925.1|1466400_1466979_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.4e-92
WP_032200200.1|1467047_1467494_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	86.3	3.0e-63
WP_097565924.1|1467486_1467918_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	1.3e-71
WP_032200198.1|1468013_1468442_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	2.2e-47
WP_038999994.1|1468438_1468816_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.8e-16
WP_001069905.1|1468817_1469330_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|1469310_1469526_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_029364122.1|1469529_1469733_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	4.4e-30
WP_029364121.1|1469732_1470197_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	5.5e-76
WP_000059191.1|1470292_1470943_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742511.1|1470946_1472005_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216237.1|1472021_1472855_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001098431.1|1472997_1474764_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_168848345.1|1474763_1475795_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.6	8.5e-170
WP_168848346.1|1475844_1477602_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_028985770.1|1478292_1479336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029364119.1|1479332_1481192_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001217575.1|1481336_1481570_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|1481580_1481769_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_168848347.1|1481921_1484336_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_029364117.1|1484332_1485190_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	1.2e-161
WP_000752613.1|1485186_1485414_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244209.1|1485413_1485647_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	2.4e-32
WP_000996717.1|1485714_1486056_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|1486173_1486470_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_168848348.1|1486477_1486987_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	2.9e-86
WP_000188450.1|1487051_1487255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024220196.1|1487400_1487970_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	4.2e-38
WP_000900883.1|1487985_1488177_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290937.1|1488365_1489418_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
1489566:1489580	attR	GATAGCGGCTTACGG	NA	NA	NA	NA
>prophage 7
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	1791999	1857221	5024521	protease,lysis,integrase,transposase,portal,tRNA,head,terminase,capsid,tail	Enterobacteria_phage(50.94%)	73	1800480:1800526	1847014:1847060
WP_168848366.1|1791999_1793136_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001580085.1|1795628_1798601_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224566.1|1798601_1799492_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|1799674_1800436_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1800480:1800526	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|1800950_1801904_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226375.1|1802090_1803575_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168848367.1|1804119_1804788_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885570.1|1804842_1805427_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_045133724.1|1805426_1808453_-|tail	tail protein	tail	U5N099	Enterobacteria_phage	81.4	3.6e-67
WP_001230378.1|1808517_1809117_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	4.4e-110
WP_168848368.1|1809183_1812582_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_168848369.1|1812642_1813275_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	3.8e-96
WP_000194779.1|1813211_1813955_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152652.1|1813960_1814659_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
WP_000847362.1|1814658_1814988_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	1.4e-57
WP_000840260.1|1814984_1817546_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.3	0.0e+00
WP_000459458.1|1817538_1817973_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000479206.1|1817954_1818377_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	81.4	6.1e-58
WP_001360166.1|1818392_1819133_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.2	5.0e-132
WP_000683128.1|1819140_1819536_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000975111.1|1819532_1820111_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	3.9e-79
WP_000752996.1|1820122_1820476_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_000158854.1|1820487_1820886_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	89.4	1.8e-56
WP_000063288.1|1820925_1821951_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	5.2e-188
WP_001299443.1|1822006_1822339_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_168848370.1|1822348_1823668_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	4.0e-233
WP_168848371.1|1823648_1825250_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	8.5e-310
WP_000198149.1|1825246_1825453_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_139496554.1|1825449_1827375_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|1827349_1827895_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|1828283_1828478_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738421.1|1828837_1829131_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|1829221_1829404_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|1829620_1830118_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|1830117_1830333_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_139496555.1|1830921_1832019_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.0	1.1e-154
WP_001204780.1|1832208_1832592_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971055.1|1832677_1832818_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|1832814_1833177_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|1833173_1833464_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224919.1|1833456_1833627_-	NinE family protein	NA	NA	NA	NA	NA
WP_001053032.1|1833626_1834082_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.8e-60
WP_072130332.1|1834078_1834180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379698.1|1834269_1834626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032351880.1|1835087_1835411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709083.1|1835522_1837049_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001070451.1|1837306_1837639_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|1837706_1838009_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788813.1|1838005_1838707_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_001551200.1|1838703_1839633_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.0e-111
WP_001182903.1|1839719_1840259_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|1840328_1840559_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259987.1|1840597_1841353_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000233576.1|1841948_1842155_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|1842230_1842527_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|1842532_1843318_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|1843314_1843995_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682294.1|1843991_1844153_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000129285.1|1844145_1844703_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_077250124.1|1844713_1844995_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	7.9e-46
WP_000763390.1|1845093_1845312_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|1845359_1845638_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000051902.1|1845836_1847000_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805428.1|1847334_1847967_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1847014:1847060	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250422.1|1847969_1848485_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691043.1|1848495_1849503_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_168848372.1|1849515_1852125_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988366.1|1852155_1852848_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001369891.1|1853067_1853610_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|1854090_1854957_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1854958_1855171_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|1855278_1855800_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|1855835_1857221_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 8
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	2087093	2170340	5024521	holin,protease,integrase,portal,head,terminase,capsid,tail	Shigella_phage(35.85%)	84	2124462:2124517	2166429:2166484
WP_168848384.1|2087093_2089127_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001299022.1|2089255_2089843_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_096147211.1|2089856_2091329_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|2091342_2093013_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_096147210.1|2093225_2093891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358288.1|2094136_2094832_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023906.1|2094824_2096252_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102119.1|2096262_2096982_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339593.1|2097508_2098363_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046329.1|2098588_2099914_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	1.0e-114
WP_000474077.1|2100022_2100259_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001296896.1|2100270_2100864_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|2101023_2101893_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001358290.1|2102141_2102999_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_139496352.1|2103119_2107373_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|2108488_2108590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|2108951_2109215_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|2109214_2109355_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|2109389_2109617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|2110439_2110982_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730974.1|2111056_2111644_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716394.1|2111701_2112370_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_073840925.1|2112395_2114921_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001323478.1|2114910_2116554_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|2116522_2117233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032144344.1|2117545_2117875_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000070694.1|2119152_2119842_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643332.1|2119838_2120795_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_168848385.1|2120791_2122990_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	4.3e-38
WP_000121330.1|2122999_2123956_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|2123934_2124345_+	transcriptional regulator	NA	NA	NA	NA	NA
2124462:2124517	attL	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_073528136.1|2125006_2125750_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168848386.1|2130982_2131582_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.5	2.8e-109
WP_168848387.1|2131650_2135130_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_130553433.1|2135190_2135838_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.5	2.2e-107
WP_168848388.1|2135735_2136479_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.3e-148
WP_052929219.1|2136484_2137183_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.4	2.8e-132
WP_001330090.1|2137182_2137539_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224016.1|2137516_2140744_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.7	0.0e+00
WP_021570074.1|2140790_2141069_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.7	2.4e-42
WP_168848389.1|2141092_2141464_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	98.4	5.5e-63
WP_000097524.1|2141478_2142183_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
WP_063084496.1|2142242_2142587_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	93.0	2.2e-53
WP_119725929.1|2142583_2143033_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	76.5	1.2e-59
WP_168848390.1|2143029_2143368_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	83.9	1.0e-47
WP_021543573.1|2143377_2143683_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	87.1	3.9e-38
WP_021543574.1|2143694_2143883_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	95.2	3.9e-25
WP_001393068.1|2143932_2145138_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	4.5e-223
WP_001193631.1|2145152_2145803_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_001393070.1|2145780_2147022_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_024169538.1|2147021_2147204_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	95.0	2.5e-24
WP_168848533.1|2147215_2148712_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.0	6.9e-298
WP_000929172.1|2148945_2149440_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_021519684.1|2149565_2149916_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	2.3e-63
WP_021519683.1|2149973_2150480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032193237.1|2150817_2151210_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	82.9	1.3e-49
WP_016236818.1|2151193_2151670_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	94.3	1.5e-84
WP_001120501.1|2151673_2152009_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|2152145_2152439_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|2152717_2152951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|2153094_2153634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168848391.1|2153849_2154602_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	2.6e-136
WP_001764249.1|2154615_2155605_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.2e-194
WP_168848392.1|2155612_2156425_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	96.7	1.4e-146
WP_000767111.1|2156444_2156834_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_000210178.1|2156830_2157157_-	LexA repressor	NA	U5P451	Shigella_phage	97.2	2.9e-52
WP_168848393.1|2157153_2157807_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.2	3.6e-126
WP_072278360.1|2157806_2158301_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	2.1e-86
WP_000104954.1|2158297_2159239_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|2159228_2159408_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_032141723.1|2159583_2160135_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.9	3.4e-101
WP_000649477.1|2160178_2160379_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2160469_2161144_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549623.1|2161378_2161585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|2161556_2161991_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000135682.1|2162459_2162822_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_097454982.1|2162887_2163712_+	YfdQ family protein	NA	A5LH63	Enterobacteria_phage	99.6	1.3e-149
WP_000008200.1|2163839_2164376_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|2164366_2164729_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|2164728_2165034_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|2165260_2166424_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893252.1|2166628_2167882_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
2166429:2166484	attR	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|2167893_2168997_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_137465051.1|2169284_2170340_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	7.7e-118
>prophage 9
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	2201358	2263549	5024521	tRNA,protease,transposase,plate	Escherichia_phage(12.5%)	51	NA	NA
WP_000611742.1|2201358_2201772_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|2201775_2203626_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|2203589_2204672_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|2204696_2205977_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|2205973_2206498_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246449.1|2206500_2207832_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343298.1|2207836_2208598_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_168848396.1|2208606_2211372_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	30.1	3.6e-82
WP_000088862.1|2211368_2212112_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|2212116_2213529_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985538.1|2213637_2217072_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|2217082_2218435_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|2218458_2218941_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|2218984_2219899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|2219908_2220388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297205.1|2221845_2222577_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917888.1|2222641_2223109_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001298887.1|2223105_2223828_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052750.1|2223861_2224617_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|2224688_2226047_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211728.1|2226094_2226865_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|2226942_2227743_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648576.1|2227983_2228898_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997049.1|2228894_2229698_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_001140186.1|2235458_2236031_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|2236218_2237250_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|2237242_2237896_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|2237935_2238751_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|2238868_2239273_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|2239269_2239977_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260716.1|2240087_2241806_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001346133.1|2241858_2242683_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_168848397.1|2242885_2243866_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|2244115_2244826_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|2244839_2245262_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_088748050.1|2245258_2245804_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|2245969_2246170_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|2246156_2246417_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_139496388.1|2246465_2247764_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|2247828_2248218_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|2248274_2250416_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|2250514_2251474_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|2251486_2254969_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|2255005_2255602_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139659.1|2255598_2256747_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|2256746_2257535_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2257538_2257994_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|2258098_2259124_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|2259127_2259613_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|2259734_2262167_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|2262196_2263549_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 10
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	2829208	2871112	5024521	protease,lysis,integrase,portal,tRNA,terminase,tail	Enterobacteria_phage(56.25%)	50	2825803:2825817	2832157:2832171
2825803:2825817	attL	CCTCTTCCAGCGCAG	NA	NA	NA	NA
WP_000543828.1|2829208_2830246_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332276.1|2830334_2831432_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.8e-211
WP_001217553.1|2831493_2831742_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_096931532.1|2831857_2831986_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	79.5	2.4e-10
WP_069354224.1|2835587_2836187_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.0	1.0e-106
2832157:2832171	attR	CCTCTTCCAGCGCAG	NA	NA	NA	NA
WP_168848424.1|2836255_2839651_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.4	0.0e+00
WP_168848425.1|2839711_2840359_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_124064715.1|2840256_2841000_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	6.1e-146
WP_001152409.1|2841005_2841704_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
WP_000447253.1|2841713_2842043_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_168848426.1|2842042_2845108_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
WP_001161009.1|2845079_2845409_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001370402.1|2845417_2845804_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_000211131.1|2845864_2846608_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.6	3.6e-130
WP_023148639.1|2846618_2847020_-|tail	phage tail protein	tail	K7PJP5	Enterobacteria_phage	100.0	1.1e-72
WP_000677106.1|2847016_2847595_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|2847606_2847882_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097045.1|2847874_2848198_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001360054.1|2848284_2850312_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_077821076.1|2850256_2851837_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|2851764_2851977_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_097448893.1|2851973_2854073_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.9	0.0e+00
WP_077881733.1|2854081_2854621_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	98.9	4.4e-93
WP_001139675.1|2855294_2855447_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001341210.1|2855434_2855902_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|2855898_2856396_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|2856395_2856611_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001610363.1|2856678_2857731_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	100.0	2.1e-208
WP_000917724.1|2857881_2858085_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000360285.1|2858361_2858979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204813.1|2859054_2859426_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	59.2	3.7e-35
WP_016241035.1|2859443_2860433_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_119188321.1|2860440_2861250_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	3.1e-151
WP_112875663.1|2861269_2861659_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.3e-67
WP_000210187.1|2861655_2861982_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000066917.1|2861978_2862632_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_119188319.1|2862631_2863126_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.9	1.4e-85
WP_000104953.1|2863122_2864064_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	5.6e-144
WP_001188051.1|2864053_2864233_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.7e-15
WP_000514174.1|2864408_2864993_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001231956.1|2865020_2865218_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_168848427.1|2865313_2865967_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.4	4.8e-70
WP_000081297.1|2866851_2867676_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
WP_000008180.1|2867803_2868340_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.9	1.1e-99
WP_039022222.1|2868330_2868918_+	hypothetical protein	NA	Q9MCT8	Escherichia_phage	76.0	3.2e-97
WP_001743084.1|2868919_2869111_+	hypothetical protein	NA	G9L660	Escherichia_phage	95.2	6.8e-25
WP_039022220.1|2869113_2870001_+	DUF551 domain-containing protein	NA	A0A0N7C063	Escherichia_phage	96.1	4.9e-49
WP_057688084.1|2870000_2870573_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	98.9	2.7e-109
WP_001093917.1|2870609_2870891_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_000390072.1|2870938_2871112_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	98.2	9.8e-23
>prophage 11
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	3333652	3351609	5024521	integrase	Morganella_phage(35.71%)	22	3336824:3336840	3357081:3357097
WP_161403138.1|3333652_3334108_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	65.7	6.4e-45
WP_000678613.1|3334187_3334409_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	38.5	6.9e-05
WP_000594596.1|3334958_3335657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168848440.1|3335807_3338528_-	lytic transglycosylase domain-containing protein	NA	A5VW64	Enterobacteria_phage	50.9	2.6e-149
3336824:3336840	attL	TCATCTCCGGGCTGAGT	NA	NA	NA	NA
WP_016234632.1|3338524_3339844_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	43.2	7.1e-36
WP_000909176.1|3339843_3340521_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_000420674.1|3340514_3340976_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001018524.1|3340992_3341154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168848441.1|3341738_3344495_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	2.3e-299
WP_168848442.1|3344481_3344853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016234636.1|3344845_3345187_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	5.5e-33
WP_001058743.1|3345197_3345800_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.0e-25
WP_000181940.1|3345792_3346014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|3346010_3346274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3346270_3346465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005040399.1|3346457_3347525_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	37.1	5.2e-13
WP_000042978.1|3347521_3347701_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_168848443.1|3347693_3348527_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412538.1|3348539_3348971_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_001090781.1|3348970_3349174_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001555743.1|3349288_3350254_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	51.2	3.0e-07
WP_001555742.1|3350349_3351609_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	3.0e-193
3357081:3357097	attR	ACTCAGCCCGGAGATGA	NA	NA	NA	NA
>prophage 12
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	4336706	4343846	5024521		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4336706_4337345_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590397.1|4337341_4338604_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|4338600_4339509_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|4339704_4340472_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|4340522_4341179_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_021534487.1|4341284_4343846_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	3.0e-30
>prophage 13
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	4415351	4475028	5024521	holin,lysis,integrase,transposase,portal,plate,tRNA,head,terminase,capsid,tail	Salmonella_phage(28.07%)	75	4434761:4434775	4479355:4479369
WP_085948468.1|4415351_4416513_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_168848497.1|4416665_4418384_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.3	1.1e-304
WP_000214990.1|4418385_4420134_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|4420205_4420622_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|4420660_4421890_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_168848498.1|4422568_4424902_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
WP_000856729.1|4424916_4425237_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_052907993.1|4425372_4425828_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	2.8e-64
WP_168848499.1|4425820_4426108_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	1.1e-47
WP_044686936.1|4426100_4426655_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	79.3	8.9e-41
WP_001149160.1|4426651_4426918_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283017.1|4427469_4428204_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	9.4e-131
WP_000638635.1|4428200_4428701_+	transactivation protein	NA	NA	NA	NA	NA
WP_053901924.1|4428774_4429347_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_088551761.1|4429826_4431530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124719.1|4431526_4432723_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	6.3e-108
WP_000162574.1|4433484_4433967_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|4434098_4434575_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|4434564_4434855_+	RnfH family protein	NA	NA	NA	NA	NA
4434761:4434775	attL	TGCATGATGGCGATC	NA	NA	NA	NA
WP_001203437.1|4434916_4435258_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|4435406_4437068_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|4437153_4438032_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|4438154_4438748_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_032149952.1|4438802_4440089_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|4440109_4440901_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|4441067_4442429_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|4442565_4442814_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|4442832_4443381_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|4443411_4444179_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|4444220_4444568_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000972010.1|4444712_4444931_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
WP_001580942.1|4445006_4446176_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	95.4	5.8e-207
WP_001407015.1|4446172_4446658_-|tail	phage tail protein	tail	O80317	Escherichia_phage	94.4	2.6e-81
WP_073507264.1|4446671_4449116_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	79.9	5.8e-302
WP_000763319.1|4449108_4449228_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	94.9	9.7e-14
WP_001029730.1|4449260_4449596_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	98.2	8.8e-52
WP_001207675.1|4449659_4450178_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_168848500.1|4450193_4451372_-|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	95.9	1.9e-213
WP_137591417.1|4451783_4452146_+|tail	phage tail protein	tail	M1FN94	Enterobacteria_phage	42.5	1.6e-14
WP_000639074.1|4452154_4452550_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_000782986.1|4452521_4452941_-|tail	tail assembly chaperone	tail	M1SNQ2	Escherichia_phage	63.8	4.2e-35
WP_001283830.1|4453913_4454522_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	97.5	1.2e-112
WP_023278485.1|4454514_4455423_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	99.3	2.4e-160
WP_000127178.1|4455429_4455777_-|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	99.1	5.5e-57
WP_023278483.1|4455773_4456409_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	98.1	9.3e-111
WP_087603766.1|4456477_4456927_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	98.0	3.9e-71
WP_001437785.1|4456919_4457387_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	100.0	1.4e-84
WP_001759348.1|4457349_4457523_-	hypothetical protein	NA	O80311	Escherichia_phage	96.5	2.3e-24
WP_087603765.1|4457494_4457908_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	82.8	1.4e-54
WP_001394643.1|4457904_4458402_-	glycoside hydrolase family 104 protein	NA	M1TAR2	Escherichia_phage	93.9	3.9e-88
WP_001394642.1|4458388_4458685_-|holin	phage holin 2 family protein	holin	O80308	Escherichia_phage	96.9	5.4e-45
WP_001407031.1|4458688_4458892_-|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	92.5	2.2e-29
WP_000214252.1|4458891_4459401_-|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	98.2	4.3e-90
WP_073507266.1|4459494_4460244_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	94.8	1.5e-123
WP_001394639.1|4460247_4461315_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.4	2.6e-198
WP_168848501.1|4461391_4462246_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	93.0	1.5e-148
WP_073507267.1|4462411_4464181_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	98.8	0.0e+00
WP_000517961.1|4464182_4465229_+|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	94.8	9.8e-190
WP_073507268.1|4465259_4465985_-	hypothetical protein	NA	S5W9H2	Leptospira_phage	26.6	2.9e-07
WP_073507269.1|4465981_4466800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073507529.1|4466951_4467221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407038.1|4467251_4467443_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	95.2	1.4e-25
WP_073507271.1|4467441_4467873_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	95.1	4.4e-72
WP_001222154.1|4467939_4468173_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
WP_000232651.1|4468176_4468359_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	98.3	4.5e-26
WP_077897201.1|4468472_4470695_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	90.6	0.0e+00
WP_000752601.1|4470696_4470918_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	97.3	2.4e-34
WP_001246238.1|4470917_4471145_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.0e-31
WP_073507273.1|4471212_4471551_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	4.7e-53
WP_000920167.1|4471514_4471715_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	95.5	1.1e-30
WP_073507274.1|4471722_4472232_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	95.9	2.6e-87
WP_001278195.1|4472264_4472636_-	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	98.4	2.3e-61
WP_001394632.1|4472757_4473618_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	97.9	2.4e-162
WP_001394631.1|4473626_4473965_+	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	92.0	4.3e-54
WP_168848502.1|4473987_4475028_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	89.5	2.1e-184
4479355:4479369	attR	GATCGCCATCATGCA	NA	NA	NA	NA
>prophage 14
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	4971635	4981077	5024521		Enterobacteria_phage(85.71%)	10	NA	NA
WP_168848523.1|4971635_4972562_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	5.3e-22
WP_000783120.1|4972566_4973298_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4973278_4973386_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4973445_4974177_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4974398_4976084_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4976080_4976800_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4976846_4977317_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4977357_4977819_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|4977943_4979944_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_168848524.1|4979940_4981077_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	9.4e-162
>prophage 15
NZ_CP051430	Escherichia sp. SCLE84 chromosome, complete genome	5024521	5019047	5024261	5024521	integrase	Escherichia_phage(33.33%)	10	5020290:5020302	5023045:5023057
WP_069199732.1|5019047_5019947_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
5020290:5020302	attL	ATTATAATAATCA	NA	NA	NA	NA
WP_168848529.1|5020361_5020679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985261.1|5020943_5021957_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000020919.1|5022072_5022372_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|5022493_5022769_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|5022779_5022950_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|5022946_5023447_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
5023045:5023057	attR	TGATTATTATAAT	NA	NA	NA	NA
WP_000557705.1|5023510_5023735_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.4e-32
WP_001277897.1|5023734_5024037_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_001113264.1|5024036_5024261_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
>prophage 1
NZ_CP051431	Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence	217533	109790	138678	217533	transposase	Escherichia_phage(50.0%)	31	NA	NA
WP_012783960.1|109790_111380_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
WP_001067855.1|111370_112075_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014342101.1|112275_112398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001617865.1|112377_113253_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_014839980.1|113864_114281_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|114285_114804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071448054.1|114803_115550_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|115555_116260_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|116373_117150_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000602738.1|118700_119453_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_057102336.1|121113_121824_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.4	2.1e-95
WP_001175593.1|121924_122248_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058650130.1|122353_123487_+	permease	NA	NA	NA	NA	NA
WP_000521603.1|123779_124397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818556.1|124588_126145_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000194575.1|126407_126998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343085.1|126997_127255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350638.1|127608_129747_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044768.1|129908_130325_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|130321_130552_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_061602529.1|130847_131120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|131166_131871_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000429836.1|131917_132352_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|132423_132774_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|132787_133063_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|133098_133521_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|133572_135267_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|135284_135647_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|135643_135880_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|135915_136584_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|137973_138678_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP051431	Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence	217533	148836	183150	217533	transposase,integrase	Escherichia_phage(23.08%)	30	147242:147257	155121:155136
147242:147257	attL	ATCGCCGGCCCAGTCG	NA	NA	NA	NA
WP_119015029.1|148836_149808_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	44.7	5.1e-68
WP_001067855.1|149841_150546_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_168848545.1|150516_151200_+|transposase	transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	2.3e-107
WP_001516695.1|152652_153309_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|154088_155480_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
155121:155136	attR	ATCGCCGGCCCAGTCG	NA	NA	NA	NA
WP_001493762.1|155516_156089_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|156225_156816_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001067855.1|156922_157627_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_048230589.1|157603_158506_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	7.9e-156
WP_000844627.1|158563_158806_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_063120597.1|158837_159488_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001493765.1|159593_160793_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|160824_161709_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|161846_162239_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_072656931.1|164055_165687_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_001023231.1|165921_166371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000287499.1|166645_167383_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_000843501.1|167416_167614_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_011251358.1|167654_170132_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.0	3.8e-83
WP_000758221.1|170229_170670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251357.1|170756_173903_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	1.2e-60
WP_001398209.1|173913_175206_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246155.1|175319_175673_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_063107410.1|175700_177086_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697965.1|177275_177956_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	1.2e-31
WP_000555737.1|177948_179424_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000790483.1|179674_180106_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000694953.1|180249_180600_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
WP_001372261.1|180987_181896_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001067858.1|182445_183150_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
NZ_CP051432	Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence	45814	4973	11795	45814	transposase	Escherichia_phage(66.67%)	6	NA	NA
WP_001067855.1|4973_5678_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001532073.1|5779_6994_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	2.1e-34
WP_072135327.1|7027_8431_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
WP_001067855.1|8908_9613_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|9999_10704_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|11090_11795_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP051433	Escherichia sp. SCLE84 plasmid pSCLE3, complete sequence	96595	2635	44416	96595	integrase,protease,transposase	Escherichia_phage(30.77%)	36	NA	NA
WP_168848548.1|2635_3849_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.6	8.2e-164
WP_168848549.1|4475_8378_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	38.5	8.0e-221
WP_001254932.1|9002_10154_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_063085579.1|11119_15253_+|protease	temperature-sensitive protease autotransporter hemagglutinin Tsh	protease	Q9LA54	Enterobacteria_phage	41.6	5.6e-297
WP_000948429.1|16070_17270_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|17279_17468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168848547.1|19331_20309_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_105910642.1|20426_20876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094308965.1|20872_23320_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_074425405.1|23335_24097_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_157769469.1|24237_24741_-	CD15/CS22/SEF14 family fimbrial major subunit	NA	NA	NA	NA	NA
WP_074425400.1|25172_25781_+	helix-turn-helix domain-containing protein	NA	A0A077SLK2	Escherichia_phage	82.5	2.2e-69
WP_168848550.1|26637_27120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112889124.1|27333_28164_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_112889123.1|28294_29251_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	86.6	1.8e-158
WP_094308932.1|30020_30230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150739.1|30278_30482_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_094313750.1|30542_31037_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_094309628.1|31067_31640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065801593.1|31644_31893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095153353.1|33734_33989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065801591.1|34052_34298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023292131.1|34332_34749_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_021312476.1|34745_34976_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000493379.1|35551_35902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112907394.1|36630_37422_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	9.4e-52
WP_000239529.1|37559_37835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|37828_38473_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103690.1|38701_39673_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000340829.1|39677_40070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457496.1|40074_41346_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000109071.1|41345_41783_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|41779_42028_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_001302618.1|42445_43348_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032317461.1|43344_43656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168848551.1|43732_44416_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	3.0e-30
