The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051269	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF_FSR1_WB_Finch_ST-13 chromosome, complete genome	4819669	466284	516305	4819669	tail,tRNA,plate	Burkholderia_phage(37.5%)	51	NA	NA
WP_001285165.1|466284_467232_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
WP_000114987.1|467247_467757_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_000124529.1|467888_469013_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460663.1|468984_469458_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001129708.1|469484_470027_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_001063609.1|470031_470604_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
WP_000451193.1|470608_471427_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001070571.1|471423_471681_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_001285640.1|471656_472211_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000795911.1|472324_472477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973242.1|478214_478652_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001122767.1|478808_479738_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_001069372.1|480006_481608_+	malate synthase A	NA	NA	NA	NA	NA
WP_000857881.1|481639_482944_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_001137266.1|483045_484797_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_010989091.1|484760_485168_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000226434.1|485178_486003_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_000095958.1|486306_489990_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
WP_000956811.1|490256_491888_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_000421792.1|491963_492653_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_001541281.1|492724_492826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001096724.1|492860_493400_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000954611.1|493446_494316_+	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_001207628.1|494312_494585_-	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_000881652.1|494682_495624_-	ketopantoate/pantoate/pantothenate transporter PanS	NA	NA	NA	NA	NA
WP_000587738.1|495885_496614_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|496810_497101_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|497349_497805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|497801_498407_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_023139145.1|498411_500157_-|tail	phage tail fiber protein H	tail	A0A0M3ULF6	Salmonella_phage	51.7	5.5e-52
WP_000359500.1|500159_500792_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|500784_501900_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|501890_502250_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|502413_503961_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_023139146.1|503960_504890_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.4	2.0e-149
WP_000593182.1|504886_505249_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_023139147.1|505576_506299_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|506308_507352_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|507339_507549_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|507548_508502_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|508501_510856_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|510952_511081_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|511040_511358_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|511409_511934_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001741803.1|511933_513361_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.7	1.5e-193
WP_000875314.1|513350_513548_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|513544_514000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|514159_514474_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|514486_515092_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|515094_515382_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|515957_516305_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 2
NZ_CP051269	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF_FSR1_WB_Finch_ST-13 chromosome, complete genome	4819669	1497517	1586071	4819669	protease,portal,lysis,tRNA,integrase,coat,terminase,tail,holin	Salmonella_phage(77.65%)	109	1489820:1489836	1592592:1592608
1489820:1489836	attL	GCCAGCGCATCCGCCAC	NA	NA	NA	NA
WP_001010574.1|1497517_1498132_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110598.1|1498102_1498789_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.1e-31
WP_075146413.1|1498785_1501200_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000152869.1|1501385_1502519_+	porin	NA	NA	NA	NA	NA
WP_000524317.1|1502775_1503606_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000569660.1|1503642_1504659_+	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-32
WP_000342247.1|1504651_1505311_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_075146414.1|1505349_1506444_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460169.1|1506513_1507440_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000764664.1|1507666_1508149_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141265.1|1508227_1509046_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096865.1|1509130_1510912_+	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.3	1.9e-39
WP_075146416.1|1510924_1511701_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765810.1|1511801_1512680_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000005067.1|1512745_1513993_+	MFS transporter	NA	NA	NA	NA	NA
WP_000401063.1|1514088_1515543_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006865.1|1515621_1516983_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_000484503.1|1517041_1518340_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000706331.1|1518362_1519511_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	39.0	9.1e-48
WP_000540981.1|1519590_1520376_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_023139287.1|1520386_1521622_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703934.1|1521643_1522693_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580915.1|1523023_1524688_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495330.1|1524697_1525957_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000821191.1|1525968_1526778_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_023139286.1|1526781_1527675_+	carbamate kinase	NA	NA	NA	NA	NA
WP_168728508.1|1528458_1529784_+|terminase	terminase	terminase	A0A075B8G6	Enterobacteria_phage	100.0	8.9e-273
WP_000774649.1|1529783_1531961_+|portal	portal protein	portal	A0A075B8I1	Enterobacteria_phage	100.0	0.0e+00
WP_000433852.1|1531974_1532886_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_168728509.1|1532885_1534178_+|coat	coat protein	coat	I1TEI8	Salmonella_phage	99.1	1.0e-241
WP_023167451.1|1534218_1534779_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	1.6e-101
WP_001166093.1|1534762_1535263_+	packaged DNA stabilization protein p27	NA	E7C9U0	Salmonella_phage	100.0	2.5e-90
WP_168728510.1|1535222_1536641_+	hypothetical protein	NA	A0A075B8I2	Enterobacteria_phage	97.9	1.5e-273
WP_000774919.1|1536644_1537283_+	hypothetical protein	NA	A8CGD2	Salmonella_phage	100.0	6.3e-91
WP_000627703.1|1537282_1537738_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_000964900.1|1537740_1538430_+	hypothetical protein	NA	E7C9U4	Salmonella_phage	100.0	4.3e-109
WP_000246971.1|1538440_1539745_+	phage DNA ejection protein	NA	E7C9U5	Salmonella_phage	100.0	9.9e-224
WP_001262317.1|1539744_1541658_+	hypothetical protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
WP_000889769.1|1541675_1542005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757527.1|1542035_1542401_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_001085430.1|1542414_1542594_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000532175.1|1542693_1542945_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
WP_000129928.1|1543080_1545084_+	endorhamnosidase	NA	E7C9U9	Salmonella_phage	100.0	0.0e+00
WP_000671497.1|1545142_1546600_-	hypothetical protein	NA	E7C9N7	Salmonella_phage	100.0	1.3e-240
WP_000703639.1|1546589_1547522_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|1547518_1547881_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_168728511.1|1548229_1549393_-|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	98.7	1.5e-226
WP_168728501.1|1549622_1549763_-	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	93.5	2.3e-14
WP_001084858.1|1549831_1550359_-	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	100.0	1.8e-99
WP_000348980.1|1550360_1550552_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	100.0	2.1e-26
WP_000034216.1|1550553_1551393_-	hypothetical protein	NA	A0A088CC42	Shigella_phage	64.8	7.8e-65
WP_000812204.1|1551389_1552031_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	100.0	1.7e-112
WP_001214772.1|1552027_1552198_-	DUF2737 family protein	NA	E7C9P7	Salmonella_phage	100.0	7.2e-26
WP_001111310.1|1552208_1552502_-	DUF2856 family protein	NA	E7C9P8	Salmonella_phage	100.0	3.2e-50
WP_001253475.1|1552548_1552833_-	sigma-70 region 4 domain-containing protein	NA	E7C9P9	Salmonella_phage	100.0	2.3e-45
WP_000365269.1|1552832_1553540_-	recombinase	NA	E7C9Q0	Salmonella_phage	100.0	3.7e-140
WP_000361564.1|1553733_1553847_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_001541875.1|1553839_1553986_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	E7C9Q3	Salmonella_phage	100.0	1.3e-20
WP_000776962.1|1554070_1554385_-	superinfection exclusion protein	NA	E7C9Q4	Salmonella_phage	100.0	1.9e-56
WP_001541877.1|1554556_1555096_-	pentapeptide repeat-containing protein	NA	E7C9Q5	Salmonella_phage	100.0	3.1e-54
WP_000213981.1|1555179_1555374_-	Restriction inhibitor protein ral	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
WP_000216177.1|1555452_1555791_-	hypothetical protein	NA	E7C9Q7	Salmonella_phage	100.0	1.1e-57
WP_138922303.1|1555811_1555994_-	hypothetical protein	NA	A0A220NQW5	Salmonella_phage	100.0	3.3e-29
WP_071533030.1|1556013_1556211_+	hypothetical protein	NA	A0A075B8J1	Enterobacteria_phage	97.1	1.5e-11
WP_000786968.1|1556357_1556567_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	98.6	3.5e-30
WP_015995141.1|1556607_1557681_-	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	100.0	8.4e-205
WP_000885924.1|1557819_1558161_-	DUF3024 domain-containing protein	NA	E7C9Q9	Salmonella_phage	100.0	4.3e-62
WP_000712404.1|1558227_1558917_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	100.0	2.9e-126
WP_000182204.1|1559027_1559243_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|1559353_1559635_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_001125981.1|1559669_1559816_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000065659.1|1559808_1560708_+	hypothetical protein	NA	E7C9R4	Salmonella_phage	100.0	1.9e-157
WP_000131503.1|1560697_1562134_+	AAA family ATPase	NA	E7C9R5	Salmonella_phage	100.0	6.1e-275
WP_001227831.1|1562210_1562405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000440795.1|1562404_1562695_+	hypothetical protein	NA	E7C9R6	Salmonella_phage	100.0	2.2e-51
WP_000049339.1|1562697_1562994_+	hypothetical protein	NA	E7C9R7	Salmonella_phage	100.0	1.1e-48
WP_000811304.1|1562950_1563397_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	100.0	3.2e-81
WP_000679702.1|1563393_1563567_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113765.1|1563533_1563710_+	NinE family protein	NA	C6ZR57	Salmonella_phage	100.0	4.6e-28
WP_001532927.1|1563712_1564054_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000950941.1|1564046_1564223_+	protein ninF	NA	E7C9S2	Salmonella_phage	100.0	6.7e-27
WP_001107939.1|1564215_1564821_+	recombination protein NinG	NA	E7C9S3	Salmonella_phage	100.0	7.1e-100
WP_001748048.1|1564817_1565042_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	98.6	2.4e-37
WP_000149925.1|1565038_1565242_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219143.1|1565222_1565402_+	hypothetical protein	NA	E7C9S6	Salmonella_phage	100.0	9.2e-24
WP_000027541.1|1565398_1565917_+	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	100.0	9.0e-96
WP_001129219.1|1566316_1566634_+|holin	holin	holin	E7C9S8	Salmonella_phage	100.0	1.1e-54
WP_001194317.1|1566620_1567019_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	100.0	1.1e-69
WP_001541885.1|1567015_1567468_+|lysis	lysis protein	lysis	E7C9T0	Salmonella_phage	100.0	5.0e-74
WP_000808099.1|1567763_1568006_+	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|1568009_1568399_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_168728512.1|1568398_1568803_+	Decoration protein	NA	C6ZR73	Salmonella_phage	98.5	9.0e-67
WP_000729923.1|1568806_1569295_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_023893007.1|1569272_1570772_+|terminase	terminase	terminase	A0A2H4FUR5	Salmonella_phage	99.8	1.1e-306
WP_023170969.1|1570771_1572949_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.4	0.0e+00
WP_023167453.1|1572962_1573874_+	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	1.1e-160
WP_020899473.1|1573873_1575166_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.3	3.2e-243
WP_168728513.1|1575206_1575767_+	hypothetical protein	NA	E7C9T9	Salmonella_phage	99.5	6.3e-103
WP_001166098.1|1575750_1576251_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_168728514.1|1576210_1577629_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.5	1.5e-273
WP_168728515.1|1577632_1578271_+|tail	phage tail protein	tail	A8CGD2	Salmonella_phage	98.6	4.1e-90
WP_000627703.1|1578270_1578726_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_000964900.1|1578728_1579418_+	hypothetical protein	NA	E7C9U4	Salmonella_phage	100.0	4.3e-109
WP_000246971.1|1579428_1580733_+	phage DNA ejection protein	NA	E7C9U5	Salmonella_phage	100.0	9.9e-224
WP_001262317.1|1580732_1582646_+	hypothetical protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
WP_000757527.1|1583022_1583388_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_001085430.1|1583401_1583581_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000532175.1|1583680_1583932_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
WP_000129928.1|1584067_1586071_+	endorhamnosidase	NA	E7C9U9	Salmonella_phage	100.0	0.0e+00
1592592:1592608	attR	GTGGCGGATGCGCTGGC	NA	NA	NA	NA
>prophage 3
NZ_CP051269	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF_FSR1_WB_Finch_ST-13 chromosome, complete genome	4819669	1910441	1918058	4819669	transposase,protease	Planktothrix_phage(16.67%)	6	NA	NA
WP_000125877.1|1910441_1912388_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1912517_1912739_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1913062_1913383_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1913413_1915690_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1915881_1916340_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_109182773.1|1916802_1918058_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.2e-16
>prophage 4
NZ_CP051269	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF_FSR1_WB_Finch_ST-13 chromosome, complete genome	4819669	1968151	2066947	4819669	protease,portal,lysis,tRNA,terminase,tail,holin	Salmonella_phage(41.82%)	99	NA	NA
WP_001154025.1|1968151_1968955_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1968947_1970270_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1970250_1970955_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1970954_1975421_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|1975765_1977607_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1977866_1978415_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1978442_1979090_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1979151_1980342_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1980526_1981618_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1982224_1983625_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1983825_1984287_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1984603_1985818_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1986062_1987499_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1987576_1988779_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1988973_1990266_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1990310_1990559_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1990599_1990839_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_076149000.1|1992000_1994886_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.7	0.0e+00
WP_014344461.1|1995012_1995312_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	83.6	1.4e-48
WP_000917564.1|1995333_1995492_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1995484_1995745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1995794_1996205_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1996324_1996564_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1996529_1996904_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1996988_1997972_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1997974_1998724_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1998734_1999082_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1999078_1999390_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1999467_1999758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2000049_2000283_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|2000394_2000616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|2000698_2001301_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|2001509_2002121_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|2002117_2002264_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|2002253_2003051_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|2003117_2003435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2003608_2003734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|2003869_2004319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|2004679_2005366_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|2005641_2005971_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_077248249.1|2005954_2006407_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	2.7e-80
WP_001541990.1|2006424_2006904_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|2007111_2007645_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|2007601_2009740_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|2009736_2009943_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|2009939_2011487_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|2011410_2013492_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|2013582_2013906_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|2013898_2014198_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|2014178_2014745_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196701.1|2014741_2015143_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.2	2.6e-42
WP_000132756.1|2015154_2015904_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|2015949_2016348_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|2016344_2016674_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_168728529.1|2016753_2019741_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	7.7e-264
WP_000978296.1|2019737_2020070_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|2020168_2020666_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|2020782_2021316_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|2021405_2022101_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|2022110_2022848_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|2022745_2023450_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_168728519.1|2025996_2026872_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178853.1|2026910_2027153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168728520.1|2027206_2029633_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.8	1.6e-89
WP_000143167.1|2029632_2030214_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_050951585.1|2030690_2031659_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	98.4	3.3e-192
WP_000334547.1|2032306_2032933_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|2033284_2033971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|2034241_2034433_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|2034859_2037472_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|2037679_2038690_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|2038855_2039398_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|2039394_2040504_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|2040602_2042711_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|2042723_2044631_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|2044645_2045899_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|2045903_2047544_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|2047540_2048104_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|2048359_2048527_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|2048626_2049145_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|2049213_2050974_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|2051159_2051612_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|2051683_2052736_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|2053092_2053602_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|2053818_2054424_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|2054410_2056564_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|2056582_2057029_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|2057152_2059207_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|2059242_2059701_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|2059795_2060458_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|2060631_2061045_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|2061089_2061407_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|2061464_2062676_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|2062890_2063439_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|2063464_2064244_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|2064292_2064574_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|2064570_2064900_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|2064986_2065646_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|2066266_2066947_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 5
NZ_CP051269	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF_FSR1_WB_Finch_ST-13 chromosome, complete genome	4819669	2807363	2863789	4819669	protease,tRNA,integrase,transposase,tail	Saccharomonospora_phage(11.11%)	62	2851843:2851865	2861558:2861580
WP_000502119.1|2807363_2807822_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000758418.1|2808012_2809698_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
WP_000290594.1|2809902_2810484_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_001221014.1|2810555_2811251_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128807.1|2811308_2813219_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_000029550.1|2813349_2813694_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457328.1|2813699_2813879_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000978464.1|2813959_2815324_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	1.9e-44
WP_000381544.1|2815327_2815906_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_001738311.1|2816169_2817534_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001192513.1|2817671_2819273_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_023139113.1|2819294_2820854_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
WP_000150521.1|2821326_2822295_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406918.1|2822347_2823148_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001518647.1|2823160_2824012_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156280.1|2824069_2824528_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001518359.1|2824937_2825504_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010923.1|2825500_2826310_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_000730322.1|2826375_2828121_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|2828340_2828550_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001537930.1|2828562_2828706_-	YobF family protein	NA	NA	NA	NA	NA
WP_001000660.1|2829354_2829642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714547.1|2829712_2829856_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001236777.1|2830013_2830253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262195.1|2830464_2831256_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_000416128.1|2831431_2832805_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984498.1|2832852_2833734_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_000502119.1|2834000_2834459_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001091237.1|2834638_2836687_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2836706_2837393_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|2837490_2837988_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2838116_2839400_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001535256.1|2839368_2842002_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001542138.1|2842079_2843519_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2843636_2843873_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457836.1|2843983_2844175_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986176.1|2844193_2844844_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_001134856.1|2845067_2845232_-	membrane protein	NA	NA	NA	NA	NA
WP_000182072.1|2845516_2846239_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|2846922_2847318_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|2847647_2848124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354408.1|2848511_2848931_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001752421.1|2849300_2849570_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_001617922.1|2849735_2849876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000684835.1|2851339_2851708_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
2851843:2851865	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_001233446.1|2853011_2853926_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2854058_2854217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|2854226_2854841_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_001520350.1|2855328_2855475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|2855988_2856114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989029.1|2856683_2856884_+	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000275418.1|2856980_2857862_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|2858334_2858523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2858587_2858755_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|2859011_2859545_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|2859598_2859829_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|2860018_2860513_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|2860572_2861427_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|2861800_2862154_-	YebY family protein	NA	NA	NA	NA	NA
2861558:2861580	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|2862170_2863046_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|2863046_2863421_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|2863558_2863789_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 6
NZ_CP051269	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF_FSR1_WB_Finch_ST-13 chromosome, complete genome	4819669	2939238	3018593	4819669	protease,portal,head,lysis,plate,integrase,terminase,transposase,holin,tail	Salmonella_phage(85.25%)	97	2945776:2945791	3020216:3020231
WP_000502119.1|2939238_2939697_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2939877_2941083_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2941161_2942649_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2942905_2944309_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_075146474.1|2944323_2944731_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2944730_2945099_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2945170_2946655_+	alpha-amylase	NA	NA	NA	NA	NA
2945776:2945791	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2946694_2947120_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2947305_2948511_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2948507_2948741_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2949005_2949392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2949511_2949826_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2950042_2951725_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2951717_2952713_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2952705_2953413_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2953412_2954783_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_075146475.1|2954804_2955248_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2955244_2956462_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2956566_2957034_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2957038_2958043_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2958039_2958453_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2958452_2958830_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2958829_2959567_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2959576_2959846_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2959854_2960649_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2960930_2961554_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2961592_2961841_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2961915_2962143_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2962452_2963268_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2963246_2964959_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2965123_2965369_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2965385_2966297_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2966472_2967393_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2967381_2967852_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2967832_2969263_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2969336_2970032_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2970123_2970423_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2971072_2972269_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2972529_2972718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2972728_2972941_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2973395_2974664_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2974666_2975086_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2975212_2975374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2976004_2976226_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_015701331.1|2977727_2978327_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_001207832.1|2979845_2980433_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_014343855.1|2980435_2980957_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_000605050.1|2981509_2981923_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2981927_2982461_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2982460_2983519_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2983515_2984856_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_075146476.1|2984889_2986821_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000588852.1|2986905_2987232_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2987228_2987585_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2987584_2989081_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2989070_2989235_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2989238_2989799_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2989795_2990308_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2990279_2990684_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2990680_2991004_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2991006_2991207_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_001193639.1|2992487_2993138_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2993115_2994357_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2994356_2994539_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_075146477.1|2994550_2996284_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
WP_000929191.1|2996280_2996775_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2996900_2997251_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2997311_2997614_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2997833_2998253_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2998465_2998951_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2998947_2999562_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2999564_2999909_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|3000070_3000505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|3000434_3000692_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_168728523.1|3000824_3001448_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	99.5	2.7e-118
WP_001202277.1|3001458_3002448_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_075146479.1|3002455_3003316_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	1.4e-162
WP_023139095.1|3003332_3003722_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	99.2	2.4e-69
WP_000066908.1|3003718_3004612_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|3004611_3005094_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|3005095_3005914_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001087402.1|3006131_3007289_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|3007285_3007840_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|3007868_3008093_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|3008190_3008886_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|3009700_3010072_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|3010129_3010957_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|3011093_3011633_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|3011703_3011934_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|3011930_3012446_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|3012442_3013060_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|3013056_3013890_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|3013893_3014463_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_001527041.1|3014502_3014730_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|3014731_3015721_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|3016012_3016810_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001219015.1|3018119_3018593_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
3020216:3020231	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 7
NZ_CP051269	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF_FSR1_WB_Finch_ST-13 chromosome, complete genome	4819669	3104585	3115091	4819669		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|3104585_3105899_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|3105925_3107005_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|3107009_3107783_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|3107779_3108772_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|3108777_3109329_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|3109329_3110208_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|3110255_3111155_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|3111154_3112240_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|3112616_3113510_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|3113687_3115091_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 8
NZ_CP051269	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF_FSR1_WB_Finch_ST-13 chromosome, complete genome	4819669	3211977	3278359	4819669	lysis,holin,tail	Salmonella_phage(30.0%)	59	NA	NA
WP_000989296.1|3211977_3212673_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|3212826_3213711_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|3213887_3214607_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|3214603_3214849_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_075146486.1|3215053_3216295_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|3216288_3217524_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|3217598_3218609_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|3218624_3220145_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_023139082.1|3220278_3221277_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|3221775_3222798_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_075146584.1|3222947_3224090_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|3224104_3224773_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|3225102_3225960_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|3225948_3226338_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|3226342_3227710_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_168728524.1|3227926_3228844_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|3228845_3230168_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|3230211_3232203_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|3232547_3234017_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|3234206_3235070_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|3235190_3236240_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|3236318_3237176_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|3237240_3238929_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|3238945_3239884_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|3239883_3241014_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|3241382_3242564_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|3242628_3243294_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|3243295_3243418_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|3243805_3244060_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|3244383_3244956_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|3245168_3246155_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|3246184_3246904_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|3247317_3247890_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|3248215_3249772_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|3249878_3251684_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|3251693_3252788_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|3252787_3253813_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|3253814_3255404_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|3255407_3255752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|3256142_3257333_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|3257360_3258056_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|3258207_3259968_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|3260092_3260377_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|3260485_3261106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|3261133_3262141_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|3262320_3262548_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|3262579_3264340_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|3264620_3265124_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|3265151_3265442_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|3265778_3267608_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|3267661_3268105_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|3268482_3269010_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|3269012_3270254_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|3270846_3271176_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|3271472_3272804_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|3272832_3273201_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_031602376.1|3273215_3274205_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	1.7e-188
WP_001113462.1|3277067_3277271_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|3277567_3278359_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP051269	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF_FSR1_WB_Finch_ST-13 chromosome, complete genome	4819669	3616817	3722775	4819669	protease,head,lysis,tRNA,integrase,capsid,terminase,transposase,holin,tail	Salmonella_phage(38.71%)	108	3641371:3641387	3730679:3730695
WP_000940032.1|3616817_3617549_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|3617667_3618471_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|3618615_3619494_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_023139062.1|3619675_3620719_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|3620722_3621541_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|3621551_3622565_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|3622565_3623552_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|3623542_3624181_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|3624306_3625584_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|3625578_3626718_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|3626913_3628167_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|3628491_3629682_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|3629863_3631408_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000100008.1|3631768_3633100_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|3633182_3635327_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|3635382_3636843_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|3636891_3637230_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|3637306_3638644_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|3638640_3639405_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|3639406_3640837_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
3641371:3641387	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|3641495_3645383_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|3645404_3645638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|3645638_3647183_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|3647233_3647785_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|3647809_3648445_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|3648448_3649810_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|3649820_3650714_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|3650829_3651678_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|3651716_3652634_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|3652655_3653852_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|3653967_3654894_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|3654931_3655192_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|3655303_3655684_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|3655683_3656415_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|3656426_3657155_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|3657166_3658072_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|3658068_3658749_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|3659022_3659997_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|3660013_3661813_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|3662217_3663711_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|3664153_3664291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|3665003_3665168_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738443.1|3665875_3666088_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|3666194_3666422_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|3666518_3667097_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|3667086_3667911_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_075146502.1|3667907_3670280_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.4	1.1e-90
WP_000178853.1|3670333_3670576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080109167.1|3670614_3673977_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|3674038_3674686_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|3674583_3675321_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|3675327_3676026_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|3676035_3676365_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|3676367_3679463_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|3679434_3679773_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|3679769_3680165_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077248250.1|3680215_3680962_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_080075580.1|3680969_3681371_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	3.1e-51
WP_000817263.1|3681479_3682610_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|3682658_3683237_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|3683264_3683648_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|3683658_3684018_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|3684075_3685104_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|3685158_3685506_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|3685518_3687015_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000201415.1|3688767_3688971_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|3688954_3690886_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|3690857_3691403_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|3691689_3692091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|3692326_3692779_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_015701345.1|3692796_3693249_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|3693232_3693562_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|3693837_3694524_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|3694738_3694927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|3695433_3695997_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|3696269_3696947_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|3696943_3697084_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|3697080_3697692_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929803.1|3697900_3698503_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001217666.1|3698837_3699077_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_022630917.1|3699941_3700415_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	3.3e-68
WP_168728525.1|3700414_3700939_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.1	3.7e-89
WP_000113623.1|3700935_3701283_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|3701293_3702043_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|3702045_3703029_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|3703113_3703488_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869364.1|3703453_3703690_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009037.1|3703819_3704224_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000917562.1|3704622_3704781_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|3704802_3705153_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_168728526.1|3705279_3708207_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_077248255.1|3708169_3709327_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|3709369_3709609_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|3709649_3709934_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|3709911_3711141_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|3711638_3712118_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|3712114_3713071_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|3713070_3713721_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|3713752_3714328_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|3714324_3714489_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|3714752_3716375_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|3716359_3717097_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|3717227_3718562_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|3718579_3719479_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023139269.1|3719581_3720169_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|3720230_3720614_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|3720932_3721622_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|3721737_3722775_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
3730679:3730695	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
