The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051267	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 chromosome, complete genome	4815388	464180	514197	4815388	tail,plate,tRNA	Burkholderia_phage(37.5%)	51	NA	NA
WP_001285165.1|464180_465128_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
WP_000114987.1|465143_465653_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_000124529.1|465784_466909_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460663.1|466880_467354_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001129708.1|467380_467923_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_001063609.1|467927_468500_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
WP_000451193.1|468504_469323_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001070571.1|469319_469577_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_001285640.1|469552_470107_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000795911.1|470220_470373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973242.1|476107_476545_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001122767.1|476701_477631_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_001069372.1|477899_479501_+	malate synthase A	NA	NA	NA	NA	NA
WP_000857881.1|479532_480837_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_001137266.1|480938_482690_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_010989091.1|482653_483061_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000226434.1|483071_483896_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_000095958.1|484199_487883_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
WP_000956811.1|488149_489781_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_000421792.1|489856_490546_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_001541281.1|490617_490719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001096724.1|490753_491293_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000954611.1|491339_492209_+	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_001207628.1|492205_492478_-	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_000881652.1|492575_493517_-	ketopantoate/pantoate/pantothenate transporter PanS	NA	NA	NA	NA	NA
WP_000587738.1|493778_494507_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|494703_494994_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|495241_495697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|495693_496299_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_023139145.1|496303_498049_-|tail	phage tail fiber protein H	tail	A0A0M3ULF6	Salmonella_phage	51.7	5.5e-52
WP_000359500.1|498051_498684_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|498676_499792_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|499782_500142_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|500305_501853_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_023139146.1|501852_502782_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.4	2.0e-149
WP_000593182.1|502778_503141_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_023139147.1|503468_504191_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|504200_505244_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|505231_505441_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|505440_506394_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|506393_508748_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|508844_508973_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|508932_509250_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|509301_509826_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001741803.1|509825_511253_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.7	1.5e-193
WP_000875314.1|511242_511440_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|511436_511892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|512051_512366_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|512378_512984_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|512986_513274_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|513849_514197_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 2
NZ_CP051267	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 chromosome, complete genome	4815388	1528670	1566416	4815388	coat,protease,lysis,tRNA,holin,integrase	Salmonella_phage(81.97%)	63	1538680:1538694	1549729:1549743
WP_000912376.1|1528670_1530056_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
WP_168728233.1|1530424_1530586_+	hypothetical protein	NA	A0A192Y922	Salmonella_phage	100.0	3.4e-17
WP_000433852.1|1530599_1531511_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196937.1|1531510_1532803_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000538674.1|1532843_1533404_+	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_001166093.1|1533387_1533888_+	packaged DNA stabilization protein p27	NA	E7C9U0	Salmonella_phage	100.0	2.5e-90
WP_016032790.1|1533847_1535266_+	Gp10	NA	E7C9U1	Salmonella_phage	100.0	9.2e-276
WP_000774919.1|1535269_1535908_+	hypothetical protein	NA	A8CGD2	Salmonella_phage	100.0	6.3e-91
WP_000627703.1|1535907_1536363_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_000964900.1|1536365_1537055_+	hypothetical protein	NA	E7C9U4	Salmonella_phage	100.0	4.3e-109
WP_000246971.1|1537065_1538370_+	phage DNA ejection protein	NA	E7C9U5	Salmonella_phage	100.0	9.9e-224
WP_001262317.1|1538369_1540283_+	hypothetical protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
1538680:1538694	attL	CGTTTGATGTATTGC	NA	NA	NA	NA
WP_000889769.1|1540300_1540630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757527.1|1540660_1541026_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_001085430.1|1541039_1541219_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000532175.1|1541318_1541570_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
WP_000129928.1|1541705_1543709_+	endorhamnosidase	NA	E7C9U9	Salmonella_phage	100.0	0.0e+00
WP_168728238.1|1543767_1545228_-	hypothetical protein	NA	E7C9N7	Salmonella_phage	99.4	1.3e-237
WP_039513020.1|1545217_1546150_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	99.0	1.8e-174
WP_000915523.1|1546146_1546509_-	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_000051898.1|1546857_1548021_-|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	100.0	6.3e-230
WP_153246670.1|1548250_1548391_-	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	91.3	5.2e-14
WP_001084858.1|1548459_1548987_-	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	100.0	1.8e-99
WP_000348980.1|1548988_1549180_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	100.0	2.1e-26
WP_000034216.1|1549181_1550021_-	hypothetical protein	NA	A0A088CC42	Shigella_phage	64.8	7.8e-65
1549729:1549743	attR	CGTTTGATGTATTGC	NA	NA	NA	NA
WP_000812204.1|1550017_1550659_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	100.0	1.7e-112
WP_001214772.1|1550655_1550826_-	DUF2737 family protein	NA	E7C9P7	Salmonella_phage	100.0	7.2e-26
WP_001111310.1|1550836_1551130_-	DUF2856 family protein	NA	E7C9P8	Salmonella_phage	100.0	3.2e-50
WP_001253475.1|1551176_1551461_-	sigma-70 region 4 domain-containing protein	NA	E7C9P9	Salmonella_phage	100.0	2.3e-45
WP_000365269.1|1551460_1552168_-	recombinase	NA	E7C9Q0	Salmonella_phage	100.0	3.7e-140
WP_000361564.1|1552361_1552475_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_001541875.1|1552467_1552614_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	E7C9Q3	Salmonella_phage	100.0	1.3e-20
WP_000776962.1|1552698_1553013_-	superinfection exclusion protein	NA	E7C9Q4	Salmonella_phage	100.0	1.9e-56
WP_168728239.1|1553184_1553559_-	hypothetical protein	NA	A0A220NQW1	Salmonella_phage	76.5	2.3e-56
WP_000213981.1|1553642_1553837_-	Restriction inhibitor protein ral	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
WP_000216177.1|1553915_1554254_-	hypothetical protein	NA	E7C9Q7	Salmonella_phage	100.0	1.1e-57
WP_138922303.1|1554274_1554457_-	hypothetical protein	NA	A0A220NQW5	Salmonella_phage	100.0	3.3e-29
WP_071533030.1|1554476_1554674_+	hypothetical protein	NA	A0A075B8J1	Enterobacteria_phage	97.1	1.5e-11
WP_000786968.1|1554820_1555030_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	98.6	3.5e-30
WP_000885924.1|1556280_1556622_-	DUF3024 domain-containing protein	NA	E7C9Q9	Salmonella_phage	100.0	4.3e-62
WP_000712404.1|1556688_1557378_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	100.0	2.9e-126
WP_000182204.1|1557488_1557704_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|1557814_1558096_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_001125981.1|1558130_1558277_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000065659.1|1558269_1559169_+	hypothetical protein	NA	E7C9R4	Salmonella_phage	100.0	1.9e-157
WP_000131503.1|1559158_1560595_+	AAA family ATPase	NA	E7C9R5	Salmonella_phage	100.0	6.1e-275
WP_001227831.1|1560671_1560866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000440795.1|1560865_1561156_+	hypothetical protein	NA	E7C9R6	Salmonella_phage	100.0	2.2e-51
WP_000049339.1|1561158_1561455_+	hypothetical protein	NA	E7C9R7	Salmonella_phage	100.0	1.1e-48
WP_000811304.1|1561411_1561858_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	100.0	3.2e-81
WP_000679702.1|1561854_1562028_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113765.1|1561994_1562171_+	NinE family protein	NA	C6ZR57	Salmonella_phage	100.0	4.6e-28
WP_001532927.1|1562173_1562515_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000950941.1|1562507_1562684_+	protein ninF	NA	E7C9S2	Salmonella_phage	100.0	6.7e-27
WP_001107939.1|1562676_1563282_+	recombination protein NinG	NA	E7C9S3	Salmonella_phage	100.0	7.1e-100
WP_000036320.1|1563278_1563503_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_000149925.1|1563499_1563703_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219143.1|1563683_1563863_+	hypothetical protein	NA	E7C9S6	Salmonella_phage	100.0	9.2e-24
WP_000027541.1|1563859_1564378_+	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	100.0	9.0e-96
WP_001129219.1|1564777_1565095_+|holin	holin	holin	E7C9S8	Salmonella_phage	100.0	1.1e-54
WP_001194317.1|1565081_1565480_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	100.0	1.1e-69
WP_001541885.1|1565476_1565929_+|lysis	lysis protein	lysis	E7C9T0	Salmonella_phage	100.0	5.0e-74
WP_168728268.1|1566224_1566416_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	3.0e-20
>prophage 3
NZ_CP051267	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 chromosome, complete genome	4815388	1904985	1913717	4815388	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1904985_1906104_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1906100_1908047_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1908176_1908398_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1908721_1909042_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1909072_1911349_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1911540_1911999_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_109182773.1|1912461_1913717_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.2e-16
>prophage 4
NZ_CP051267	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 chromosome, complete genome	4815388	1963809	2062617	4815388	protease,tail,portal,lysis,terminase,tRNA,holin	Salmonella_phage(44.44%)	98	NA	NA
WP_001154025.1|1963809_1964613_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1964605_1965928_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1965908_1966613_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1966612_1971079_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|1971423_1973265_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1973524_1974073_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1974100_1974748_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1974809_1976000_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1976184_1977276_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1977881_1979282_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1979482_1979944_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1980260_1981475_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1981719_1983156_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1983233_1984436_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1984630_1985923_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1985967_1986216_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1986256_1986496_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1986538_1987696_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_076149000.1|1987658_1990544_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.7	0.0e+00
WP_014344461.1|1990670_1990970_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	83.6	1.4e-48
WP_000917564.1|1990991_1991150_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1991142_1991403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1991452_1991863_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1991982_1992222_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1992187_1992562_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1992646_1993630_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1993632_1994382_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1994392_1994740_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1994736_1995048_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1995125_1995416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1995707_1995941_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1996052_1996274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1996356_1996959_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1997167_1997779_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1997775_1997922_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1997911_1998709_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1998775_1999093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1999266_1999392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1999527_1999977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|2000337_2001024_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|2001299_2001629_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_077248249.1|2001612_2002065_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	2.7e-80
WP_001541990.1|2002082_2002562_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|2002769_2003303_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|2003259_2005398_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|2005394_2005601_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|2005597_2007145_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|2007068_2009150_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|2009240_2009564_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|2009556_2009856_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|2009836_2010403_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196701.1|2010399_2010801_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.2	2.6e-42
WP_000132756.1|2010812_2011562_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|2011607_2012006_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|2012002_2012332_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|2012411_2015399_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|2015395_2015728_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|2015826_2016324_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|2016440_2016974_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|2017063_2017759_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|2017768_2018506_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|2018403_2019108_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000178853.1|2022567_2022810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000143167.1|2025302_2025884_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_050951585.1|2026360_2027329_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	98.4	3.3e-192
WP_000334547.1|2027976_2028603_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|2028954_2029641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|2029911_2030103_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|2030529_2033142_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|2033349_2034360_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|2034525_2035068_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|2035064_2036174_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|2036272_2038381_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|2038393_2040301_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|2040315_2041569_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|2041573_2043214_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|2043210_2043774_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|2044029_2044197_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|2044296_2044815_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|2044883_2046644_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|2046829_2047282_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|2047353_2048406_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|2048762_2049272_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|2049488_2050094_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|2050080_2052234_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|2052252_2052699_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|2052822_2054877_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|2054912_2055371_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|2055465_2056128_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|2056301_2056715_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|2056759_2057077_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|2057134_2058346_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|2058560_2059109_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|2059134_2059914_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|2059962_2060244_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|2060240_2060570_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|2060656_2061316_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|2061936_2062617_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 5
NZ_CP051267	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 chromosome, complete genome	4815388	2802866	2859291	4815388	protease,tail,tRNA,transposase,integrase	Saccharomonospora_phage(11.11%)	61	2847346:2847368	2857060:2857082
WP_168728250.1|2802866_2803325_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000758418.1|2803515_2805201_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
WP_000290594.1|2805405_2805987_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_001221014.1|2806058_2806754_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128807.1|2806811_2808722_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_000029550.1|2808852_2809197_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457328.1|2809202_2809382_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000978464.1|2809462_2810827_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	1.9e-44
WP_000381544.1|2810830_2811409_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_001738311.1|2811672_2813037_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001192513.1|2813174_2814776_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_023139113.1|2814797_2816357_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
WP_000150521.1|2816829_2817798_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406918.1|2817850_2818651_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001518647.1|2818663_2819515_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156280.1|2819572_2820031_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001518359.1|2820440_2821007_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010923.1|2821003_2821813_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_000730322.1|2821878_2823624_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|2823843_2824053_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001537930.1|2824065_2824209_-	YobF family protein	NA	NA	NA	NA	NA
WP_001000660.1|2824857_2825145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714547.1|2825215_2825359_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001236777.1|2825516_2825756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262195.1|2825967_2826759_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_000416128.1|2826934_2828308_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984498.1|2828355_2829237_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_000502119.1|2829503_2829962_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001091237.1|2830141_2832190_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2832209_2832896_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|2832993_2833491_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2833619_2834903_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001535256.1|2834871_2837505_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001542138.1|2837582_2839022_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2839139_2839376_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457836.1|2839486_2839678_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986176.1|2839696_2840347_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_001134856.1|2840570_2840735_-	membrane protein	NA	NA	NA	NA	NA
WP_168728251.1|2841019_2841742_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|2842425_2842821_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|2843150_2843627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354408.1|2844014_2844434_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001752421.1|2844803_2845073_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_001617922.1|2845238_2845379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000684835.1|2846842_2847211_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
2847346:2847368	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_001233446.1|2848514_2849429_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2849561_2849720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|2849729_2850344_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_001520350.1|2850831_2850978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|2851491_2851617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989029.1|2852186_2852387_+	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000275418.1|2852483_2853365_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_000789530.1|2854089_2854257_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|2854513_2855047_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|2855100_2855331_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|2855520_2856015_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|2856074_2856929_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|2857302_2857656_-	YebY family protein	NA	NA	NA	NA	NA
2857060:2857082	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|2857672_2858548_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|2858548_2858923_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|2859060_2859291_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 6
NZ_CP051267	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 chromosome, complete genome	4815388	2934739	3014093	4815388	tail,protease,portal,plate,lysis,head,terminase,transposase,holin,integrase	Salmonella_phage(85.25%)	96	2941277:2941292	3015716:3015731
WP_000502119.1|2934739_2935198_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2935378_2936584_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2936662_2938150_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2938406_2939810_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_075146474.1|2939824_2940232_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2940231_2940600_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2940671_2942156_+	alpha-amylase	NA	NA	NA	NA	NA
2941277:2941292	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2942195_2942621_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2942806_2944012_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2944008_2944242_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2944506_2944893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2945012_2945327_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2945543_2947226_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2947218_2948214_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2948206_2948914_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2948913_2950284_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_075146475.1|2950305_2950749_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2950745_2951963_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2952067_2952535_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2952539_2953544_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2953540_2953954_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2953953_2954331_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2954330_2955068_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2955077_2955347_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2955355_2956150_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_071524019.1|2957092_2957341_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2957415_2957643_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2957952_2958768_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2958746_2960459_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2960623_2960869_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2960885_2961797_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2961972_2962893_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2962881_2963352_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2963332_2964763_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2964836_2965532_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2965623_2965923_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2966573_2967770_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2968030_2968219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2968229_2968442_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2968896_2970165_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2970167_2970587_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2970713_2970875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2971504_2971726_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_015701331.1|2973230_2973830_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_001207832.1|2975348_2975936_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_014343855.1|2975938_2976460_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_000605050.1|2977012_2977426_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2977430_2977964_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2977963_2979022_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2979018_2980359_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2980392_2982321_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2982405_2982732_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2982728_2983085_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2983084_2984581_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2984570_2984735_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2984738_2985299_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2985295_2985808_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2985779_2986184_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2986180_2986504_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2986506_2986707_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_001193639.1|2987987_2988638_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2988615_2989857_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2989856_2990039_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_075146477.1|2990050_2991784_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
WP_000929191.1|2991780_2992275_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2992400_2992751_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2992811_2993114_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2993333_2993753_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2993965_2994451_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2994447_2995062_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2995064_2995409_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2995570_2996005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2995934_2996192_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2996324_2996948_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202277.1|2996958_2997948_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_075146479.1|2997955_2998816_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	1.4e-162
WP_023139095.1|2998832_2999222_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	99.2	2.4e-69
WP_000066908.1|2999218_3000112_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|3000111_3000594_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|3000595_3001414_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001087402.1|3001631_3002789_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|3002785_3003340_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|3003368_3003593_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|3003690_3004386_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|3005200_3005572_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|3005629_3006457_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|3006593_3007133_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|3007203_3007434_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|3007430_3007946_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|3007942_3008560_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|3008556_3009390_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|3009393_3009963_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_001527041.1|3010002_3010230_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|3010231_3011221_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|3011512_3012310_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001219015.1|3013619_3014093_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
3015716:3015731	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 7
NZ_CP051267	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 chromosome, complete genome	4815388	3100081	3110587	4815388		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|3100081_3101395_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|3101421_3102501_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|3102505_3103279_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|3103275_3104268_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|3104273_3104825_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|3104825_3105704_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|3105751_3106651_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|3106650_3107736_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|3108112_3109006_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|3109183_3110587_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 8
NZ_CP051267	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 chromosome, complete genome	4815388	3178895	3188066	4815388	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_075146485.1|3178895_3180929_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|3181169_3181628_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|3181799_3182330_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3182386_3182854_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|3182900_3183620_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|3183616_3185302_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|3185524_3186256_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3186315_3186423_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|3186403_3187135_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3187118_3188066_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 9
NZ_CP051267	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 chromosome, complete genome	4815388	3207473	3273864	4815388	tail,holin,lysis	Salmonella_phage(30.0%)	59	NA	NA
WP_000989296.1|3207473_3208169_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|3208322_3209207_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|3209383_3210103_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|3210099_3210345_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_075146486.1|3210549_3211791_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|3211784_3213020_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|3213094_3214105_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|3214120_3215641_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_023139082.1|3215774_3216773_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|3217271_3218294_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_075146584.1|3218443_3219586_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|3219600_3220269_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|3220598_3221456_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|3221444_3221834_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|3221838_3223206_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_075146487.1|3223422_3224310_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|3224342_3225665_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|3225708_3227700_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|3228044_3229514_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|3229703_3230567_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|3230687_3231737_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|3231815_3232673_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|3232737_3234426_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|3234442_3235381_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|3235380_3236511_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|3236879_3238061_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|3238125_3238791_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|3238792_3238915_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|3239302_3239557_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|3239880_3240453_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|3240665_3241652_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|3241681_3242401_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|3242814_3243387_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|3243712_3245269_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|3245375_3247181_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|3247190_3248285_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|3248284_3249310_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|3249311_3250901_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|3250904_3251249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|3251639_3252830_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|3252857_3253553_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|3253704_3255465_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|3255589_3255874_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|3255982_3256603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|3256630_3257638_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|3257817_3258045_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|3258076_3259837_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|3260117_3260621_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|3260648_3260939_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_168728252.1|3261284_3263114_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	8.8e-61
WP_000022213.1|3263167_3263611_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|3263988_3264516_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|3264518_3265760_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|3266352_3266682_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|3266978_3268310_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|3268338_3268707_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_031602376.1|3268721_3269711_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	1.7e-188
WP_001113462.1|3272573_3272777_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|3273072_3273864_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 10
NZ_CP051267	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 chromosome, complete genome	4815388	3612314	3718268	4815388	tail,protease,lysis,capsid,head,terminase,tRNA,transposase,holin,integrase	Salmonella_phage(40.32%)	108	3636859:3636875	3726172:3726188
WP_000940032.1|3612314_3613046_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|3613164_3613968_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|3614112_3614991_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_023139062.1|3615172_3616216_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|3616219_3617038_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_168728256.1|3617048_3618062_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|3618062_3619049_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|3619039_3619678_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|3619803_3621081_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|3621075_3622215_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|3622410_3623664_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|3623988_3625179_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|3625360_3626905_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000100008.1|3627265_3628597_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|3628679_3630824_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|3630879_3632340_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|3632388_3632727_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|3632803_3634141_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|3634137_3634902_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|3634903_3636334_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
3636859:3636875	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|3636983_3640871_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|3640892_3641126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168728257.1|3641126_3642671_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|3642721_3643273_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|3643297_3643933_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|3643936_3645298_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|3645308_3646202_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|3646317_3647166_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|3647204_3648122_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|3648143_3649340_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|3649455_3650382_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|3650419_3650680_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|3650791_3651172_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|3651171_3651903_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|3651914_3652643_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|3652654_3653560_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|3653556_3654237_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|3654510_3655485_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|3655501_3657301_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_001542312.1|3659648_3659786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|3660498_3660663_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738443.1|3661370_3661583_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|3661689_3661917_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|3662013_3662592_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|3662581_3663406_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_075146502.1|3663402_3665775_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.4	1.1e-90
WP_000178853.1|3665828_3666071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080109167.1|3666109_3669472_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|3669533_3670181_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|3670078_3670816_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|3670822_3671521_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|3671530_3671860_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|3671862_3674958_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|3674929_3675268_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|3675264_3675660_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077248250.1|3675710_3676457_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_080075580.1|3676464_3676866_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	3.1e-51
WP_000817263.1|3676974_3678105_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|3678153_3678732_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|3678759_3679143_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|3679153_3679513_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|3679570_3680599_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|3680653_3681001_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|3681013_3682510_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000201415.1|3684262_3684466_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_168728258.1|3684449_3686381_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|3686352_3686898_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|3687183_3687585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|3687820_3688273_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_015701345.1|3688290_3688743_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|3688726_3689056_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|3689331_3690018_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|3690232_3690421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|3690927_3691491_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|3691763_3692441_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|3692437_3692578_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|3692574_3693186_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929803.1|3693394_3693997_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001217666.1|3694331_3694571_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_000445792.1|3695435_3695909_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000065105.1|3695908_3696433_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000113623.1|3696429_3696777_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|3696787_3697537_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|3697539_3698523_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|3698607_3698982_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869364.1|3698947_3699184_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009037.1|3699313_3699718_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000917562.1|3700116_3700275_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|3700296_3700647_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|3700773_3703701_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_168728259.1|3703711_3704335_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	88.4	3.1e-90
WP_077905288.1|3704283_3704820_+	DNA breaking-rejoining protein	NA	H6WRX0	Salmonella_phage	98.3	3.4e-90
WP_001237031.1|3704862_3705102_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|3705142_3705427_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|3705404_3706634_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|3707131_3707611_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|3707607_3708564_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|3708563_3709214_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|3709245_3709821_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|3709817_3709982_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|3710245_3711868_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|3711852_3712590_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|3712720_3714055_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|3714072_3714972_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023139269.1|3715074_3715662_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|3715723_3716107_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|3716425_3717115_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|3717230_3718268_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
3726172:3726188	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 1
NZ_CP051268	Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 plasmid pST33-93798, complete sequence	93798	20482	29778	93798	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_001541564.1|20482_20899_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|21082_21418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|21474_22041_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|22072_23014_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|23428_24634_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064274.1|24633_25608_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_000457541.1|25689_26964_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|26963_27386_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|27896_28367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|28359_28716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|29097_29778_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
