The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	778831	825223	8045912	transposase,integrase,holin	Mycobacterium_phage(20.0%)	43	811440:811459	831279:831298
WP_168584662.1|778831_779221_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_168584663.1|779336_780302_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_168584664.1|780553_781600_+	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168584665.1|781818_782598_+	DUF952 domain-containing protein	NA	A0A291AU44	Pandoravirus	37.7	2.1e-11
WP_168584666.1|782545_782956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168584667.1|783360_783768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168584668.1|784202_785702_+	amino acid permease	NA	NA	NA	NA	NA
WP_168584669.1|785972_786242_-	UBP-type zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_168584670.1|786346_787912_+	Na+/H+ antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	28.8	4.6e-10
WP_168584671.1|788003_788747_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168584672.1|788966_790154_+	oxidoreductase	NA	NA	NA	NA	NA
WP_168584673.1|790164_790992_-	alpha/beta hydrolase	NA	A0A249XMC3	Mycobacterium_phage	30.0	1.9e-18
WP_168584674.1|791161_791812_-	sarcosine oxidase subunit gamma	NA	NA	NA	NA	NA
WP_168584675.1|791777_794612_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168584676.1|794608_794875_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_168584677.1|795108_796332_-	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_168584678.1|796418_797075_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168584679.1|797299_799771_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168584680.1|799987_801184_+	glycine cleavage system protein T	NA	NA	NA	NA	NA
WP_168589772.1|801220_802063_+	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_168584681.1|802059_803757_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_168584682.1|803806_803968_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_168584683.1|804133_804751_-	helix-turn-helix domain-containing protein	NA	A0A1J0MCL6	Streptomyces_phage	36.8	9.3e-23
WP_168584684.1|804806_805151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168584685.1|805382_805913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168584686.1|806025_806361_+	YnfA family protein	NA	NA	NA	NA	NA
WP_168584687.1|806370_806715_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168584688.1|806814_808713_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.8	3.2e-98
WP_168584689.1|808916_809768_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168589773.1|809998_810589_-	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_168584690.1|811173_813702_-	DUF3516 domain-containing protein	NA	M1HP49	Acanthocystis_turfacea_Chlorella_virus	32.8	6.1e-44
811440:811459	attL	CCAGCGCACCGAGCTGGTCG	NA	NA	NA	NA
WP_168584691.1|813859_814060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168584692.1|814106_814388_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_168584693.1|814384_814645_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2P1N333	Gordonia_phage	46.3	1.5e-14
WP_168584694.1|816783_819003_+	methylmalonyl-CoA mutase	NA	NA	NA	NA	NA
WP_168584695.1|819005_819992_+	methylmalonyl Co-A mutase-associated GTPase MeaB	NA	NA	NA	NA	NA
WP_168584696.1|820016_820373_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168584697.1|820628_820826_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.0	6.0e-08
WP_168584698.1|820889_821189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168584699.1|821185_823105_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168584700.1|823064_824156_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1ISS9	Mycobacterium_phage	29.6	1.4e-10
WP_168589774.1|824240_824960_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_168584701.1|824935_825223_-|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	44.4	3.1e-13
831279:831298	attR	CCAGCGCACCGAGCTGGTCG	NA	NA	NA	NA
>prophage 2
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	1409350	1475257	8045912	transposase,tRNA,protease	Trichoplusia_ni_ascovirus(25.0%)	50	NA	NA
WP_168589851.1|1409350_1411012_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_168585139.1|1411224_1412010_+	DUF3105 domain-containing protein	NA	NA	NA	NA	NA
WP_168585140.1|1412013_1412685_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_168585141.1|1412724_1413642_-	cation transporter	NA	NA	NA	NA	NA
WP_168585142.1|1414424_1415147_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.3	1.2e-08
WP_168585143.1|1415201_1415759_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168585144.1|1415991_1416744_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168585145.1|1418433_1418985_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_168585146.1|1421562_1421901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168585147.1|1422143_1425098_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_168585148.1|1425149_1425590_+	roadblock/LC7 domain-containing protein	NA	NA	NA	NA	NA
WP_168585149.1|1425597_1426197_+	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_168585150.1|1426274_1426880_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_168585151.1|1426936_1427584_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.6	4.7e-09
WP_168585152.1|1427690_1429052_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_168585153.1|1429074_1429569_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_168585154.1|1429850_1430891_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168585154.1|1431439_1432480_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168585155.1|1432571_1432961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168585156.1|1436425_1436653_+	DUF3311 domain-containing protein	NA	NA	NA	NA	NA
WP_168585157.1|1436649_1438128_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_168585158.1|1438192_1439137_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_168589852.1|1439199_1439634_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_168585159.1|1439803_1441162_-	beta-lactamase family protein	NA	A0A2P1CHE9	Mycobacterium_phage	27.2	1.1e-15
WP_168585160.1|1441278_1442235_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_168589853.1|1442580_1444671_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_168585161.1|1444962_1445343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168585162.1|1445335_1445755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168589854.1|1446093_1447236_-	MFS transporter	NA	NA	NA	NA	NA
WP_168585163.1|1449209_1449941_-	cell wall anchor protein	NA	NA	NA	NA	NA
WP_168585164.1|1451756_1452590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168585165.1|1452824_1453103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168585166.1|1453585_1455802_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_168585167.1|1455816_1457031_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_168585168.1|1457122_1458445_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_168589855.1|1458444_1459662_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_168585169.1|1459700_1461185_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_168585170.1|1461633_1461960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168585171.1|1461956_1463126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168585172.1|1463148_1463913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168585173.1|1463936_1464452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168585174.1|1464762_1465155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168585175.1|1465138_1465624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168585176.1|1465630_1466794_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_168585177.1|1466836_1468015_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_168585178.1|1468235_1469369_-	CoA transferase	NA	NA	NA	NA	NA
WP_168585179.1|1470488_1471205_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168585180.1|1471322_1472645_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	24.0	3.1e-31
WP_168585181.1|1473245_1474562_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_168585182.1|1474759_1475257_+|protease	protease inhibitor	protease	NA	NA	NA	NA
>prophage 3
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	3333884	3376153	8045912	transposase,integrase	Mycobacterium_phage(22.22%)	47	3336309:3336324	3375757:3375772
WP_168586541.1|3333884_3334286_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	50.4	4.2e-32
WP_168586542.1|3334282_3335290_+|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	38.6	5.9e-43
WP_168586543.1|3335671_3335959_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168586544.1|3336257_3336497_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
3336309:3336324	attL	CACCACCTCGACCGGG	NA	NA	NA	NA
WP_168586545.1|3336514_3337351_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_168586546.1|3337347_3338322_-	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	30.5	8.6e-15
WP_168586547.1|3338910_3339411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168586548.1|3339731_3341201_-	peptidase S10	NA	NA	NA	NA	NA
WP_168590093.1|3341325_3342045_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_168590094.1|3342063_3342261_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_168586549.1|3342257_3342635_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	52.5	3.0e-16
WP_168586550.1|3343366_3343957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586551.1|3344206_3344392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586552.1|3344388_3344700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586553.1|3344717_3345404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586554.1|3345498_3346473_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168586555.1|3346605_3346941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586556.1|3347218_3347551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586557.1|3347811_3348366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586558.1|3348530_3348878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168586559.1|3349042_3349552_-	hypothetical protein	NA	G3MA75	Bacillus_virus	37.7	2.2e-17
WP_168586560.1|3349548_3350001_-	HIT domain-containing protein	NA	S5VWB9	Mycobacterium_phage	51.8	9.2e-20
WP_168586561.1|3350215_3350632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586562.1|3350628_3350844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168584100.1|3351311_3351734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586563.1|3352151_3353474_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168590095.1|3353870_3354926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168590096.1|3355384_3355978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586564.1|3356292_3357105_+	ESX secretion-associated protein EspG	NA	NA	NA	NA	NA
WP_168590097.1|3357238_3357592_+	PE domain-containing protein	NA	NA	NA	NA	NA
WP_168586565.1|3357588_3358161_+	DUF3558 domain-containing protein	NA	NA	NA	NA	NA
WP_168586566.1|3358173_3359400_+	PPE domain-containing protein	NA	NA	NA	NA	NA
WP_168586567.1|3359441_3359750_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_168586568.1|3359752_3360046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168586569.1|3360049_3360358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168586570.1|3360379_3361045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168586571.1|3361041_3361641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168586572.1|3361672_3361906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586573.1|3362034_3362265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586574.1|3362264_3362507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586575.1|3362859_3363714_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168586576.1|3363737_3363935_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_168586577.1|3364151_3368921_+	DEAD/DEAH box helicase	NA	A0A2H4UVA3	Bodo_saltans_virus	24.1	8.2e-34
WP_168586578.1|3369466_3369979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168586579.1|3369975_3371259_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	73.9	3.9e-180
WP_168590098.1|3372003_3373683_+	maturase	NA	A0A0U4J920	Pseudomonas_phage	27.2	1.1e-20
WP_168586580.1|3374509_3376153_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
3375757:3375772	attR	CACCACCTCGACCGGG	NA	NA	NA	NA
>prophage 4
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	3912832	3977814	8045912	transposase,tRNA,protease	Saccharomonospora_phage(21.43%)	56	NA	NA
WP_168586968.1|3912832_3913459_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	50.6	5.0e-40
WP_168586969.1|3913497_3914130_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	38.9	2.1e-30
WP_168586970.1|3914340_3914517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586971.1|3914618_3915899_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.4	7.9e-141
WP_168586972.1|3916157_3916796_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_168586973.1|3916801_3917677_-	esterase family protein	NA	NA	NA	NA	NA
WP_168586974.1|3917750_3918587_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_168586975.1|3918692_3920030_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_168586976.1|3920575_3921184_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_168586977.1|3921415_3923713_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_168586978.1|3923840_3926546_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	38.8	5.2e-142
WP_168586979.1|3926886_3928254_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_168590170.1|3928316_3928733_+	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_168586980.1|3928793_3929648_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168586981.1|3929759_3930665_+	DMT family transporter	NA	NA	NA	NA	NA
WP_168586982.1|3930688_3931789_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_168586983.1|3931972_3933511_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_168586984.1|3933571_3933802_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168590171.1|3933851_3934220_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_168586985.1|3934325_3934736_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	50.0	6.8e-30
WP_168586986.1|3934988_3936953_+	TIGR03960 family B12-binding radical SAM protein	NA	NA	NA	NA	NA
WP_168586987.1|3937243_3938038_+	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
WP_168586988.1|3938205_3941055_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_168586989.1|3941119_3942028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168586990.1|3942079_3942688_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168586991.1|3944502_3945249_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168585152.1|3945669_3947031_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_168586992.1|3947571_3947784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590172.1|3947783_3947990_-	hypothetical protein	NA	A0A2P1JSH5	Gordonia_phage	50.0	1.6e-08
WP_168586993.1|3948021_3948165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168586994.1|3948456_3948906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590173.1|3949418_3952616_-	arabinosyltransferase	NA	NA	NA	NA	NA
WP_168586995.1|3952791_3953778_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_168586996.1|3953774_3955475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010695780.1|3955894_3956203_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_010695777.1|3956217_3956475_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_168590174.1|3956689_3958180_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_168586997.1|3958176_3959298_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.4	3.5e-52
WP_168586998.1|3959443_3960718_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.9	6.6e-47
WP_168586999.1|3960838_3961078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587000.1|3961303_3961801_+	helix-turn-helix domain-containing protein	NA	I4AZQ1	Saccharomonospora_phage	42.1	4.7e-17
WP_168587001.1|3962449_3964570_-	ATP-dependent DNA helicase RecQ	NA	Q9DSV4	Diadromus_pulchellus_ascovirus	33.0	9.0e-41
WP_168587002.1|3964690_3966010_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.9	1.1e-102
WP_168587003.1|3966398_3966620_+	ferredoxin	NA	NA	NA	NA	NA
WP_168587004.1|3966955_3967576_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_168587005.1|3967918_3968317_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_168587006.1|3968313_3968934_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_168587007.1|3968968_3969829_+	DegV family protein	NA	NA	NA	NA	NA
WP_168590175.1|3970156_3970738_+	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_168590176.1|3970758_3973086_+	DUF4131 domain-containing protein	NA	Q0H255	Geobacillus_phage	29.6	7.8e-22
WP_168590177.1|3973606_3973813_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_168587008.1|3973889_3974279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587009.1|3974367_3975111_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168587010.1|3975710_3976046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587011.1|3976193_3976592_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	89.2	3.1e-64
WP_168584596.1|3976596_3977814_+|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	84.9	1.3e-196
>prophage 5
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	3982351	4001941	8045912	transposase	Saccharomonospora_phage(60.0%)	22	NA	NA
WP_168587011.1|3982351_3982750_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	89.2	3.1e-64
WP_168584596.1|3982754_3983972_+|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	84.9	1.3e-196
WP_168587015.1|3983952_3984630_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_168587016.1|3984819_3985149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168584373.1|3985165_3986056_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_168587017.1|3987571_3987958_+	VOC family protein	NA	NA	NA	NA	NA
WP_168587018.1|3987995_3988277_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_168587019.1|3988415_3989000_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168587020.1|3989130_3990981_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	39.8	1.8e-21
WP_168587021.1|3991116_3991362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587022.1|3992303_3993128_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_168590178.1|3993257_3993626_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168587023.1|3993552_3993864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168584106.1|3993876_3994296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590080.1|3994839_3996336_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	38.9	5.9e-71
WP_168587024.1|3996479_3996731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168584374.1|3996787_3997552_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168590179.1|3998834_3999665_+	helix-turn-helix transcriptional regulator	NA	I4AZQ1	Saccharomonospora_phage	40.2	6.8e-45
WP_168587025.1|3999633_3999810_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_168587026.1|4000067_4000229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587027.1|4000264_4000597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587028.1|4001032_4001941_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	4818181	4888308	8045912	transposase	Mycobacterium_phage(100.0%)	58	NA	NA
WP_168585154.1|4818181_4819222_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168587607.1|4819345_4819762_+	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_168587608.1|4820048_4820528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168584118.1|4821035_4821392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587609.1|4821538_4821847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590289.1|4822344_4822560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587610.1|4823281_4824310_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_168587611.1|4824394_4824736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587612.1|4824868_4825453_-	adenylate cyclase	NA	NA	NA	NA	NA
WP_168587613.1|4825647_4825908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587614.1|4826071_4826440_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168587615.1|4826666_4826984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587616.1|4827752_4828070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587617.1|4828066_4828600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587618.1|4829000_4830167_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_168587619.1|4830171_4831068_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_168587620.1|4831269_4831950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587621.1|4831946_4832507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587622.1|4832503_4832974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587623.1|4832970_4833222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168584119.1|4833807_4834047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587624.1|4834839_4835277_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_168590290.1|4835591_4836476_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168587625.1|4836475_4836694_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_168587626.1|4836738_4837731_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_168587627.1|4837740_4838730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587628.1|4838737_4840012_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_168587629.1|4840008_4841157_-	glycine amidinotransferase	NA	NA	NA	NA	NA
WP_168587630.1|4841207_4842194_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	NA	NA	NA	NA
WP_168587631.1|4842247_4843630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587632.1|4843693_4844731_-	cytochrome P450	NA	NA	NA	NA	NA
WP_168587633.1|4846203_4848984_-	RNAseH domain-containing protein	NA	NA	NA	NA	NA
WP_168587634.1|4849012_4852444_-	signal recognition particle	NA	NA	NA	NA	NA
WP_168587635.1|4852436_4853630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587636.1|4853571_4855230_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_168587637.1|4855448_4855826_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_168587638.1|4856016_4859091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587639.1|4859087_4859576_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_168587640.1|4859833_4862755_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_168587641.1|4862751_4863897_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_168587642.1|4863887_4865183_-	DUF2399 domain-containing protein	NA	NA	NA	NA	NA
WP_168587643.1|4865179_4868029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587644.1|4868298_4868961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587645.1|4868957_4869497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587646.1|4869489_4870725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590080.1|4871174_4872671_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	38.9	5.9e-71
WP_168587647.1|4873912_4876366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590291.1|4876709_4876937_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168590292.1|4878215_4879154_-	cyclase family protein	NA	NA	NA	NA	NA
WP_168587648.1|4879385_4879559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587649.1|4880935_4881259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168590293.1|4882233_4882698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587650.1|4883368_4884370_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168587651.1|4884544_4884862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168590294.1|4885182_4885500_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_168587652.1|4885656_4885983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587653.1|4886072_4887599_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_168587654.1|4888011_4888308_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	4912950	5038178	8045912	transposase,integrase	Staphylococcus_phage(50.0%)	94	4903982:4903999	5021742:5021758
4903982:4903999	attL	GCGGTGGCGGTCGGAGCC	NA	NA	NA	NA
WP_168587669.1|4912950_4913181_+|transposase	transposase	transposase	NA	NA	NA	NA
4903982:4903999	attL	GCGGTGGCGGTCGGAGCC	NA	NA	NA	NA
WP_168587670.1|4913183_4914191_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168587671.1|4914268_4915771_-	formate hydrogenase	NA	NA	NA	NA	NA
WP_168587672.1|4915770_4917249_-	hydrogenase	NA	NA	NA	NA	NA
WP_168587673.1|4917248_4917911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587674.1|4917926_4918874_-	formate hydrogenlyase	NA	NA	NA	NA	NA
WP_168587675.1|4918870_4920886_-	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
WP_168590298.1|4920882_4921365_-	NADH-quinone oxidoreductase subunit B family protein	NA	NA	NA	NA	NA
WP_168587676.1|4921468_4921846_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168587677.1|4922040_4922211_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_168587678.1|4924477_4924804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587679.1|4925318_4926407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587680.1|4927338_4927665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587681.1|4927925_4928147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168590299.1|4928237_4929440_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_168587682.1|4929523_4930402_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168587683.1|4931436_4932663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587684.1|4933043_4934051_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_168587685.1|4934043_4936512_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.7	2.8e-25
WP_168587686.1|4936569_4937721_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168587687.1|4937723_4939277_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	1.5e-08
WP_168587688.1|4939273_4940323_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_168587689.1|4942241_4943036_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168587690.1|4943543_4944896_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.6	4.1e-47
WP_168587691.1|4945054_4945672_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168587692.1|4945824_4946736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587693.1|4946732_4947554_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168587694.1|4947550_4949200_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_168590300.1|4949205_4950423_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_168587695.1|4950419_4951193_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168587696.1|4951265_4952450_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_168587697.1|4952442_4953408_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_168587698.1|4953407_4953908_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_168587699.1|4953992_4954880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587700.1|4954935_4955688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587701.1|4955684_4956596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587702.1|4956861_4957659_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168590301.1|4957825_4959133_+	MFS transporter	NA	NA	NA	NA	NA
WP_168587703.1|4959129_4959507_+	hypothetical protein	NA	NA	NA	NA	NA
4959342:4959359	attR	GCGGTGGCGGTCGGAGCC	NA	NA	NA	NA
WP_168587704.1|4959873_4960383_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
4959342:4959359	attR	GCGGTGGCGGTCGGAGCC	NA	NA	NA	NA
WP_168587705.1|4960620_4961055_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168584120.1|4961038_4969759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587706.1|4971044_4971500_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168587707.1|4972761_4974129_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168587708.1|4974154_4975624_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168587709.1|4975710_4977561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168590302.1|4978508_4979720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587710.1|4979729_4980179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168590303.1|4981381_4981804_+	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_168587711.1|4983854_4984406_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_168587712.1|4984402_4985107_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_168587713.1|4985198_4986185_+	DUF1996 domain-containing protein	NA	NA	NA	NA	NA
WP_168587714.1|4986266_4987187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587715.1|4988131_4988521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587716.1|4988517_4989561_+	AAA family ATPase	NA	A0A059VHA6	Mycobacterium_phage	35.3	2.6e-33
WP_168590304.1|4990101_4992360_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168587717.1|4993489_4994521_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168587718.1|4994581_4996099_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.9	5.8e-18
WP_168587719.1|4996251_4996914_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168587720.1|4997371_4998223_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_168587721.1|4998405_4999431_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_168587722.1|4999427_5000825_+	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_168587723.1|5000817_5001699_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_168587724.1|5001718_5003407_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	26.1	1.7e-29
WP_168587725.1|5003429_5003906_+	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	34.8	7.7e-17
WP_168587726.1|5003902_5006272_+	xanthine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_168587727.1|5006268_5006931_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_168587728.1|5006927_5007509_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_168590305.1|5007821_5008187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587729.1|5008376_5009057_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168587730.1|5009047_5009326_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168590306.1|5009945_5012252_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168587731.1|5012333_5012570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587732.1|5013754_5014765_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_168587733.1|5014769_5016326_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168587734.1|5016322_5017060_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168587735.1|5017056_5017380_-	lycopene cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_168587736.1|5017376_5017712_-	lycopene cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_168587737.1|5017711_5018683_-	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_168587738.1|5018679_5020197_-	phytoene desaturase	NA	NA	NA	NA	NA
WP_168587739.1|5020711_5021881_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_168590307.1|5023042_5024107_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_168587740.1|5025432_5026161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587741.1|5026210_5027302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587742.1|5028085_5028508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587743.1|5028753_5029035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587744.1|5029084_5029960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587745.1|5030152_5031355_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168587746.1|5031513_5032491_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_168587747.1|5032504_5034046_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	4.1e-27
WP_168587748.1|5034042_5034894_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_168587749.1|5034929_5036474_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.7	1.5e-69
WP_168587750.1|5036521_5037286_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168587751.1|5037881_5038178_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.6	2.0e-07
>prophage 8
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	5128486	5199499	8045912	transposase,integrase,bacteriocin	Bacillus_phage(16.67%)	58	5151716:5151732	5203656:5203672
WP_168590312.1|5128486_5128660_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168590313.1|5129011_5129425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587776.1|5129490_5131080_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168590314.1|5131216_5132722_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_168587777.1|5132734_5134096_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	22.3	7.8e-14
WP_168587778.1|5134440_5134791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587779.1|5134860_5136171_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	5.6e-33
WP_168587780.1|5136206_5136902_-	VOC family protein	NA	NA	NA	NA	NA
WP_168587781.1|5137158_5138256_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_168587782.1|5138252_5139224_-	amidohydrolase	NA	NA	NA	NA	NA
WP_168587783.1|5139220_5139661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587784.1|5139702_5140893_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_168590315.1|5140892_5142194_-	MFS transporter	NA	NA	NA	NA	NA
WP_168590316.1|5142318_5143746_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_168590317.1|5143935_5145696_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_168587785.1|5148749_5148938_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168584121.1|5148919_5149177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168590318.1|5149188_5149518_+	hypothetical protein	NA	S5VXX4	Leptospira_phage	38.0	4.1e-09
WP_168587786.1|5149654_5149783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587787.1|5149779_5149959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587788.1|5150003_5150285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587789.1|5150741_5152454_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.6	1.2e-22
5151716:5151732	attL	CGAACTCGAAGACGACC	NA	NA	NA	NA
WP_168587790.1|5152450_5154208_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.1	2.1e-27
WP_168587791.1|5154204_5160672_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.3	1.8e-47
WP_168587792.1|5160668_5160860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587793.1|5160870_5162115_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	27.4	7.9e-13
WP_168587794.1|5162383_5163460_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168587795.1|5163461_5164613_+	N-methyl-L-tryptophan oxidase	NA	NA	NA	NA	NA
WP_168587796.1|5164621_5166226_-	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_168587797.1|5166425_5171873_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	27.6	4.4e-39
WP_168590319.1|5171890_5172979_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_168587798.1|5175124_5176324_+	cytochrome P450	NA	NA	NA	NA	NA
WP_168587799.1|5176329_5177112_+	thioesterase	NA	NA	NA	NA	NA
WP_168590320.1|5177129_5177861_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168587800.1|5177857_5179375_+	MFS transporter	NA	NA	NA	NA	NA
WP_168587801.1|5180029_5181532_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	3.3e-13
WP_168587802.1|5181528_5182332_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_168590321.1|5182494_5182863_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	51.3	3.2e-31
WP_168587803.1|5182859_5183318_+|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	37.3	9.4e-12
WP_168587804.1|5183362_5184313_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_168587805.1|5184309_5185860_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168587806.1|5185893_5186100_-	ferredoxin	NA	NA	NA	NA	NA
WP_168587807.1|5186486_5187035_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_168587808.1|5187047_5188409_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168587809.1|5188799_5189006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587810.1|5189002_5189191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587811.1|5189187_5189700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587812.1|5189696_5190023_+	RNA polymerase-binding protein RbpA	NA	NA	NA	NA	NA
WP_168587813.1|5190082_5190298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587814.1|5190297_5190972_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_168587815.1|5191007_5191616_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168587816.1|5191794_5191980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587817.1|5192539_5192833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168587818.1|5193282_5193891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587819.1|5194871_5195648_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	NA	NA	NA	NA
WP_168590322.1|5195665_5196337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590323.1|5196377_5197505_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A220NQQ9	Corynebacterium_phage	25.6	1.9e-05
WP_168587820.1|5197780_5199499_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
5203656:5203672	attR	CGAACTCGAAGACGACC	NA	NA	NA	NA
>prophage 9
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	5912151	5925979	8045912	transposase,integrase	Enterobacteria_phage(33.33%)	13	5909399:5909414	5935584:5935599
5909399:5909414	attL	CTGGACGACGACGGTG	NA	NA	NA	NA
WP_168584374.1|5912151_5912916_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168588246.1|5912975_5913173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588247.1|5913206_5913683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588248.1|5914257_5914596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588249.1|5914827_5916624_+	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_168588250.1|5918889_5919294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588251.1|5919375_5919933_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_168584701.1|5921384_5921672_+|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	44.4	3.1e-13
WP_168590394.1|5921647_5922367_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_168584700.1|5922451_5923543_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1ISS9	Mycobacterium_phage	29.6	1.4e-10
WP_168588252.1|5923502_5925422_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168584698.1|5925418_5925718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168584697.1|5925781_5925979_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.0	6.0e-08
5935584:5935599	attR	CACCGTCGTCGTCCAG	NA	NA	NA	NA
>prophage 10
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	6088270	6178876	8045912	transposase,integrase	Mycobacterium_phage(23.08%)	66	6119453:6119473	6125480:6125500
WP_168590411.1|6088270_6089929_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_168588369.1|6090437_6091331_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_168588370.1|6091483_6092176_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_168585067.1|6092737_6093688_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_168590412.1|6093918_6094293_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_168588371.1|6094418_6095216_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	38.3	6.8e-42
WP_168588372.1|6095652_6096660_+	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_168588373.1|6097168_6097510_-	Lsr2 family protein	NA	A0A218M8U0	Mycobacterium_phage	44.9	4.4e-14
WP_168588374.1|6097824_6098199_+	Lsr2 family protein	NA	NA	NA	NA	NA
WP_168588375.1|6098346_6098736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168584132.1|6098891_6099305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590413.1|6101033_6101357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168588376.1|6101427_6102513_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168588377.1|6102858_6105159_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168590414.1|6105194_6106925_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_168588378.1|6107294_6108059_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168588379.1|6108360_6109887_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_168587652.1|6109976_6110303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590287.1|6110915_6112145_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.4	1.8e-33
WP_168588380.1|6112870_6113914_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_168590415.1|6114059_6115322_-	MFS transporter	NA	NA	NA	NA	NA
WP_168588381.1|6115569_6117186_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_168588382.1|6117182_6119261_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
6119453:6119473	attL	AGAGACTGTTGGGTAACTGGG	NA	NA	NA	NA
WP_168588383.1|6120342_6121704_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_168588384.1|6122899_6125230_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168588385.1|6125728_6127030_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
6125480:6125500	attR	CCCAGTTACCCAACAGTCTCT	NA	NA	NA	NA
WP_168588386.1|6127153_6128371_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168588387.1|6128816_6130202_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_168588388.1|6130248_6130998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588389.1|6131267_6132215_-	hypothetical protein	NA	A0A2P1N0G0	Streptomyces_phage	39.6	3.0e-12
WP_168588390.1|6132261_6132459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588391.1|6132445_6132910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588392.1|6132906_6133467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588393.1|6134097_6134481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588394.1|6135112_6135742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588395.1|6135886_6136471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588396.1|6136616_6137657_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	35.4	2.8e-56
WP_168588397.1|6137693_6137921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588398.1|6138089_6138632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588399.1|6138731_6139322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590416.1|6140117_6141038_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168590397.1|6144998_6145703_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.8	1.8e-22
WP_168589887.1|6145911_6147495_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_168588400.1|6148073_6148400_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168588401.1|6149532_6151158_+	GMC oxidoreductase	NA	A0A1V0S9J5	Catovirus	28.0	1.5e-48
WP_168590080.1|6151218_6152715_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	38.9	5.9e-71
WP_168590417.1|6153017_6153728_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.3	1.8e-06
WP_168588402.1|6153818_6155942_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_168590418.1|6156097_6157060_+	methyltransferase	NA	NA	NA	NA	NA
WP_168588403.1|6157097_6158210_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_168588404.1|6159016_6160174_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_168588405.1|6160170_6161058_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_168588406.1|6161198_6161456_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_168588407.1|6161430_6162891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588408.1|6162925_6164053_-	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	43.1	3.6e-73
WP_168588409.1|6164635_6165985_+	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_168588410.1|6166158_6167364_+	cytochrome P450	NA	NA	NA	NA	NA
WP_168588411.1|6167457_6168438_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_168588412.1|6168506_6169007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588413.1|6170132_6170528_+	methyltransferase domain-containing protein	NA	A0A1J0MC50	Streptomyces_phage	49.2	3.0e-22
WP_168588414.1|6170596_6171133_+	hypothetical protein	NA	A0A1J0MC50	Streptomyces_phage	36.6	4.0e-22
WP_168588415.1|6172573_6174109_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_168588416.1|6174230_6174791_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_168588417.1|6175091_6175709_+	iron-sulfur cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168585803.1|6175908_6177177_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_168590080.1|6177379_6178876_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	38.9	5.9e-71
>prophage 11
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	6189195	6262379	8045912	transposase,integrase	Acinetobacter_phage(12.5%)	57	6220529:6220548	6226682:6226701
WP_168588427.1|6189195_6190251_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168590420.1|6190247_6190442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588428.1|6191231_6192239_+	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_168588429.1|6192439_6193957_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	32.6	2.8e-36
WP_168588430.1|6193953_6195156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588431.1|6195190_6198631_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.5	1.1e-14
WP_168588432.1|6198949_6199486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588433.1|6199775_6199982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588434.1|6199978_6200455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588435.1|6202377_6202749_-	signal peptidase I	NA	NA	NA	NA	NA
WP_168590421.1|6202733_6204320_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_168588436.1|6204470_6204854_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_168588437.1|6205036_6205249_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168588438.1|6205248_6205599_+	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_168588439.1|6205595_6205928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168590422.1|6205960_6206659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588440.1|6206648_6208793_+	cell division protein FtsK	NA	NA	NA	NA	NA
WP_168588441.1|6208943_6210761_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	22.9	7.5e-12
WP_168588442.1|6211152_6211809_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168588443.1|6212625_6213390_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_168588444.1|6213397_6216934_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_168588445.1|6217167_6218178_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168588446.1|6218913_6219348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588447.1|6219349_6221551_-|integrase	integrase	integrase	NA	NA	NA	NA
6220529:6220548	attL	GTCGTTGTCGGCGATGCGGG	NA	NA	NA	NA
WP_168588448.1|6221547_6223635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590423.1|6223634_6225086_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168590424.1|6227535_6227934_-	hypothetical protein	NA	NA	NA	NA	NA
6226682:6226701	attR	GTCGTTGTCGGCGATGCGGG	NA	NA	NA	NA
WP_168590425.1|6229091_6229967_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_168590426.1|6230065_6230383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168590427.1|6230665_6231379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588449.1|6231406_6232462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168590428.1|6232491_6234540_-	recombinase family protein	NA	NA	NA	NA	NA
WP_168588450.1|6234691_6234943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588451.1|6234945_6236058_+	PrgI family protein	NA	NA	NA	NA	NA
WP_168588452.1|6236054_6237944_+	DUF87 domain-containing protein	NA	G3MBM1	Bacillus_virus	25.5	5.4e-21
WP_168588453.1|6237993_6240483_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_168588454.1|6240570_6241602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588455.1|6241629_6242565_+	M23 family metallopeptidase	NA	A0A2L1IVP0	Streptomyces_phage	44.5	1.1e-48
WP_168588456.1|6242782_6243541_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168588457.1|6245778_6246216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588458.1|6246411_6246765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588459.1|6246881_6248639_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_168590429.1|6248679_6249897_-	AAA domain-containing protein	NA	A0A0K0N7E9	Gordonia_phage	41.0	2.6e-45
WP_168588460.1|6250596_6250938_-	Lsr2 family protein	NA	Q854K3	Mycobacterium_phage	44.3	4.4e-14
WP_168590430.1|6251253_6251634_+	Lsr2 family protein	NA	NA	NA	NA	NA
WP_168588461.1|6251778_6252168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588462.1|6252391_6255337_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A076YP46	Citrobacter_phage	47.2	1.0e-05
WP_168588463.1|6255333_6255753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588464.1|6255749_6256184_-	pilus assembly protein TadE	NA	NA	NA	NA	NA
WP_168588465.1|6256180_6256600_-	pilus assembly protein TadE	NA	NA	NA	NA	NA
WP_168588466.1|6256618_6256852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588467.1|6256900_6257794_-	pilus assembly protein TadB	NA	NA	NA	NA	NA
WP_168588468.1|6257790_6258639_-	pilus assembly protein TadB	NA	NA	NA	NA	NA
WP_168588469.1|6258635_6260021_-	CpaF family protein	NA	NA	NA	NA	NA
WP_168588470.1|6260017_6260830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588471.1|6260865_6261462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588472.1|6261614_6262379_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	6283541	6320898	8045912	transposase	Pneumococcus_phage(33.33%)	45	NA	NA
WP_168588472.1|6283541_6284306_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168588493.1|6285530_6285866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588494.1|6286685_6286880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588495.1|6287010_6288222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588496.1|6288202_6288907_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	39.7	4.5e-29
WP_168588497.1|6288903_6289323_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_168588498.1|6289319_6290075_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2P1JXY9	Rhodococcus_phage	43.5	1.0e-47
WP_168588499.1|6290011_6290578_+	purine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_168588500.1|6290561_6291389_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168590433.1|6291370_6292108_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_168588501.1|6292097_6293135_+	radical SAM protein	NA	NA	NA	NA	NA
WP_168588502.1|6293131_6294244_+	aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.6	1.1e-16
WP_168588503.1|6294231_6295104_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_168588504.1|6295100_6295916_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_168588505.1|6295944_6296907_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_168588506.1|6297021_6297696_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_168590434.1|6297755_6298388_+	DsbA family protein	NA	NA	NA	NA	NA
WP_168588507.1|6298539_6299100_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_168588508.1|6299335_6299629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588509.1|6300192_6300378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588510.1|6300551_6301175_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168588511.1|6301311_6301671_-	RNA polymerase-binding protein RbpA	NA	NA	NA	NA	NA
WP_168588512.1|6301667_6302180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588513.1|6302304_6302514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588514.1|6302622_6303036_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_168588515.1|6303322_6304681_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168588516.1|6304819_6305335_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168588517.1|6305432_6305621_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168588518.1|6305984_6306623_-	mycofactocin system transcriptional regulator	NA	NA	NA	NA	NA
WP_168588519.1|6306701_6306809_+	mycofactocin precursor	NA	NA	NA	NA	NA
WP_168588520.1|6306808_6307081_+	mycofactocin biosynthesis chaperone MftB	NA	NA	NA	NA	NA
WP_168588521.1|6307110_6308304_+	mycofactocin radical SAM maturase	NA	NA	NA	NA	NA
WP_168588522.1|6308330_6309506_+	mycofactocin biosynthesis FMN-dependent deaminase MftD	NA	NA	NA	NA	NA
WP_168590435.1|6309528_6310299_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_168588523.1|6310372_6310645_+	creatininase family protein	NA	NA	NA	NA	NA
WP_168588524.1|6310691_6311933_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_168588525.1|6312177_6312618_+	creatininase family protein	NA	NA	NA	NA	NA
WP_168590436.1|6313695_6313932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588526.1|6313957_6314161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590437.1|6314233_6314575_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_168588527.1|6314706_6316245_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_168588528.1|6316310_6316790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588529.1|6317087_6317522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588530.1|6317707_6320023_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_168588531.1|6320658_6320898_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	6447943	6463507	8045912	transposase,integrase	Leptospira_phage(33.33%)	17	6449397:6449413	6467697:6467713
WP_168588639.1|6447943_6448798_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	39.6	2.3e-51
WP_168588640.1|6449301_6449577_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
6449397:6449413	attL	CATCCTCATCGGCATCG	NA	NA	NA	NA
WP_168588641.1|6450088_6450319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588642.1|6450959_6451478_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_168588643.1|6451410_6452007_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_168590352.1|6452356_6453586_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	34.9	4.0e-33
WP_168590453.1|6454394_6454916_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_168588644.1|6454912_6455545_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_168588645.1|6455754_6456255_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_168588646.1|6456251_6456590_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_168588647.1|6456592_6456781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588648.1|6456777_6457254_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_168588649.1|6457250_6457796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588650.1|6457795_6458368_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_168590454.1|6458720_6458918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588651.1|6459839_6461021_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0C5AN64	Paenibacillus_phage	24.2	9.8e-05
WP_168590455.1|6462397_6463507_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
6467697:6467713	attR	CGATGCCGATGAGGATG	NA	NA	NA	NA
>prophage 14
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	6601952	6627153	8045912	transposase,integrase	Paenibacillus_phage(50.0%)	21	6607919:6607936	6630299:6630316
WP_168590470.1|6601952_6604883_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_168588764.1|6604928_6605339_-	RidA family protein	NA	NA	NA	NA	NA
WP_168588765.1|6606838_6607261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588766.1|6607257_6609177_-|integrase	integrase	integrase	NA	NA	NA	NA
6607919:6607936	attL	GCGATGGCCTCGCCGAGC	NA	NA	NA	NA
WP_168587152.1|6609596_6610166_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168588767.1|6610203_6610392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588768.1|6610905_6613197_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168590471.1|6613241_6614417_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	24.0	1.5e-08
WP_168588769.1|6614571_6614709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588770.1|6614856_6615297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588771.1|6615293_6616388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588772.1|6616403_6616823_+	recombinase family protein	NA	NA	NA	NA	NA
WP_168588773.1|6616819_6617137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132485213.1|6617336_6618620_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_168588774.1|6618866_6619226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588775.1|6619284_6622404_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	40.3	5.9e-198
WP_168590472.1|6622691_6623225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168588776.1|6623458_6624034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590473.1|6624445_6624874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168588777.1|6625159_6625747_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_168588778.1|6626109_6627153_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
6630299:6630316	attR	GCTCGGCGAGGCCATCGC	NA	NA	NA	NA
>prophage 15
NZ_CP040605	Saccharopolyspora sp. ASAGF58 chromosome, complete genome	8045912	7085208	7224327	8045912	transposase,integrase,tRNA	Enterobacteria_phage(18.18%)	104	7184352:7184372	7223632:7223652
WP_168589097.1|7085208_7085787_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168589098.1|7086570_7087530_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_168589099.1|7087771_7088452_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168589100.1|7088771_7089605_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_168589101.1|7089900_7090467_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168590540.1|7090479_7090908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168589102.1|7091208_7095180_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	36.9	7.8e-30
WP_168589103.1|7095198_7095855_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_168589104.1|7095998_7096418_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	53.3	5.3e-38
WP_168589105.1|7097077_7097476_-	gas vesicle structural protein GvpA	NA	NA	NA	NA	NA
WP_168589106.1|7097609_7098134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168589107.1|7099829_7100204_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168589108.1|7100906_7101779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590541.1|7101969_7102923_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168589109.1|7103003_7103516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168589110.1|7103499_7104879_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_168589111.1|7104890_7105811_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_168589112.1|7105819_7105984_+	DUF2437 domain-containing protein	NA	NA	NA	NA	NA
WP_168589113.1|7106084_7106573_+	MFS transporter	NA	NA	NA	NA	NA
WP_168589114.1|7106715_7107375_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168589115.1|7107371_7109057_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_168589116.1|7109053_7111150_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_168589117.1|7111388_7111676_+|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	44.4	1.4e-13
WP_168589118.1|7111693_7112005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168589119.1|7112001_7112391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168589120.1|7112507_7112732_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168589121.1|7114488_7115814_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.8	8.9e-55
WP_168589122.1|7115936_7117550_-	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	35.1	8.3e-71
WP_168589123.1|7117584_7118388_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_168589124.1|7118561_7119479_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168589125.1|7123268_7123415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168589126.1|7123944_7124277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590542.1|7124625_7125087_+	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_168589127.1|7127108_7129607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168589128.1|7130192_7131293_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_168589129.1|7132841_7133672_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_168589130.1|7135158_7137498_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168589131.1|7137761_7139288_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_168589132.1|7139377_7139704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168587152.1|7141472_7142042_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168589133.1|7142079_7142232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168589134.1|7142306_7142594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168589135.1|7142756_7142945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168589136.1|7143962_7144190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590543.1|7144197_7144650_-	UDP-N-acetyl glucosamine 2-epimerase	NA	NA	NA	NA	NA
WP_168589137.1|7144701_7145121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168589138.1|7145143_7146442_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168589139.1|7146657_7147587_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_168588383.1|7147641_7149003_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_168589140.1|7149009_7149531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168589141.1|7149618_7150365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168589142.1|7151056_7151845_+	DUF1698 domain-containing protein	NA	NA	NA	NA	NA
WP_168589143.1|7153752_7154019_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_168589144.1|7153922_7154318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168589145.1|7155047_7155839_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_168589146.1|7155835_7156933_-	DUF917 domain-containing protein	NA	NA	NA	NA	NA
WP_168589147.1|7156935_7158498_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_168589148.1|7158548_7159904_-	cytosine permease	NA	NA	NA	NA	NA
WP_168589149.1|7160032_7161112_+	DUF917 domain-containing protein	NA	NA	NA	NA	NA
WP_168589150.1|7161108_7162656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168589151.1|7162772_7165322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168589152.1|7165450_7166749_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_168589153.1|7166745_7167240_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_168589154.1|7167245_7168742_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_168589155.1|7168789_7169785_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_168589156.1|7169781_7169973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168589157.1|7169959_7171387_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_168589158.1|7171373_7172792_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_168589159.1|7174739_7175033_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
WP_168590544.1|7175029_7176595_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168590545.1|7176603_7177593_-	dipeptidase	NA	NA	NA	NA	NA
WP_168590546.1|7177667_7179113_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_168589160.1|7179261_7180920_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	1.5e-19
WP_168589161.1|7180916_7181996_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.8	4.2e-18
WP_168589162.1|7182078_7183029_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_168590547.1|7183039_7183834_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_168589163.1|7183957_7184680_-	decarboxylase	NA	NA	NA	NA	NA
7184352:7184372	attL	ACCGCCGACTGCTGCATCGTG	NA	NA	NA	NA
WP_168589164.1|7185201_7186776_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168590548.1|7186983_7187679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168589165.1|7187590_7188457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168589166.1|7188507_7188831_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168589167.1|7190518_7191322_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168588765.1|7192019_7192442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590549.1|7192438_7192855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168589168.1|7194480_7195533_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_168589169.1|7196225_7196747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168590550.1|7196803_7197913_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_168588651.1|7199288_7200470_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0C5AN64	Paenibacillus_phage	24.2	9.8e-05
WP_168590551.1|7201165_7203355_+|integrase	phage integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	24.9	4.3e-06
WP_168589170.1|7204272_7205097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168589171.1|7205909_7207181_-	hydantoinase/carbamoylase family amidase	NA	NA	NA	NA	NA
WP_168589172.1|7207177_7208311_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_168589173.1|7208450_7208666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168589174.1|7208671_7210111_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_168589175.1|7210138_7211290_-	YgeY family selenium metabolism-linked hydrolase	NA	NA	NA	NA	NA
WP_168589176.1|7211291_7212869_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_168589177.1|7213724_7214450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168589178.1|7214737_7215526_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168589179.1|7215941_7216547_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_168589180.1|7216597_7217995_-	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_168589181.1|7218481_7219984_-	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_168589182.1|7220930_7222211_-	GNAT family N-acetyltransferase	NA	R4TQL5	Phaeocystis_globosa_virus	30.4	3.0e-15
WP_168589183.1|7222465_7223038_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_168590287.1|7223097_7224327_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.4	1.8e-33
7223632:7223652	attR	CACGATGCAGCAGTCGGCGGT	NA	NA	NA	NA
