The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP051219	Escherichia coli strain SFE8 chromosome, complete genome	5061372	62622	77049	5061372		Morganella_phage(37.5%)	13	NA	NA
WP_001295237.1|62622_63246_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_001395780.1|63503_65186_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	3.3e-22
WP_000924289.1|65182_65800_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001299758.1|66091_66916_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	6.9e-90
WP_000588629.1|67617_67905_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000230707.1|68164_68620_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	2.9e-45
WP_000678612.1|68699_68900_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	43.1	1.3e-05
WP_001363070.1|69382_69778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729823.1|69797_71915_-	hypothetical protein	NA	A0A2D1GLK8	Escherichia_phage	57.9	1.3e-169
WP_021548279.1|71899_73243_-	phage DNA ejection protein	NA	A0A0M5M1J8	Salmonella_phage	71.4	1.6e-160
WP_001018522.1|73247_73421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032235469.1|73601_74060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244106.1|74292_77049_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	1.8e-299
>prophage 2
NZ_CP051219	Escherichia coli strain SFE8 chromosome, complete genome	5061372	671782	768493	5061372	integrase,tRNA,transposase	Escherichia_phage(28.0%)	80	695621:695637	733750:733766
WP_000450589.1|671782_672115_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001297164.1|672156_673536_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000094682.1|673953_675474_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|675627_676251_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001065895.1|676527_677292_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000290290.1|677588_678905_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	3.5e-35
WP_000268404.1|679034_679631_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	9.4e-97
WP_000256688.1|679713_681318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265818.1|682096_682324_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001354442.1|682386_683133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001428286.1|683414_683915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000628304.1|684296_684911_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_077896578.1|684938_685505_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001360193.1|685711_686698_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	2.2e-167
WP_000053329.1|687123_688134_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	28.3	5.1e-18
WP_000433621.1|688227_690354_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_001099189.1|690408_691686_+	MFS transporter	NA	NA	NA	NA	NA
WP_000813683.1|691682_693113_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_000523728.1|693176_693692_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001313182.1|693697_693901_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001313183.1|693962_694274_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000108760.1|694303_695230_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001696225.1|695329_696826_+	carbohydrate porin	NA	NA	NA	NA	NA
695621:695637	attL	CTGCTGATGAACGATGC	NA	NA	NA	NA
WP_001189119.1|699321_700830_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	2.3e-43
WP_077253078.1|701392_701650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000003143.1|701754_701949_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072668134.1|701951_704633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361559.1|704650_705649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157877.1|705688_708952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286234.1|708948_709455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000577204.1|709466_712190_+	DEAD/DEAH box helicase family protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	24.8	2.0e-40
WP_001175593.1|713409_713733_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001089729.1|713838_714972_+	permease	NA	NA	NA	NA	NA
WP_001029679.1|716982_717804_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000267723.1|717790_719899_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|719895_721563_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067858.1|722448_723153_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_072668103.1|723920_725537_+	transcriptional antiterminator	NA	NA	NA	NA	NA
WP_168725307.1|725767_725962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|725938_726643_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_013188475.1|726743_727619_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_014342101.1|727598_727721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434930.1|728123_728750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|728846_729551_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001199192.1|729664_730441_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|730669_731695_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|732116_732869_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_167811043.1|734450_735725_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
733750:733766	attR	CTGCTGATGAACGATGC	NA	NA	NA	NA
WP_001053381.1|735799_736573_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.4	5.5e-73
WP_072668450.1|736572_737598_-|transposase	IS21-like element ISEc57 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	43.8	5.6e-73
WP_001255015.1|737959_738265_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058100717.1|738292_739507_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001447541.1|739723_740608_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_015344975.1|740638_742132_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|742342_742567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|742639_743344_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_047340819.1|744871_745744_+	GTPase family protein	NA	NA	NA	NA	NA
WP_047340818.1|746115_748962_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001234702.1|749289_750108_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.3	8.0e-46
WP_000214418.1|750198_750684_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	5.3e-13
WP_001186773.1|750699_751176_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|751238_751460_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_000086744.1|751474_752119_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	33.8	3.4e-28
WP_001360188.1|752168_752537_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854801.1|752626_753004_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000761658.1|753000_753489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839269.1|753500_753698_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000228937.1|754927_755434_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|755512_757354_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|757548_759294_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|759404_759620_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|759856_760870_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_000804934.1|760912_762376_-	L-tartrate/succinate antiporter	NA	NA	NA	NA	NA
WP_000722957.1|762424_763030_-	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_000986797.1|763026_763938_-	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_000935206.1|764144_765077_+	DNA-binding transcriptional activator TtdR	NA	NA	NA	NA	NA
WP_001272796.1|765089_765707_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_001325893.1|765811_766180_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001305111.1|766270_767092_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000708500.1|767254_768493_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 3
NZ_CP051219	Escherichia coli strain SFE8 chromosome, complete genome	5061372	1149897	1157037	5061372		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1149897_1150536_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1150532_1151795_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1151791_1152700_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1152895_1153663_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|1153713_1154370_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272924.1|1154475_1157037_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 4
NZ_CP051219	Escherichia coli strain SFE8 chromosome, complete genome	5061372	1227102	1287628	5061372	head,lysis,protease,tail,transposase,integrase,portal,tRNA,holin,terminase,plate,capsid	Shigella_phage(48.15%)	76	1263686:1263701	1282470:1282485
WP_085948468.1|1227102_1228264_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000577254.1|1228416_1230135_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_000214996.1|1230136_1231885_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.7	0.0e+00
WP_000448925.1|1231956_1232373_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|1232411_1233641_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_045171897.1|1234265_1235081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145022.1|1235070_1235454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206590.1|1235467_1236640_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.0	2.0e-146
WP_001331174.1|1236600_1236807_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001075212.1|1236848_1237715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072646408.1|1237823_1238348_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.7	9.1e-96
WP_000081296.1|1238476_1239301_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.3	7.8e-150
WP_000135682.1|1239366_1239729_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000016389.1|1240197_1240632_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549623.1|1240603_1240810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020634.1|1241149_1241842_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|1241939_1242200_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|1242192_1242744_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|1242919_1243099_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001406328.1|1243088_1244030_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	5.6e-152
WP_073313562.1|1244026_1244521_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	2.1e-86
WP_001305610.1|1244520_1245174_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_073313559.1|1245170_1245497_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.0e-53
WP_001532216.1|1245493_1245883_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	7.8e-68
WP_044687610.1|1245902_1246712_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_073313556.1|1246719_1247709_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.2e-194
WP_001205472.1|1247726_1248074_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.0	9.4e-57
WP_001163088.1|1248095_1248980_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001037093.1|1248985_1249504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120498.1|1249837_1250164_+|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	98.1	3.4e-56
WP_054625651.1|1250167_1250650_+	glycoside hydrolase family protein	NA	K7P7P0	Enterobacteria_phage	93.0	1.3e-83
WP_023566046.1|1250642_1251107_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	66.4	8.5e-45
WP_073313554.1|1251188_1251947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073313552.1|1252026_1252377_+	HNH endonuclease	NA	Q8SBD7	Shigella_phage	98.3	4.0e-63
WP_000929175.1|1252502_1252997_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_122986317.1|1253230_1254727_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	9.7e-300
WP_000478565.1|1254738_1254921_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	95.0	3.2e-24
WP_000466255.1|1254920_1256162_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193631.1|1256139_1256790_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_089631983.1|1256804_1258010_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	9.1e-224
WP_000601360.1|1258059_1258260_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927719.1|1258262_1258586_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702387.1|1258582_1258993_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	5.7e-69
WP_000235780.1|1258967_1259474_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	2.9e-83
WP_000779279.1|1259470_1260031_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000497751.1|1260039_1260210_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_089631982.1|1260193_1261690_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.6	1.5e-271
WP_000090998.1|1261689_1262046_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|1262045_1262315_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000807181.1|1262456_1264292_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.4	3.5e-307
1263686:1263701	attL	CGTTGGCGGTGCCATC	NA	NA	NA	NA
WP_122991517.1|1264352_1265681_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	2.1e-245
WP_000999504.1|1265677_1266757_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	1.7e-205
WP_089631980.1|1266756_1267305_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	99.5	6.6e-97
WP_122991516.1|1267304_1267730_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	6.7e-81
WP_089631978.1|1267716_1268775_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.7	8.9e-199
WP_089631977.1|1268765_1269350_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	7.0e-113
WP_168725314.1|1269353_1270079_+|integrase	integrase	integrase	U5P0I1	Shigella_phage	94.4	2.5e-51
WP_021533210.1|1270078_1270681_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.5	5.6e-97
WP_021533209.1|1270652_1271096_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	95.9	1.0e-79
WP_001559668.1|1271116_1271527_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000834401.1|1271780_1273670_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001072750.1|1274563_1275484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162574.1|1276229_1276712_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|1276843_1277320_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1277309_1277600_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1277661_1278003_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1278151_1279813_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1279898_1280777_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001300112.1|1280899_1281490_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287916.1|1281524_1282130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723175.1|1282251_1283538_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
1282470:1282485	attR	CGTTGGCGGTGCCATC	NA	NA	NA	NA
WP_001338897.1|1283558_1284350_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1284516_1285878_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1286014_1286263_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1286281_1286830_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1286860_1287628_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP051219	Escherichia coli strain SFE8 chromosome, complete genome	5061372	1795835	1805276	5061372		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|1795835_1796762_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1796766_1797498_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1797478_1797586_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1797645_1798377_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1798598_1800284_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1800280_1801000_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_063108270.1|1801046_1801517_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.5e-81
WP_001295429.1|1801556_1802018_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001349936.1|1802142_1804143_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001292769.1|1804139_1805276_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 6
NZ_CP051219	Escherichia coli strain SFE8 chromosome, complete genome	5061372	1817787	1877716	5061372	head,lysis,protease,tail,integrase,portal,tRNA,terminase,plate,capsid	Escherichia_phage(21.95%)	65	1843677:1843698	1876184:1876205
WP_001295427.1|1817787_1819821_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|1819952_1821062_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|1821324_1821606_+	YehE family protein	NA	NA	NA	NA	NA
WP_001026151.1|1824345_1825380_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1825461_1825800_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134575.1|1826018_1826843_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1826963_1827236_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195591.1|1827458_1828247_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1828243_1829044_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001297420.1|1829108_1829927_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434038.1|1829978_1830725_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011973.1|1830698_1831664_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846218.1|1831660_1832665_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_089631989.1|1832661_1833939_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1834195_1835248_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|1835556_1836411_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_089631988.1|1836439_1837702_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_032178620.1|1837711_1838164_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|1838194_1838479_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1838482_1839838_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844200.1|1839885_1840926_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1841025_1841805_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1841886_1842786_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|1843200_1843518_+	hypothetical protein	NA	NA	NA	NA	NA
1843677:1843698	attL	AAAAAATAAGCCCGTGTAAGGG	NA	NA	NA	NA
WP_000111938.1|1843782_1844796_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	83.6	1.4e-164
WP_000613396.1|1844892_1845189_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	71.1	8.6e-35
WP_001082439.1|1845324_1845600_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	82.2	4.4e-41
WP_000662666.1|1845610_1845781_+	hypothetical protein	NA	A0A0F7LCM1	Escherichia_phage	68.5	2.4e-13
WP_000217659.1|1845777_1846278_+	hypothetical protein	NA	M1SV55	Escherichia_phage	83.7	3.7e-78
WP_000549519.1|1846344_1846563_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	64.0	1.6e-09
WP_000027679.1|1846585_1846861_+	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	47.7	5.2e-18
WP_000257718.1|1846850_1849142_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	74.0	0.0e+00
WP_001461201.1|1849141_1849606_+	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	53.3	3.9e-42
WP_001396141.1|1849617_1849842_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	59.4	6.4e-14
WP_001396142.1|1850142_1851771_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_000906719.1|1851773_1852886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000747182.1|1852981_1853989_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.1	1.1e-161
WP_000156051.1|1853990_1855760_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	84.7	4.7e-301
WP_001085983.1|1855926_1856781_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	73.9	4.8e-118
WP_168725321.1|1856841_1857909_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.1	7.4e-169
WP_000203407.1|1857912_1858668_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	72.6	1.3e-87
WP_000214249.1|1858767_1859274_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.6	2.0e-63
WP_000870103.1|1859273_1859477_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	83.6	2.9e-26
WP_000524521.1|1859467_1859689_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	79.2	2.2e-27
WP_000094908.1|1859672_1860182_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	85.1	2.0e-79
WP_000866050.1|1860178_1860604_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	71.9	4.6e-45
WP_001171050.1|1860699_1861167_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	72.3	2.2e-61
WP_001001754.1|1861159_1861600_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.1	3.5e-48
WP_001396148.1|1861907_1862900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001061833.1|1863331_1863973_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	81.7	5.6e-95
WP_000218497.1|1863969_1864320_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	72.4	8.1e-40
WP_001018859.1|1864325_1865234_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	82.5	7.0e-136
WP_001282890.1|1865226_1865757_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.9	4.0e-91
WP_000216933.1|1865768_1867454_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	60.0	1.0e-124
WP_000143189.1|1867453_1868032_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	52.1	8.4e-50
WP_001286670.1|1868167_1869361_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.9	6.8e-187
WP_001207672.1|1869373_1869892_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.7	6.5e-78
WP_000789944.1|1869946_1870261_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	63.9	1.9e-27
WP_000763322.1|1870293_1870416_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	84.6	1.9e-12
WP_000069995.1|1870405_1872847_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.7	7.8e-307
WP_000928499.1|1872860_1873325_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	71.4	3.2e-60
WP_089632020.1|1873321_1874485_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	79.0	5.1e-171
WP_000468306.1|1874565_1874787_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	75.3	4.5e-28
WP_001059829.1|1875093_1875945_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_000475999.1|1876354_1877716_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	4.2e-217
1876184:1876205	attR	AAAAAATAAGCCCGTGTAAGGG	NA	NA	NA	NA
>prophage 7
NZ_CP051219	Escherichia coli strain SFE8 chromosome, complete genome	5061372	2278825	2322299	5061372	transposase	Enterobacteria_phage(27.27%)	24	NA	NA
WP_032346664.1|2278825_2278939_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	74.3	1.2e-08
WP_106652286.1|2279762_2281403_+	immunoglobulin-binding protein	NA	Q9MCI8	Enterobacteria_phage	76.1	6.8e-20
WP_001300563.1|2281612_2282725_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000884153.1|2282813_2283269_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_102384962.1|2283478_2284706_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000095521.1|2288413_2289607_-	MFS transporter	NA	NA	NA	NA	NA
WP_000602863.1|2289742_2291467_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000011908.1|2291467_2292415_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015724.1|2292414_2294157_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001354579.1|2294153_2295431_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_024179179.1|2295512_2297714_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000968123.1|2300303_2301182_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101720.1|2301178_2302036_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983725.1|2302032_2302860_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.9	1.9e-10
WP_000555617.1|2302859_2303774_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000823671.1|2307135_2307660_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	62.4	3.0e-62
WP_001470144.1|2307788_2308013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024211228.1|2309261_2309582_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000017086.1|2314867_2316094_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	34.2	1.5e-64
WP_000502867.1|2316078_2316723_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.5	1.6e-54
WP_168725333.1|2318312_2319335_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	4.6e-200
WP_168725334.1|2319334_2320114_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	2.9e-138
WP_000248798.1|2320740_2321061_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	70.9	8.8e-33
WP_000952434.1|2321126_2322299_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	97.7	1.4e-224
>prophage 8
NZ_CP051219	Escherichia coli strain SFE8 chromosome, complete genome	5061372	2329807	2395183	5061372	integrase,tRNA,transposase	Shigella_phage(20.0%)	57	2320329:2320344	2360512:2360527
2320329:2320344	attL	GCATTCCTCTTCTGGC	NA	NA	NA	NA
WP_000881114.1|2329807_2330200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001354603.1|2332003_2333035_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_001266790.1|2334788_2336876_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	33.8	2.3e-09
WP_102384962.1|2337473_2338702_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000285581.1|2339145_2339424_+	DUF1525 domain-containing protein	NA	NA	NA	NA	NA
WP_077248705.1|2339427_2339541_+	DUF1525 domain-containing protein	NA	NA	NA	NA	NA
WP_001470069.1|2341485_2341647_+|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	71.4	4.3e-12
WP_029400372.1|2341878_2342331_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_000533456.1|2344666_2346646_+	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_001470088.1|2346696_2346891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001470087.1|2346938_2347118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001354049.1|2347114_2347297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001354050.1|2349389_2349638_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000907124.1|2349669_2349846_-	protein convertase	NA	NA	NA	NA	NA
WP_001066120.1|2349921_2350242_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_050554504.1|2350259_2350556_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001298859.1|2351428_2352970_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2352984_2353731_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001354052.1|2354180_2354570_+	cytochrome B562	NA	NA	NA	NA	NA
WP_001354053.1|2355067_2355241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089623569.1|2357398_2358034_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001218736.1|2358584_2359772_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.6	5.8e-122
WP_000524071.1|2359959_2360508_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000975812.1|2360507_2361215_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
2360512:2360527	attR	GCATTCCTCTTCTGGC	NA	NA	NA	NA
WP_000077941.1|2361229_2361907_-	protein YdjY	NA	NA	NA	NA	NA
WP_001299560.1|2361911_2362622_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_000673925.1|2362788_2363595_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_000081983.1|2364040_2365261_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
WP_000989414.1|2365257_2366292_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_168725335.1|2366288_2367767_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000995008.1|2367763_2369107_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_089562751.1|2369099_2370068_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_001228981.1|2370397_2370883_+	ATP-independent periplasmic protein-refolding chaperone	NA	NA	NA	NA	NA
WP_000455601.1|2371085_2371661_+	environmental stress-induced protein Ves	NA	NA	NA	NA	NA
WP_000252397.1|2371620_2372508_-	excinuclease Cho	NA	NA	NA	NA	NA
WP_000175050.1|2372737_2373565_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.2e-73
WP_001039044.1|2373766_2374105_+	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_000412169.1|2374404_2374725_+	PTS N,N'-diacetylchitobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_000073041.1|2374809_2376168_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000968919.1|2376218_2376569_+	PTS N,N'-diacetylchitobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_024251449.1|2376579_2377419_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_000078745.1|2377523_2378876_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_000440441.1|2378888_2379647_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_000077843.1|2379693_2381955_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
WP_001241561.1|2382137_2382401_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_001396674.1|2382677_2383493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010707.1|2383496_2384888_-	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_001295408.1|2385020_2385611_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000106833.1|2385773_2386442_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000222172.1|2386588_2387125_+	membrane protein	NA	NA	NA	NA	NA
WP_000267650.1|2387165_2388026_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000146149.1|2388132_2388423_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000251735.1|2388523_2389453_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000771396.1|2389739_2390498_+	YdiY family protein	NA	NA	NA	NA	NA
WP_001142445.1|2390550_2390658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081120.1|2390833_2392732_-	type III secretion system effector EspL1	NA	NA	NA	NA	NA
WP_001144192.1|2393254_2395183_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 9
NZ_CP051219	Escherichia coli strain SFE8 chromosome, complete genome	5061372	3186182	3273702	5061372	head,lysis,protease,tail,portal,integrase,tRNA,terminase,plate,capsid	Salmonella_phage(58.33%)	92	3179144:3179159	3276273:3276288
3179144:3179159	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3186182_3187475_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3187565_3188909_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3188919_3189531_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077063.1|3189685_3193792_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3193926_3194421_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3194965_3195931_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|3196053_3197820_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|3197820_3199542_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_168725343.1|3199583_3200288_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3200572_3200791_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_168725344.1|3201713_3203990_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.6	1.9e-166
WP_000520781.1|3204020_3204341_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3204663_3204888_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|3204960_3206907_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|3206903_3208019_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_162842175.1|3208175_3209126_+	DUF535 family protein	NA	NA	NA	NA	NA
WP_000599820.1|3209122_3210781_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3211206_3211902_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491127.1|3212397_3213297_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3213440_3215093_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_168725345.1|3215104_3216073_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|3216205_3217924_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|3217960_3218962_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3218972_3220403_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3220501_3221515_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|3221511_3222342_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3222338_3222662_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3222787_3223303_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3223520_3224249_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3224266_3224998_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3225004_3225721_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_168725346.1|3225720_3226389_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3226680_3227412_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149734.1|3227586_3228714_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
WP_000389260.1|3228754_3229243_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3229302_3230148_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105430.1|3230144_3231098_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996025.1|3231107_3232241_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000126072.1|3232335_3233448_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3233799_3234276_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3234363_3235266_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_089631889.1|3235326_3236049_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3236032_3236320_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3236479_3236737_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3236766_3237144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3237413_3239099_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3239334_3239553_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_032141791.1|3239643_3240744_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	4.5e-177
WP_032141790.1|3240740_3241226_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_089631890.1|3241222_3244300_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|3244292_3244412_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3244426_3244729_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3244783_3245299_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_089631892.1|3245308_3246481_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.7	8.6e-203
WP_000905033.1|3246623_3247190_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_032216050.1|3247220_3247625_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	43.1	7.2e-16
WP_044069214.1|3247633_3248029_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	56.1	3.5e-15
WP_089631893.1|3248000_3248420_-|tail	phage tail protein	tail	M1SNQ2	Escherichia_phage	62.1	2.1e-34
WP_089631895.1|3248416_3249838_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.7	2.6e-153
WP_001583365.1|3249834_3250440_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	5.8e-110
WP_001583364.1|3250432_3251341_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_000177591.1|3251327_3251687_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	8.0e-51
WP_032141780.1|3251683_3252262_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.5	1.5e-94
WP_000829122.1|3252330_3252777_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	5.1e-63
WP_044069632.1|3252769_3253201_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	2.9e-71
WP_001504068.1|3253296_3253725_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.4	4.9e-47
WP_000727849.1|3253721_3254099_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	5.1e-16
WP_001069905.1|3254100_3254613_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|3254593_3254809_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3254812_3255016_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|3255015_3255480_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_044069629.1|3255575_3256226_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	5.6e-111
WP_044069627.1|3256229_3257288_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	2.4e-180
WP_000216237.1|3257304_3258138_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001098431.1|3258280_3260047_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_061348713.1|3260046_3261072_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	90.0	4.0e-172
WP_052431344.1|3261120_3261915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044069624.1|3261989_3262997_-	ParA family protein	NA	Q7M293	Enterobacteria_phage	27.8	6.4e-21
WP_029365156.1|3263447_3265340_-	NTPase KAP	NA	NA	NA	NA	NA
WP_001217575.1|3265654_3265888_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|3265898_3266087_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_089631897.1|3266239_3268654_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.8	0.0e+00
WP_089631898.1|3268650_3269508_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.2	1.2e-153
WP_000752613.1|3269504_3269732_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244216.1|3269731_3269965_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_089631900.1|3270032_3270374_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	8.7e-55
WP_089631901.1|3270491_3270788_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	8.4e-22
WP_000460893.1|3270795_3271305_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_001247707.1|3271337_3271559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047327.1|3271684_3272254_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_000900883.1|3272269_3272461_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290950.1|3272649_3273702_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3276273:3276288	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 10
NZ_CP051219	Escherichia coli strain SFE8 chromosome, complete genome	5061372	3549189	3621878	5061372	head,lysis,protease,tail,transposase,portal,terminase,capsid	Enterobacteria_phage(54.24%)	82	NA	NA
WP_001300563.1|3549189_3550302_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956456.1|3550378_3550531_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130618.1|3550972_3552091_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682518.1|3552156_3552405_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|3552469_3552838_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351464.1|3552931_3553585_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153146.1|3553692_3554940_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786320.1|3555007_3556384_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573940.1|3556485_3559629_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
WP_000717160.1|3559640_3560864_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709865.1|3560879_3561212_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074237.1|3561235_3562618_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770941.1|3562774_3563458_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_032141754.1|3563447_3564890_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000383954.1|3565039_3567277_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001580085.1|3567263_3570236_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224602.1|3570236_3571127_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|3571309_3572071_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001201810.1|3572584_3573538_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_053285649.1|3573787_3574537_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_101135208.1|3575082_3575658_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	3.6e-101
WP_000279133.1|3575657_3579056_-	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233090.1|3579120_3579720_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000515477.1|3579790_3583288_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.9	0.0e+00
WP_000090891.1|3583347_3583980_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000140727.1|3583916_3584660_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	2.7e-149
WP_001152632.1|3584665_3585364_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	9.5e-133
WP_000847379.1|3585363_3585693_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_089632025.1|3585689_3588269_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.2	0.0e+00
WP_000459457.1|3588261_3588696_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479142.1|3588677_3589100_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_089632026.1|3589115_3589856_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	4.0e-129
WP_000683105.1|3589863_3590259_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975081.1|3590255_3590834_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|3590845_3591199_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158863.1|3591210_3591606_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	7.4e-58
WP_000063250.1|3591647_3592673_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_001358225.1|3592728_3593061_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_094396015.1|3593070_3594390_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001359455.1|3594370_3595972_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000198149.1|3595968_3596175_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027266.1|3596171_3598097_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_168725347.1|3598071_3598617_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	5.2e-94
WP_001307652.1|3599006_3599201_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738421.1|3599561_3599855_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|3599945_3600128_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|3600344_3600842_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|3600841_3601057_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737275.1|3601646_3602729_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_001204791.1|3602917_3603301_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3603386_3603527_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3603523_3603886_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|3603882_3604173_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224912.1|3604165_3604336_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_001053034.1|3604335_3604791_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_072130332.1|3604787_3604889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053286786.1|3604978_3605335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351655.1|3605796_3606120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709074.1|3606231_3607758_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	3.6e-31
WP_032139864.1|3607815_3607923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|3608014_3608347_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145903.1|3608414_3608717_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	94.6	4.4e-42
WP_000788890.1|3608713_3609415_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_001361484.1|3609411_3610341_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.0e-110
WP_001182871.1|3610427_3610967_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_000184665.1|3610997_3611225_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712397.1|3611335_3612028_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	1.5e-109
WP_102384962.1|3612144_3613373_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000957425.1|3613899_3614946_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	96.8	4.4e-198
WP_000233576.1|3615589_3615796_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|3615871_3616168_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100845.1|3616173_3616959_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186886.1|3616955_3617636_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.3	4.3e-130
WP_000682318.1|3617632_3617815_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548531.1|3617787_3617979_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|3617989_3618271_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|3618369_3618588_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3618635_3618914_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|3618885_3619257_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000839179.1|3619545_3619950_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|3619946_3620294_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333339.1|3620342_3621878_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
>prophage 11
NZ_CP051219	Escherichia coli strain SFE8 chromosome, complete genome	5061372	3918834	3950982	5061372	integrase,plate,transposase	Vibrio_phage(100.0%)	28	3928557:3928571	3952277:3952291
WP_000420795.1|3918834_3919971_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_001199686.1|3922786_3923218_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_032141711.1|3923245_3925465_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_168725351.1|3925489_3925861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402126.1|3925857_3926424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024170797.1|3926640_3927417_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_032217617.1|3927416_3931283_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
3928557:3928571	attL	CTGCTCCACCACCGC	NA	NA	NA	NA
WP_000522897.1|3931282_3931528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060994.1|3931578_3932253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402123.1|3932258_3933575_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_000118770.1|3933571_3934915_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001402122.1|3934918_3935452_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119441.1|3935519_3936005_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000871596.1|3936118_3936490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533466.1|3936486_3936972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000245849.1|3937024_3938539_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996814.1|3938563_3939109_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000144225.1|3939170_3939461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040751.1|3939463_3940027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542643.1|3940039_3942673_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.8	2.5e-80
WP_000804010.1|3943005_3943920_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000183810.1|3943906_3944737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276642.1|3944733_3945228_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371477.1|3945243_3947127_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000063810.1|3947123_3948119_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000450225.1|3948129_3949176_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000985079.1|3949175_3949451_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_001396203.1|3950616_3950982_+|integrase	integrase	integrase	NA	NA	NA	NA
3952277:3952291	attR	CTGCTCCACCACCGC	NA	NA	NA	NA
>prophage 12
NZ_CP051219	Escherichia coli strain SFE8 chromosome, complete genome	5061372	4122239	4211559	5061372	integrase,tRNA,transposase	Escherichia_phage(29.63%)	83	4145186:4145245	4157254:4158074
WP_000525182.1|4122239_4122899_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_001200573.1|4123015_4123831_-	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_000746151.1|4124085_4126440_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_000800457.1|4126492_4127779_+	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_000241259.1|4127778_4128768_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_001065381.1|4128764_4129586_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_000610901.1|4129588_4129966_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_000257186.1|4129972_4130815_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|4130892_4131372_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000377129.1|4131563_4133426_-	glutathione-regulated potassium-efflux system protein KefC	NA	NA	NA	NA	NA
WP_000600725.1|4133418_4133949_-	glutathione-regulated potassium-efflux system oxidoreductase KefF	NA	NA	NA	NA	NA
WP_001183198.1|4134056_4135388_-	MFS transporter	NA	NA	NA	NA	NA
WP_000203741.1|4135446_4135734_-	ferredoxin-like protein FixX	NA	NA	NA	NA	NA
WP_001067858.1|4136761_4137466_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_168725355.1|4137456_4137939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168725369.1|4139674_4140019_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001067855.1|4140043_4140748_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|4141503_4142355_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|4142662_4143478_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|4143538_4144342_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4144341_4145178_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
4145186:4145245	attL	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_168725356.1|4145238_4145943_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.4e-138
WP_000018329.1|4146093_4146909_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|4147081_4147786_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001403349.1|4147762_4148188_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.7e-53
WP_000027057.1|4148370_4149231_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001347546.1|4149380_4149806_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|4149817_4150522_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000454193.1|4150802_4151153_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_168725357.1|4151355_4152369_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	8.0e-72
WP_000777555.1|4152525_4152999_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	33.8	3.7e-19
WP_001206317.1|4153091_4153883_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|4154046_4154394_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|4154387_4155227_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|4155354_4155855_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|4155823_4156816_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_168725356.1|4157306_4158011_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.4e-138
WP_085955245.1|4158327_4159520_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
4157254:4158074	attR	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGGCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_001138082.1|4159640_4162526_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_001043843.1|4162590_4163016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224687.1|4163564_4163873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|4163888_4164746_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	38.7	1.8e-11
WP_001194555.1|4164807_4165011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287392.1|4165352_4165757_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000175476.1|4166254_4166491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000475945.1|4166532_4166988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|4167047_4167713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|4167770_4168151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|4168793_4169612_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|4170182_4171396_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000078514.1|4172407_4173727_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000220758.1|4173749_4173917_-	hypothetical protein	NA	A0A1P7WFU2	Pectobacterium_phage	54.5	1.9e-07
WP_000833382.1|4173977_4175405_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|4175619_4176135_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|4176137_4177034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|4177255_4177489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|4178150_4178381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|4178717_4179179_+	hypothetical protein	NA	A0A2H4IBJ0	Erwinia_phage	37.9	7.7e-14
WP_000074418.1|4179208_4179616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|4179666_4179984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|4180360_4180711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351729.1|4182575_4182968_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|4183105_4183990_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|4184021_4185221_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|4185326_4185977_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_063102497.1|4189588_4189975_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084745.1|4190294_4190687_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001067858.1|4191010_4191715_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000787103.1|4192019_4193534_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|4193564_4194707_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349938.1|4194835_4196053_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001395601.1|4196126_4197680_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	6.2e-31
WP_000004397.1|4197788_4198574_+	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000122876.1|4198579_4199170_+	carnitine operon protein CaiE	NA	NA	NA	NA	NA
WP_000333120.1|4199255_4199651_-	carnitine metabolism transcriptional regulator CaiF	NA	NA	NA	NA	NA
WP_001126376.1|4199911_4203133_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_000597260.1|4203150_4204299_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
WP_000543605.1|4204754_4205576_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_001239142.1|4205742_4206657_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_001166395.1|4206722_4207673_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_000004655.1|4207674_4208124_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000083372.1|4208248_4208743_-	signal peptidase II	NA	NA	NA	NA	NA
WP_001286859.1|4208742_4211559_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 1
NZ_CP051220	Escherichia coli strain SFE8 plasmid pSCZP1, complete sequence	107230	3860	54308	107230	transposase,integrase	Escherichia_phage(40.0%)	44	NA	NA
WP_106693623.1|3860_5399_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	6.7e-296
WP_021531026.1|5510_5846_-	immunity protein	NA	NA	NA	NA	NA
WP_106693625.1|5974_6322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106693627.1|6339_6930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168725371.1|6926_7166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102384962.1|7176_8404_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000670961.1|8850_9303_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_136669667.1|9412_9868_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	34.6	2.7e-11
WP_168725372.1|10085_10568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045133246.1|11060_11483_-	adhesin	NA	NA	NA	NA	NA
WP_168725373.1|11499_12657_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_000080195.1|13710_15324_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624677.1|15354_15705_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_000422696.1|15701_16121_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	2.2e-44
WP_168725374.1|16610_20108_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	35.2	1.8e-99
WP_168725375.1|21851_22241_-	cytochrome B562	NA	NA	NA	NA	NA
WP_000470711.1|22674_23565_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024188138.1|23642_24866_-	cytosine permease	NA	NA	NA	NA	NA
WP_001696803.1|24888_25278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062894335.1|25294_26251_-	carbamate kinase	NA	NA	NA	NA	NA
WP_053287902.1|26243_27668_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000865634.1|27664_29224_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_001442105.1|29318_30179_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000155780.1|30184_30853_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001557184.1|33128_33722_-	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	40.9	1.1e-31
WP_168725376.1|33721_34099_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.0	2.3e-24
WP_000633913.1|34327_34972_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|34965_35241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113452213.1|35377_36187_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	2.1e-54
WP_001159871.1|36187_36493_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813639.1|36494_36713_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_106693592.1|37270_41092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000251882.1|41335_41497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106693595.1|41514_41862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000864815.1|42751_43105_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_166494957.1|43277_43934_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.7e-54
WP_000929752.1|44886_45096_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_024198451.1|45284_46040_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_136669669.1|46194_48726_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_045133246.1|48742_49165_+	adhesin	NA	NA	NA	NA	NA
WP_168725377.1|49657_50140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001323403.1|50867_51647_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|51646_52669_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_102384962.1|53080_54308_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
