The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	3076	50562	3275517	transposase,tRNA	Staphylococcus_phage(25.0%)	50	NA	NA
WP_016209326.1|3076_4456_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_036776466.1|4570_6463_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_036776463.1|6510_7137_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_016209314.1|7156_8041_+	ParA family protein	NA	Q8JL10	Natrialba_phage	27.7	1.7e-17
WP_016209349.1|8073_8967_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_016209313.1|9081_9480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209354.1|9484_10300_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|10351_10756_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|10810_11281_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_016209332.1|11292_11820_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_016209323.1|11836_13378_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209322.1|13403_14264_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|14294_15686_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_016209335.1|15710_16139_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_016209325.1|16232_17597_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.5	6.6e-37
WP_036776458.1|17652_19488_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.0	3.3e-124
WP_016209318.1|19610_20252_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075273393.1|20316_21024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274976.1|21168_21420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274975.1|21828_22011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183130.1|22215_23061_+	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	26.4	1.1e-10
WP_075273397.1|23648_24044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211851.1|24732_25389_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_075273625.1|25585_26338_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211852.1|26396_27110_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	1.7e-28
WP_129556614.1|27695_27848_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_122942409.1|27985_28417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211924.1|28776_28935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047255.1|29090_30062_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_157883632.1|29980_30226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212448.1|30744_31524_+	O-methyltransferase family protein	NA	NA	NA	NA	NA
WP_080743040.1|31570_32227_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|32285_33260_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_052104719.1|33772_35197_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211299.1|35424_36366_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_032126720.1|36385_38380_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211298.1|38376_38982_+	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_016211294.1|38983_39325_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211297.1|39325_40162_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211291.1|40158_40503_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155047005.1|40540_41390_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211791.1|42497_42761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211793.1|42786_44214_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211790.1|44210_44906_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_054300550.1|46210_46576_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|46632_46797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|46786_47086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007065.1|47298_48138_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_016212335.1|48154_48493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|49587_50562_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 2
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	71780	131063	3275517	transposase,protease	Bacillus_phage(14.29%)	54	NA	NA
WP_054300173.1|71780_72842_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|72891_73122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|73251_74466_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|74766_75828_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_036777695.1|75841_77569_+	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_016211245.1|77602_78334_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|78333_79122_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211251.1|79226_79850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|80169_80382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047032.1|80537_81599_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047033.1|81593_82190_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212241.1|82323_82680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212244.1|82765_83518_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126220.1|89193_89817_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016209608.1|89856_90339_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_016209606.1|90386_91532_+	lipoprotein	NA	NA	NA	NA	NA
WP_122940254.1|91548_93804_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_122940264.1|93784_94654_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.0e-67
WP_016209587.1|94660_95533_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.0	1.3e-91
WP_016209609.1|95529_96534_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	48.9	3.3e-78
WP_036776538.1|96553_96961_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	51.1	2.6e-29
WP_016209613.1|96988_98377_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_168183131.1|98406_99546_+	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_016209593.1|99577_100432_+	glycosyltransferase family 2 protein	NA	A0A167RG86	Powai_lake_megavirus	30.8	5.4e-05
WP_016209578.1|100431_101790_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_016209596.1|101789_102881_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016209602.1|102880_104137_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016209607.1|104137_105064_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.6	3.9e-57
WP_016209584.1|105161_106559_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.2	1.8e-50
WP_032126221.1|106833_108234_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_122940262.1|108327_109143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122940232.1|109373_110354_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209597.1|110407_110638_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_032126222.1|110645_111524_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.5	1.2e-39
WP_129556618.1|111889_112987_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.1	5.3e-21
WP_016209581.1|113052_113763_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556619.1|113845_115054_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_016209598.1|115120_115705_+	YggT family protein	NA	NA	NA	NA	NA
WP_032126223.1|115770_116430_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016209604.1|116433_117360_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_016209605.1|117356_118148_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_129556620.1|118228_119113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047034.1|119114_120302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|120278_121253_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209611.1|121501_121693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047035.1|121772_121952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209580.1|122043_122568_+	ankyrin repeat family protein	NA	NA	NA	NA	NA
WP_016209612.1|122951_123320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209595.1|123357_123630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300576.1|123720_125016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211692.1|125651_126554_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	1.6e-18
WP_051307362.1|126610_127462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211694.1|128041_130051_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	3.0e-110
WP_054300271.1|130088_131063_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 3
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	145446	191417	3275517	transposase	Bacillus_phage(50.0%)	54	NA	NA
WP_155047036.1|145446_146346_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047037.1|146490_146796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212564.1|147109_147259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212565.1|147226_147586_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|147607_147973_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|148029_148194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|148183_148483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126725.1|149515_150082_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|150093_150879_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|151510_152434_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|152485_153481_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|153512_154007_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_036778333.1|154098_154356_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|154445_154868_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|155186_155903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|155946_156198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778330.1|156202_157639_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|157666_159109_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|159196_159535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|159619_160150_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|160210_162403_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|162445_162931_-	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_016210226.1|163200_163632_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|163649_164480_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|164494_164638_-	lipoprotein	NA	NA	NA	NA	NA
WP_052104672.1|164668_165553_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|165524_165746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|165919_166198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|167168_168074_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_036780891.1|168130_169309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|169305_169881_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|169826_170192_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|170519_171299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|171832_172633_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_052104671.1|172851_173610_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|173686_173974_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|173977_174553_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|174498_174864_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047038.1|175081_175201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300540.1|175468_175693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047039.1|176708_177449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|177492_178467_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047040.1|178486_179158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|179450_180044_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|180012_180666_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|180843_181815_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|181837_182734_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|182892_183339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779493.1|183335_183977_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|184086_184665_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|185140_185578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|185902_187243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|187506_188901_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_155047041.1|190349_191417_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	402305	419902	3275517	transposase,tRNA	Acinetobacter_phage(50.0%)	14	NA	NA
WP_105962623.1|402305_403459_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126362.1|404097_404463_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|404408_404984_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300148.1|405010_406072_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046997.1|406646_409169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183134.1|410160_412617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212310.1|414390_414846_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_052104637.1|414875_415412_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212085.1|415467_415941_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_032126534.1|415982_416498_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212084.1|416497_417514_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_054300271.1|417795_418770_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007003.1|419142_419604_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|419563_419902_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	423077	468070	3275517	transposase,protease,tRNA	uncultured_Caudovirales_phage(25.0%)	48	NA	NA
WP_016210572.1|423077_424835_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126278.1|424956_425940_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_032126275.1|426020_426572_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126276.1|426582_427950_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126279.1|428100_428340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210582.1|428398_429142_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_016210581.1|429141_429786_+	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_036777781.1|429782_431447_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210576.1|431474_431810_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777784.1|431940_433539_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210577.1|433604_433895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|433909_434365_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|434324_434663_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556663.1|435001_435367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210376.1|435429_437910_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_016210384.1|437993_438473_+	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_129556597.1|438469_439486_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_032126282.1|439482_440139_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|440151_440487_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|440523_440994_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_036777788.1|441036_442872_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_032126285.1|442916_444005_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_054300183.1|444026_445088_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_016210373.1|445166_445682_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210380.1|445722_447000_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_036779767.1|447014_447866_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_032126283.1|447894_448542_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_016210379.1|448538_449498_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126284.1|449589_450300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212036.1|450744_451593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|451644_452556_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_129556595.1|454652_455069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034464.1|455213_455693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300185.1|455927_456290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275004.1|456533_457397_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212415.1|457521_458268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047235.1|458358_459345_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|459364_460339_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047234.1|460382_460526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556594.1|460991_461759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209990.1|461791_462196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209993.1|462252_462645_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|462774_463323_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_032126288.1|463349_464150_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016209977.1|464199_465885_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_016209997.1|465961_466423_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_033923658.1|466457_467021_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_155047246.1|467095_468070_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.8e-28
>prophage 6
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	491410	547618	3275517	transposase,tRNA	Powai_lake_megavirus(12.5%)	55	NA	NA
WP_016210756.1|491410_494224_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_032126291.1|494216_494726_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210766.1|494729_495173_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_036781330.1|495261_495855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|495899_496475_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|496420_496786_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211782.1|496847_497030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|497629_498907_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211783.1|499187_499553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211784.1|499544_500267_-	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_155047232.1|500820_501882_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300188.1|502127_503687_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	9.9e-37
WP_016210175.1|504000_504330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210177.1|504715_505081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126297.1|505205_506066_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|506052_506832_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_162034448.1|506907_507516_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556592.1|507751_508282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210179.1|508572_509076_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_016210161.1|509276_509531_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210178.1|510032_510500_+	DoxX family protein	NA	NA	NA	NA	NA
WP_016210163.1|510589_511120_-	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_032126296.1|511119_511647_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_036776947.1|511806_512922_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210174.1|513158_514319_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_016210183.1|514769_516773_+	transketolase	NA	NA	NA	NA	NA
WP_016210176.1|516841_517849_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210181.1|517922_519107_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_032126295.1|519116_520571_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210162.1|520601_521639_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_155046995.1|522323_523210_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300190.1|523336_524299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047231.1|524793_525327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047230.1|525327_525750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126299.1|526038_526260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211964.1|527552_527873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|527985_528636_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211963.1|528737_529397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212030.1|530470_530716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|530807_531470_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212032.1|531593_532721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|533308_533767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|533931_534138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126304.1|535183_535528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183135.1|536002_537949_+	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.0e-06
WP_016210981.1|537964_538603_-	ribonuclease T	NA	NA	NA	NA	NA
WP_016210987.1|538632_539832_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_098082804.1|540069_541167_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036778253.1|541279_542818_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_075273313.1|542875_543214_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047229.1|543173_543635_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_017377817.1|544844_545342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|545565_546222_+	porin family protein	NA	NA	NA	NA	NA
WP_032126306.1|546326_546623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183136.1|546847_547618_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	574216	669242	3275517	transposase,protease,integrase,tRNA	Escherichia_phage(17.39%)	84	616909:616968	653502:653791
WP_075273298.1|574216_574792_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046943.1|576561_576702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275117.1|576734_577157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211905.1|577400_577811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047041.1|578079_578343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082812.1|578575_579091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300492.1|579235_580246_-	protein kinase	NA	NA	NA	NA	NA
WP_016210676.1|580549_582631_-	kinase domain protein	NA	NA	NA	NA	NA
WP_016210671.1|583086_584346_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_036778297.1|584478_584952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778294.1|584960_586343_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_016210677.1|586335_586950_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_016210675.1|587029_587746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210679.1|587913_590238_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.0e-17
WP_054300491.1|590913_592674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126421.1|592877_593969_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210055.1|594236_594875_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016210070.1|594913_595186_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_032126423.1|595279_595543_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210060.1|595539_595842_-	YciI family protein	NA	NA	NA	NA	NA
WP_016210053.1|595925_596468_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|596629_597256_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_036778098.1|597261_598101_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	1.4e-08
WP_016210061.1|598090_598735_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.8e-19
WP_032126424.1|598747_599572_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_155047226.1|599844_600090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210065.1|600518_601178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210075.1|601431_602523_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_016210064.1|602519_603884_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_016210052.1|604008_605205_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_032126425.1|605225_605822_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210066.1|606265_606934_-|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_016210076.1|607075_608377_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210073.1|608633_609365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777829.1|610077_610482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778088.1|610722_611805_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_155047224.1|611789_612266_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|613837_614713_+	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210068.1|614788_615364_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_155047222.1|616283_616958_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.8	2.2e-09
616909:616968	attL	AACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTT	NA	NA	NA	NA
WP_155047221.1|617066_617546_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	42.0	1.7e-11
WP_155049822.1|617937_618093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|618563_619469_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_036780431.1|619512_621231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|621549_622629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046749.1|623173_623461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300489.1|623524_624127_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046946.1|624129_624405_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032126389.1|625806_625995_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212230.1|627528_628977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212679.1|630245_630626_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047267.1|631989_632199_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375841.1|632500_632710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|633016_633235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776735.1|633231_633684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212294.1|633697_634042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046947.1|634471_634639_+	phosphatase	NA	NA	NA	NA	NA
WP_016212659.1|634776_635022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|635166_635316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300484.1|635540_636488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780149.1|636984_637539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211322.1|638074_638665_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211325.1|638727_640248_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211323.1|640237_641335_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211722.1|643053_646356_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_036780093.1|646365_647187_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211722.1|648069_651372_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_036780093.1|651381_652203_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_075274944.1|652559_653276_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
WP_129556588.1|653220_653388_+	phosphatase	NA	NA	NA	NA	NA
WP_075274943.1|653578_654103_-	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
653502:653791	attR	AAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTGGATTAGCTGCTTAATTCTAAGCAGAGAGCACAATAAAATAACCTTTCTGAAGCTCACTATAATTTTTCGCAACAGTGCCTATTTTTGTTTGATCACCACGACTCACCTTCTTCTTATAAGGTTTTCCTGAATGAGGTAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTCTCACTCACCTGAATATTATGCTCACGTAT	NA	NA	NA	NA
WP_087910645.1|654388_655541_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_032127022.1|655603_657790_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_155047219.1|658466_659195_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155049821.1|659241_659430_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300482.1|660588_661878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007054.1|662393_663626_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_080664881.1|663788_663995_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300481.1|664084_664813_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155084950.1|664824_665769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|665818_666634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212641.1|667162_667609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047076.1|667804_668080_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047077.1|668088_669242_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	4.4e-58
>prophage 8
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	700206	735271	3275517	transposase,tRNA	Escherichia_phage(57.14%)	34	NA	NA
WP_054300202.1|700206_700935_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_036780855.1|701700_702198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212214.1|702172_702673_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054300477.1|702831_703560_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_144019359.1|703704_703902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300478.1|704063_705800_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300202.1|706079_706808_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211623.1|707622_709263_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_036779883.1|709375_710725_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211625.1|710721_711591_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_054300475.1|712074_712803_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016212196.1|713211_713457_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016212195.1|713453_713840_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212193.1|713907_714246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|714368_715097_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211949.1|715236_716487_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_016211951.1|716520_717618_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_054300202.1|718234_718963_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_075274932.1|719271_719493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|719714_721328_-	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_016211816.1|721369_721723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047083.1|722791_723520_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	4.3e-43
WP_016210945.1|725711_726302_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_016210946.1|726428_727814_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_036779396.1|727908_728106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126573.1|728199_729018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|729524_729902_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_036779393.1|729914_730151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210951.1|730150_730357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779389.1|730539_731259_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210954.1|731347_733132_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779399.1|733230_733485_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_144019244.1|733841_734453_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_054300202.1|734542_735271_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 9
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	781961	889139	3275517	transposase,tRNA	Acinetobacter_phage(21.05%)	101	NA	NA
WP_054300271.1|781961_782936_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211761.1|783351_785343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211760.1|785449_786829_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300467.1|786866_787247_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|787243_788218_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016211615.1|788452_789169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211620.1|790712_791237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211619.1|791304_793125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210267.1|793979_794486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210259.1|794549_795968_+	asmA-like family protein	NA	NA	NA	NA	NA
WP_016210248.1|796088_796343_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_016210257.1|796489_796762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777860.1|797333_797909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210265.1|797905_798076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126418.1|798991_799222_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_036777864.1|799308_800400_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210258.1|800380_801334_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	4.9e-31
WP_051307325.1|801539_803042_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	3.8e-46
WP_032126416.1|803082_803586_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.6	2.8e-09
WP_016210254.1|803845_805021_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_016210252.1|805929_806301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210255.1|806513_808775_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.2	1.8e-95
WP_016210260.1|808815_809244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556655.1|809471_810476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047085.1|810579_811173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|811245_812307_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047086.1|812301_813072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300465.1|813064_813844_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155047087.1|814065_814209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047088.1|814275_815429_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_168183138.1|815486_815720_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300249.1|815895_816261_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|816322_816676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211058.1|816796_817330_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|817468_819106_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|819110_819332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|819429_820443_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|820605_822834_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|822814_823519_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|823753_824083_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_155047090.1|824407_824914_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054300148.1|825163_826225_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047086.1|826219_826990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300465.1|826982_827762_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155047087.1|827983_828127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047088.1|828193_829347_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_155047089.1|829404_829800_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|829814_830180_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211058.1|830711_831245_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|831383_833021_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|833025_833247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|833344_834358_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|834520_836749_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|836729_837434_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|837668_837998_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_155047090.1|838322_838829_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_075274949.1|839078_840140_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047086.1|840134_840905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300465.1|840897_841677_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_168183139.1|841898_842042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047088.1|842108_843262_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_155047089.1|843319_843715_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|843729_844095_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|844156_844510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211058.1|844630_845164_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032126660.1|845302_846940_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211065.1|846944_847166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211066.1|847263_848277_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211063.1|848439_850668_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_032126658.1|850648_851353_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|851587_851917_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_155047090.1|852241_852748_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_168183140.1|852997_853213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183141.1|853227_854061_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126663.1|854087_854330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126664.1|855048_855732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212048.1|855925_856483_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_054300173.1|857246_858308_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210881.1|858518_859334_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300463.1|859834_862564_+	kinase	NA	NA	NA	NA	NA
WP_016210879.1|862666_863026_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210871.1|863022_863340_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210872.1|863356_864466_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_036794016.1|864492_865563_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_032126665.1|865682_866741_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210873.1|866755_867406_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210876.1|867473_868316_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_054300462.1|868781_869699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|870717_870912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036794860.1|870988_871282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|871549_872467_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_016211373.1|873017_873164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211374.1|873218_874409_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211370.1|874541_874985_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211369.1|875027_876071_-	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_036778204.1|876117_877509_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211371.1|877705_878629_+	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211372.1|878615_879473_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016212287.1|885283_886429_-|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_054300173.1|886507_887569_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047091.1|887792_889139_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	914642	972275	3275517	transposase,tRNA	Planktothrix_phage(28.57%)	55	NA	NA
WP_016209560.1|914642_915317_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_016209544.1|915416_917132_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|917128_917491_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_016209576.1|917505_918660_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L0G1	Tupanvirus	31.9	8.1e-36
WP_016209573.1|918663_919671_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.2	8.3e-37
WP_016209549.1|919673_920690_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	25.8	5.5e-12
WP_016209557.1|920906_921992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209541.1|922098_922491_-	RidA family protein	NA	NA	NA	NA	NA
WP_168183142.1|922674_923907_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_016209575.1|923922_925224_+	aspartate kinase	NA	NA	NA	NA	NA
WP_129556653.1|925262_927044_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032126218.1|927054_928041_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_036777172.1|928121_929198_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_036777175.1|929297_930272_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.5e-14
WP_032126219.1|930298_931276_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	1.7e-15
WP_017376633.1|931478_931748_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_016209548.1|932066_933353_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_016209571.1|933417_934098_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210710.1|939832_940612_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032126770.1|940710_941565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210714.1|941608_941977_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210715.1|941979_942777_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032126769.1|942969_943380_+	MerR family DNA-binding protein	NA	NA	NA	NA	NA
WP_016210707.1|943386_944307_-	1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_016210711.1|944376_944595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210717.1|944695_945451_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_036778805.1|945742_947179_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_016210720.1|947439_948069_+	MarC family protein	NA	NA	NA	NA	NA
WP_016210716.1|948167_948500_-	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_016210718.1|948507_948804_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_016210721.1|948805_949162_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_016210708.1|949158_949521_-	sulfurtransferase complex subunit TusD	NA	NA	NA	NA	NA
WP_017376751.1|949654_950329_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	45.4	8.9e-35
WP_016210723.1|950806_951451_+	DUF4937 domain-containing protein	NA	NA	NA	NA	NA
WP_155047092.1|951835_952114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047093.1|952593_953298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211429.1|953817_954255_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|954329_954962_-	endonuclease III	NA	NA	NA	NA	NA
WP_016211433.1|954977_955625_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_016211428.1|955627_957691_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
WP_129556651.1|959265_960474_+	MFS transporter	NA	NA	NA	NA	NA
WP_168183143.1|960661_961174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183144.1|961157_961724_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274685.1|961773_962397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556449.1|962386_962893_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300455.1|962907_963273_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300456.1|963323_964535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|964582_965644_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556651.1|965885_967094_+	MFS transporter	NA	NA	NA	NA	NA
WP_168183145.1|967281_968343_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300456.1|968390_969602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183146.1|969652_969913_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168183215.1|970034_970544_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274685.1|970533_971157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183216.1|971570_972275_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	992178	1207274	3275517	transposase,protease,tRNA	Staphylococcus_phage(22.22%)	216	NA	NA
WP_105962625.1|992178_993064_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556569.1|993054_993264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211502.1|993966_995010_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_016211508.1|995039_995384_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211503.1|995438_995894_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_155047094.1|996044_996512_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047095.1|996656_996797_-	phosphatase	NA	NA	NA	NA	NA
WP_155047096.1|996853_997126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|997157_997502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556681.1|997734_998043_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007048.1|998383_998482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211506.1|998474_999116_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|999112_999829_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211507.1|999832_1001152_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155046737.1|1001477_1002230_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300449.1|1002359_1003139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300448.1|1004176_1006546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211004.1|1008211_1010848_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_080664849.1|1010896_1011985_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016210997.1|1011984_1012668_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_032126469.1|1012727_1014389_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210998.1|1014542_1014797_+	LapA family protein	NA	NA	NA	NA	NA
WP_016211001.1|1014874_1015180_+	competence protein ComEA	NA	NA	NA	NA	NA
WP_016211002.1|1015343_1015742_+	VOC family protein	NA	NA	NA	NA	NA
WP_051307345.1|1015775_1016462_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036781250.1|1016605_1017391_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300271.1|1017486_1018461_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210826.1|1019363_1020230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210824.1|1020339_1022019_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210830.1|1022145_1023396_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_032126465.1|1023471_1023933_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210835.1|1023929_1025078_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_016210836.1|1025083_1025758_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210834.1|1025754_1026411_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.5e-39
WP_016210828.1|1026526_1027000_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_016210832.1|1027001_1027424_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210829.1|1027410_1028430_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_054300445.1|1028699_1029251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183147.1|1029345_1029888_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273808.1|1029884_1030409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|1030937_1031369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|1031370_1031697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781320.1|1031683_1031911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300214.1|1033085_1033364_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168183148.1|1033416_1033665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|1033622_1034684_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212174.1|1035284_1035542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|1035618_1035792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183149.1|1036787_1037156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046768.1|1037252_1037852_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|1037809_1038058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300443.1|1038110_1038389_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211538.1|1038627_1039551_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_155047097.1|1040245_1040929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047098.1|1041004_1042297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780787.1|1043768_1044728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780594.1|1045817_1046300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300439.1|1046571_1048554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210316.1|1048560_1050714_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_016210310.1|1050735_1050942_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_032126592.1|1051002_1051623_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210307.1|1051663_1052554_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|1052639_1053365_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|1053425_1053830_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_036778435.1|1053994_1056109_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210314.1|1056232_1057282_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_016210313.1|1057278_1058745_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032126591.1|1058887_1060225_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_032126590.1|1060287_1061820_-	nuclease	NA	NA	NA	NA	NA
WP_155047099.1|1062012_1062168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047100.1|1062312_1062672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|1063112_1063940_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_036778439.1|1064242_1064899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211716.1|1064846_1065770_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211720.1|1065783_1066707_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155047101.1|1066954_1068073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210459.1|1068277_1068796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780722.1|1068960_1069935_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_155049817.1|1069996_1070882_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047103.1|1071677_1072799_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|1072914_1073280_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047104.1|1073336_1073618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|1073621_1073801_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016210458.1|1074074_1074623_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210461.1|1074703_1074979_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_032126596.1|1074978_1076031_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_036777098.1|1076139_1078077_-	AsmA family protein	NA	NA	NA	NA	NA
WP_052104601.1|1078224_1079937_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_016210468.1|1080005_1080725_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_016210467.1|1080721_1081324_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210471.1|1081438_1082326_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|1082516_1082864_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210465.1|1082914_1083757_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_026063519.1|1084043_1084460_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168183150.1|1084508_1085384_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126686.1|1085934_1086519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212445.1|1086577_1086844_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155047105.1|1087086_1087968_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	3.4e-50
WP_129556565.1|1088276_1088672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273603.1|1088795_1088972_-	phosphatase	NA	NA	NA	NA	NA
WP_105962625.1|1089051_1089937_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1090160_1091047_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168183128.1|1091097_1091721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209892.1|1091926_1092553_+	porin family protein	NA	NA	NA	NA	NA
WP_016209896.1|1092867_1093437_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016209891.1|1093583_1094282_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_036777115.1|1094423_1094624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209884.1|1094700_1095324_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052104600.1|1095433_1096327_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209898.1|1096433_1098044_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_016209888.1|1098040_1099336_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209876.1|1099357_1101280_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209881.1|1101390_1101693_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209893.1|1101785_1106675_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_052104599.1|1107017_1108334_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_036777110.1|1108458_1109553_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_052104598.1|1109604_1110543_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_016209890.1|1110623_1111208_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209877.1|1111422_1112313_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_016209887.1|1112515_1113007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209894.1|1113150_1113642_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1113810_1114524_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036777096.1|1114586_1115927_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_081007045.1|1117029_1117659_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211960.1|1117980_1118508_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_054300573.1|1118771_1119905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|1119932_1120514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|1121083_1121269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300431.1|1121413_1121716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1121675_1122014_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211968.1|1122139_1122544_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1122556_1122697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126649.1|1122793_1123990_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_016211971.1|1124010_1124622_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_129556499.1|1124827_1125981_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_155047106.1|1126177_1127063_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|1127104_1127713_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1127909_1128815_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155047107.1|1128840_1129293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556559.1|1129373_1129802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212093.1|1129958_1130888_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_075273313.1|1131100_1131439_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1131398_1131854_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212654.1|1131845_1132130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212100.1|1132540_1133461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212098.1|1133461_1134313_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1135033_1136080_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032126840.1|1136063_1138061_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_122941967.1|1138239_1138545_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1138774_1138981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1139241_1139943_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046955.1|1140184_1140364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104686.1|1141519_1144276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|1144511_1145804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|1145857_1146694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212218.1|1146838_1147189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274679.1|1148640_1149702_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126801.1|1150370_1150880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183151.1|1150927_1151989_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047109.1|1154172_1154586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1154647_1155013_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168183152.1|1155139_1155535_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126869.1|1156055_1156295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377359.1|1156272_1156902_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168183153.1|1156868_1157333_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047111.1|1157449_1158778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|1158781_1159668_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047112.1|1159947_1160487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777508.1|1160563_1160836_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_075274676.1|1160910_1161108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046717.1|1161266_1161416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|1163672_1165709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300427.1|1166432_1168133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047113.1|1168134_1169721_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_162034411.1|1169733_1170459_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|1170755_1171217_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_016211081.1|1171257_1172193_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211087.1|1172220_1173216_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211088.1|1173423_1174386_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155047114.1|1174505_1174760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046957.1|1175261_1176113_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_081377357.1|1176168_1176570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034412.1|1176728_1176884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212611.1|1177053_1177374_+	histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|1177421_1178483_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|1178557_1178938_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_052047081.1|1179208_1179646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780900.1|1179696_1180350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1181479_1181845_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1181790_1182366_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1182735_1183710_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212585.1|1183821_1184142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047115.1|1184436_1184841_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|1185786_1186347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|1186479_1186869_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|1187038_1187869_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211119.1|1189158_1189920_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_032126499.1|1190887_1191499_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|1191877_1193125_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|1193261_1193978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|1194111_1194813_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_155047115.1|1195402_1195807_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1195803_1196379_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1196324_1196690_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|1196751_1197312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|1197444_1197834_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|1198003_1198834_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_036779309.1|1199056_1199962_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1200125_1200887_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_168183154.1|1200890_1201766_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|1201851_1202463_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|1202841_1204089_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|1204225_1204942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|1205075_1205777_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_155047115.1|1206366_1206771_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_155047004.1|1206767_1207274_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	1217735	1267259	3275517	transposase,tRNA	Armadillidium_vulgare_iridescent_virus(40.0%)	50	NA	NA
WP_155047004.1|1217735_1218242_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1218256_1218622_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|1218683_1219244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|1219376_1219766_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|1219935_1220766_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_036779309.1|1220988_1221894_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1222057_1222819_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|1222822_1223689_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|1223785_1224397_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_054300415.1|1227009_1227711_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_168183155.1|1228300_1228705_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_155046986.1|1228701_1229588_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126498.1|1229649_1230210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|1230342_1230732_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|1230901_1231732_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_036779309.1|1231954_1232860_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1233023_1233785_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|1233788_1234655_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|1234751_1235363_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|1235741_1236989_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|1237125_1237842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|1237975_1238677_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_155047116.1|1239266_1239518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1239478_1239844_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1239789_1240365_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210280.1|1240776_1241871_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|1241952_1242474_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|1242528_1243005_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|1243060_1243363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|1243427_1244135_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_036778186.1|1244507_1244906_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|1244945_1245377_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|1245387_1246071_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1246147_1248343_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|1248440_1249184_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|1249211_1249997_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_032126333.1|1250042_1250747_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|1250734_1251901_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|1251954_1252788_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210270.1|1252857_1255845_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|1255886_1257278_+	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_075273303.1|1257291_1258008_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016211367.1|1258163_1258946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126330.1|1259093_1260053_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_036779263.1|1260395_1262405_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_016211366.1|1262460_1262748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126332.1|1263000_1264200_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_168183156.1|1265933_1266089_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168183157.1|1266069_1266735_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|1266965_1267259_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
>prophage 13
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	1273776	1406653	3275517	transposase,tRNA	uncultured_Mediterranean_phage(21.74%)	111	NA	NA
WP_129556499.1|1273776_1274929_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212343.1|1275168_1275975_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_016209806.1|1276787_1276937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209808.1|1277279_1277648_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_036778458.1|1277644_1278463_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209813.1|1278563_1279379_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209801.1|1279663_1281718_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032126324.1|1281717_1282140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209805.1|1282318_1283812_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_016209818.1|1283944_1284760_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209799.1|1284855_1285272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209815.1|1285658_1286198_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_036777937.1|1286515_1288228_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209812.1|1288674_1290498_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_016209821.1|1290587_1290920_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209800.1|1290950_1291547_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_036777933.1|1291543_1292668_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209822.1|1292803_1293451_+	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_016209810.1|1293507_1295421_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_155047117.1|1297010_1300310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|1301011_1301980_-	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209809.1|1302086_1302575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209823.1|1302999_1303443_+	response regulator	NA	NA	NA	NA	NA
WP_075273327.1|1304664_1305240_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1305185_1305551_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|1305601_1306258_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_080664854.1|1306594_1307176_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032126179.1|1307133_1307385_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_016211113.1|1307414_1308740_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_016211112.1|1308795_1309443_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211115.1|1309635_1311588_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211114.1|1311720_1314651_+	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_075274672.1|1315016_1315610_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168183158.1|1315647_1316007_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300286.1|1316070_1316535_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047118.1|1316524_1317967_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016212252.1|1318004_1318163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212466.1|1318477_1319203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|1319407_1319779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780001.1|1320135_1320399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779999.1|1320385_1320817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779996.1|1320836_1322393_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016211391.1|1322404_1322980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728317.1|1323046_1326412_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|1326602_1327577_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556498.1|1327756_1328365_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036778626.1|1328361_1330302_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_016210594.1|1330437_1331091_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_016210595.1|1331267_1332446_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210588.1|1332813_1334139_+	fimV domain protein	NA	NA	NA	NA	NA
WP_032126176.1|1334229_1335012_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210587.1|1335113_1335974_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_016210590.1|1336148_1337411_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210593.1|1337490_1338021_+	colicin V production protein	NA	NA	NA	NA	NA
WP_016210586.1|1338042_1339548_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210592.1|1339560_1340217_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016212005.1|1340606_1342367_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_075273327.1|1342705_1343281_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1343226_1343592_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126856.1|1345686_1346028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377359.1|1346088_1346718_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168183159.1|1346751_1347150_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300406.1|1347450_1350186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|1352739_1353555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047120.1|1355577_1355922_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105962623.1|1355930_1357084_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274669.1|1358096_1358399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183160.1|1358603_1359257_+	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	27.1	9.6e-10
WP_054300405.1|1359808_1360309_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209947.1|1360830_1361493_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_036777555.1|1361519_1362749_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209940.1|1362905_1365677_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_052104625.1|1365752_1366196_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209931.1|1366348_1367821_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_016209926.1|1367932_1368994_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209945.1|1368990_1370025_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209932.1|1370027_1371068_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_036777579.1|1371250_1372366_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209930.1|1372404_1372758_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777561.1|1372778_1374647_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209935.1|1374668_1375613_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_016209925.1|1375846_1376125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1376334_1376973_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209944.1|1376947_1378375_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_036777566.1|1378575_1379253_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209939.1|1379387_1380662_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_036777569.1|1380729_1381485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209948.1|1381536_1382454_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_054300404.1|1382562_1383456_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075273594.1|1383528_1384899_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300276.1|1384938_1385913_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016211771.1|1386205_1386394_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_016211770.1|1386407_1387541_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_168183161.1|1387740_1391805_+	cadherin-like domain-containing protein	NA	NA	NA	NA	NA
WP_016211827.1|1392068_1392689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1393020_1393374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1393587_1393782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183217.1|1394447_1395017_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300400.1|1395031_1395274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377857.1|1395418_1395640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300398.1|1396027_1396909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|1396966_1397563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|1397595_1398369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|1398902_1399199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210888.1|1399221_1399473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047123.1|1399418_1400141_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210886.1|1400209_1400989_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210887.1|1401071_1402022_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210889.1|1402531_1405378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047008.1|1405395_1405710_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_129556478.1|1405767_1406653_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	1447049	1477670	3275517	transposase,tRNA	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(33.33%)	27	NA	NA
WP_032126790.1|1447049_1447955_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|1448183_1449455_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|1449479_1450217_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|1450469_1451612_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|1451628_1453230_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_080664858.1|1453741_1453879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|1453875_1455153_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|1455502_1455685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047126.1|1455956_1456448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126846.1|1456615_1457221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|1457382_1457919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047127.1|1458080_1458896_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_052133287.1|1460730_1461129_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|1461317_1461875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|1462051_1463401_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|1463606_1464689_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210803.1|1464763_1466062_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_036776426.1|1466239_1467091_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210805.1|1467099_1467771_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_032126141.1|1468189_1469464_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210804.1|1469528_1471448_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126139.1|1471454_1472384_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_054300383.1|1472479_1474960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300382.1|1475230_1475653_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047129.1|1475923_1476580_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1476783_1477149_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1477163_1477670_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	1482038	1535001	3275517	transposase,tRNA	Staphylococcus_phage(20.0%)	43	NA	NA
WP_016211422.1|1482038_1482509_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|1482597_1483869_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_054300250.1|1483968_1484628_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_075273327.1|1484617_1485193_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1485138_1485504_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211838.1|1486213_1486387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|1486857_1487322_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_032126147.1|1487474_1488953_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|1489070_1489523_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1490382_1491444_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047130.1|1491506_1492265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047131.1|1492452_1493109_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556508.1|1493379_1493823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1493884_1494178_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_081377879.1|1495101_1495326_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212421.1|1495677_1495860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047133.1|1496610_1497585_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.6e-27
WP_155047134.1|1497856_1498879_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126343.1|1502478_1503291_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_168183129.1|1505160_1505298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183162.1|1506367_1506532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211468.1|1507228_1507396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126344.1|1511422_1512511_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|1512513_1513080_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_168183218.1|1513154_1513619_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|1513680_1514046_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047136.1|1514213_1514645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036781272.1|1514737_1514956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210508.1|1516714_1518412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778516.1|1518732_1519281_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|1519408_1520137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|1520196_1523694_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|1523751_1525005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|1525113_1526016_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|1526069_1527107_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|1527242_1528481_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|1528473_1529202_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|1529232_1529889_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211831.1|1530026_1531754_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|1532054_1532408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1532823_1533324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046962.1|1533975_1534422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|1534425_1535001_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	1556421	1600767	3275517	transposase,protease,tRNA	Klosneuvirus(22.22%)	40	NA	NA
WP_075273327.1|1556421_1556997_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210928.1|1557047_1557353_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|1557567_1557768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|1558574_1558907_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_155047138.1|1558924_1559407_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162034416.1|1559382_1559724_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047140.1|1559810_1560395_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1560340_1560706_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|1560939_1562475_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|1562599_1564084_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|1565031_1565571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047141.1|1566774_1566981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126642.1|1567050_1567512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126641.1|1567547_1570118_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_016209840.1|1570225_1570711_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|1570883_1571924_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|1571901_1572384_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_036777412.1|1572380_1574975_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|1575281_1575545_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|1575823_1576522_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|1576741_1576936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|1577011_1578571_-	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_161625459.1|1578889_1579762_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_054300271.1|1579894_1580869_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155064795.1|1581108_1582566_-	amino acid permease	NA	NA	NA	NA	NA
WP_164997259.1|1583155_1583302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209826.1|1583394_1584417_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_036777393.1|1584747_1586115_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|1586350_1586605_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|1586620_1587907_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|1587926_1589141_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|1589140_1590034_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|1590231_1591530_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209829.1|1592909_1595309_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209834.1|1595305_1596064_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|1596240_1596630_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_054300373.1|1597357_1598215_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|1598211_1599186_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046721.1|1599357_1599525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1599705_1600767_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	1626828	1676444	3275517	transposase,integrase,tRNA	Staphylococcus_phage(40.0%)	48	1651210:1651269	1686339:1687440
WP_036777656.1|1626828_1627608_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|1627625_1627973_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|1628084_1628357_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|1629973_1630783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|1631621_1632443_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|1632643_1633876_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_032126790.1|1634109_1635015_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_032126804.1|1635174_1636050_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211806.1|1636214_1636940_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_081007037.1|1636982_1638521_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|1638527_1639913_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_054300271.1|1640295_1641270_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047144.1|1641714_1643040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|1643075_1644050_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016212081.1|1644482_1644659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|1644803_1645487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183163.1|1645635_1645785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273555.1|1645764_1646298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210332.1|1646428_1647172_-	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_016210330.1|1647269_1647653_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210333.1|1647856_1648486_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|1649292_1650267_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
1651210:1651269	attL	GCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACTC	NA	NA	NA	NA
WP_054300271.1|1651300_1652275_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210326.1|1652394_1653693_+	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_016210325.1|1653846_1655223_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210321.1|1657893_1658862_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_016210319.1|1659058_1660471_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300568.1|1660677_1661388_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	4.1e-38
WP_054300366.1|1661408_1661822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210320.1|1661971_1663045_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_016210322.1|1663181_1664078_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016211334.1|1664695_1664884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183164.1|1664932_1665244_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126265.1|1665612_1666530_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_052104656.1|1666853_1667357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082827.1|1667433_1668735_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211330.1|1668909_1670010_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_032126267.1|1670357_1670600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155064793.1|1670593_1670764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162034417.1|1671019_1671862_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075273553.1|1672071_1672998_+	MFS transporter	NA	NA	NA	NA	NA
WP_155047145.1|1672987_1673563_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|1673508_1673856_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047146.1|1674095_1674305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047262.1|1674247_1674364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164997261.1|1674568_1674718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183165.1|1674758_1675190_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556637.1|1675664_1676444_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1686339:1687440	attR	GAGTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGCCAAGTAGTTACGGATAAAAATAAAAAATTTATGAACTTCATAGCGCCAAAATAATCAAAACTTATTTATCAAAGTATAGTCAAATTTAATAGCGCTAAAATGAAATAACGAGACTATGAACCTTCATAATCCCTAGTCAACTTAACAACTATAGGTGCTAACAATATTAAAGCAATCAGATTAGGAATAGCCATCAACGCATTTAAAATATCTGCAACTAGCCACAATAAATTTAGATTAGCGACAGCACCTAAAACAATCACAATTACCCATAGAATACGATAGGGAATAATGATTTTAGTACCAAATAAATAGCTCGCACAGCGTTCCCCATAATAACTCCAACCAAGCAAAGTAGTGAAAGCAAAAATAACGAGTCCCACCGTAACAACCAAGCCACCGCCATTAAAAGCAACCTGAAAAGCATCTGAAGAAAGCGCAGCCCCTGTCTCGCCAGATGTCCATAACCCACTTAATAAGATAACAAAGGCAGTAATACTACAAAGAATCATTGTATCAAAAAAGGTCCCGGTCATTGCGATTAATCCCTGGCGAACTGGGCTATTTGTTTTTGCTGCTGCATGAGCAATCGGTGCTGTGCCTAAACCCGCCTCATTTGAAAAAACACCGCGCGCAACACCAAAGCGAATCGCAGCCATTATCGTTGCACCAGCAAACCCTCCTGCTGCTGCTGCGCCACTAAACGCACTATTAATAATCAACATAAATACACTGGATAGGTGGTGAATATTAAGCCCAATAACAACCAGGCCGCCGATAATATAAAAAACAGCCATAATAGGAACCAAATAGCTAGTCACACGCCCAATCCAACGAATTCCTCCGAACAGTACTAAGCCCACCAAAACAGCACTGACTCCACCGACTAACCAAGGTGAAATACCAAAGTGATTATTTAATACGTGCGCCATCGAGTTACTTTGAACACTGTTGCCTATACCAAACGCTGCAATCGTTCCAAAAATAGCAAAGGCAACCCCTAAGCCTCGCCAGCGAGAGCCTAACCCATTTTTAATGTAAT	NA	NA	NA	NA
>prophage 18
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	1685332	1748776	3275517	transposase,tRNA,integrase,protease	Staphylococcus_phage(33.33%)	58	1675073:1675132	1755438:1755727
1675073:1675132	attL	ACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGC	NA	NA	NA	NA
WP_054300271.1|1685332_1686307_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211148.1|1686511_1687840_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1688103_1688673_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|1688688_1689000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|1689009_1689966_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1690078_1690432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211153.1|1690435_1691500_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211145.1|1691500_1693240_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_036779218.1|1693246_1693669_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|1693652_1694282_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_054300271.1|1694838_1695813_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081377353.1|1695852_1696518_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047147.1|1696945_1697920_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_155047148.1|1698449_1699487_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300359.1|1699845_1700418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212062.1|1700696_1702505_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|1702863_1703148_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556638.1|1704491_1705172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|1705171_1705474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|1705573_1706695_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_054300357.1|1706977_1707853_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016212011.1|1708086_1709208_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|1709429_1709813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|1709828_1710506_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_075273474.1|1710549_1711524_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_155047149.1|1711547_1711763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047150.1|1711757_1712984_-	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155047151.1|1713033_1713573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1713569_1714544_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047152.1|1714583_1715306_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211994.1|1715508_1716045_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|1716081_1716267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|1716507_1717413_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162034418.1|1718321_1719632_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016212220.1|1719640_1719796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007034.1|1720004_1720289_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|1720270_1720411_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_052104693.1|1720492_1724359_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|1724524_1725400_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|1725432_1725594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300355.1|1725804_1725990_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168183219.1|1725979_1726549_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155097713.1|1726552_1726867_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162034389.1|1726947_1727208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1727280_1728255_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300354.1|1728393_1728912_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.9	1.3e-30
WP_054300353.1|1729058_1729286_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126690.1|1735328_1735811_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_016210112.1|1736504_1737932_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_122943012.1|1738048_1738504_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|1738689_1739955_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|1740047_1741307_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|1741378_1741651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036793752.1|1741940_1743413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210113.1|1743859_1744909_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|1745096_1745852_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_036777611.1|1745912_1747502_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|1747684_1748776_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
1755438:1755727	attR	ACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGT	NA	NA	NA	NA
>prophage 20
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	1840555	1874952	3275517	transposase	Tupanvirus(25.0%)	33	NA	NA
WP_162034423.1|1840555_1841389_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|1842220_1843819_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|1843985_1845170_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|1845753_1846308_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_168183173.1|1846661_1847810_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|1847794_1848466_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|1848488_1849493_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|1849521_1850970_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|1851087_1852065_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300249.1|1852218_1852584_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047162.1|1852598_1853036_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1853055_1854030_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273543.1|1854069_1854312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212474.1|1854392_1854569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776661.1|1855296_1855626_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_032126448.1|1855657_1856038_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_016211178.1|1856128_1857157_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016211180.1|1857219_1857684_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126449.1|1857704_1858628_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_052104569.1|1858772_1859303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776658.1|1859415_1861410_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211177.1|1861795_1863016_+	amino acid permease	NA	NA	NA	NA	NA
WP_155046970.1|1864440_1864689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155049812.1|1864766_1865312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126783.1|1865422_1866664_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211741.1|1866809_1867586_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_075273313.1|1869645_1869984_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007028.1|1869943_1870399_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|1870551_1871859_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|1872109_1872988_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|1872984_1873452_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|1873578_1873764_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_168183220.1|1874439_1874952_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	39.0	1.1e-16
>prophage 21
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	1881026	2013813	3275517	transposase,plate,integrase,tRNA	Staphylococcus_phage(10.0%)	112	1901460:1901519	1941935:1942349
WP_075273327.1|1881026_1881602_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1881547_1881913_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211352.1|1882379_1882820_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|1882993_1883332_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007028.1|1883291_1883747_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1884162_1885137_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047264.1|1885176_1885536_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210801.1|1885858_1886830_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210795.1|1886811_1887783_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_052104738.1|1887888_1888695_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036777256.1|1889069_1889270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047164.1|1889692_1890115_-	response regulator	NA	NA	NA	NA	NA
WP_129556527.1|1891107_1891368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273540.1|1891552_1892164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778182.1|1892530_1893358_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155047165.1|1893564_1895130_+	amino acid permease	NA	NA	NA	NA	NA
WP_168183174.1|1895155_1895881_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_155046972.1|1896682_1897273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|1898796_1899285_-	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_051307365.1|1899304_1899565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211834.1|1899822_1900137_+	hypothetical protein	NA	NA	NA	NA	NA
1901460:1901519	attL	GGTAACCCTCCCTTAAAATAGTACAAGTGATAAGTGGAATCTTCTGTTAAATTAACTTAG	NA	NA	NA	NA
WP_016212185.1|1903511_1904501_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1904834_1905020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046973.1|1905376_1905535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|1905701_1907657_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|1907955_1908417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|1908586_1909384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210751.1|1909867_1911673_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_129556641.1|1911760_1913023_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_168183175.1|1915105_1915993_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080728364.1|1916145_1916418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211454.1|1918292_1918763_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_161625471.1|1919525_1921001_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|1921062_1922520_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|1922625_1923021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|1923048_1923627_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_155047166.1|1924248_1925310_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047167.1|1925359_1926877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300328.1|1926987_1927764_+	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_016212459.1|1927901_1928282_-	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_155046975.1|1928401_1928851_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_054300326.1|1929264_1929729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|1929830_1930103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273534.1|1930296_1931178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211726.1|1932809_1933403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300322.1|1933790_1935725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|1935763_1936678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1937193_1937769_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1937714_1938080_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212534.1|1939207_1939474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047169.1|1939886_1940495_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_162034424.1|1940529_1940784_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047171.1|1941015_1941579_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	39.9	3.2e-30
WP_016212445.1|1941653_1941920_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1942165_1942621_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1941935:1942349	attR	CTAAGTTAATTTAACAGAAGATTCCACTTATCACTTGTACTATTTTAAGGGAGGGTTACCTCAGCCCCAAATTTATATATCATTCGAATGATTTTTATCATAATGAAGTACAATCAACACTGTTAATAATGTTGCACATAATGTAAATAATAACCAGCCCAAATACATCATTTTTAACTCTTTGCCTCACGTGTCATAAAATAAATACACTAATTAGGCTCCGTTGACATTTCACCTTAACCATAAGATAGTGCTTGCAATTTTCAAAAAGGATAAATATCTGCAAGCCCTTTTTTCAAAACGTGAAAAAACTCTTCTAAATTGTTTTAACTTGCCAATGCAGCACTCTATCAAATGCCTTTCCTTGTAAACATGCTGATCGTGGTCAAATTTATTAATCCTATTTGATTTAGAA	NA	NA	NA	NA
WP_075273313.1|1942580_1942919_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211752.1|1942995_1944141_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211748.1|1944156_1945761_-	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_032126540.1|1947242_1948106_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212346.1|1948339_1948486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300321.1|1949280_1949652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300320.1|1949869_1950469_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047172.1|1951614_1952640_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|1952811_1953030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122942160.1|1953190_1954171_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|1954798_1955782_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|1955932_1956280_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|1956276_1956879_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|1956966_1958487_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|1958556_1959021_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016212485.1|1959817_1960351_+	IQ calmodulin-binding motif family protein	NA	NA	NA	NA	NA
WP_155046976.1|1960647_1960785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007073.1|1960850_1961021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777066.1|1961003_1964060_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|1964146_1965595_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|1966027_1967032_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209617.1|1967152_1967551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209627.1|1967590_1969414_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_033923701.1|1969410_1972713_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209616.1|1972743_1973658_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016209618.1|1973728_1974358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|1974402_1974837_-	lipoprotein	NA	NA	NA	NA	NA
WP_016209630.1|1974817_1975558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|1975571_1976969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|1976971_1979920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|1979919_1981641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209636.1|1981655_1982060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777070.1|1982060_1984934_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075273639.1|1984936_1985653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|1986020_1987913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|1987944_1990482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|1990513_1991686_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209624.1|1991682_1992294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209623.1|1992315_1993815_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209615.1|1993831_1994338_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_155047173.1|1995690_1995900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047174.1|1995955_1996600_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.4	1.1e-39
WP_168183176.1|1996533_1996674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|1999244_2000060_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032126786.1|2000358_2003439_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|2003456_2004509_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|2005041_2005692_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|2006026_2006671_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|2006858_2007194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|2007154_2007742_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|2007959_2008199_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|2008520_2008868_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|2008966_2009245_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|2009297_2009585_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_129556490.1|2009588_2010475_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007019.1|2012036_2012546_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_033923708.1|2012937_2013813_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	2033384	2092815	3275517	transposase	Escherichia_phage(33.33%)	59	NA	NA
WP_155047178.1|2033384_2034113_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.5e-43
WP_155047179.1|2034181_2034526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211983.1|2034773_2035433_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|2035528_2036893_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|2037350_2037845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211946.1|2039199_2039955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211943.1|2040215_2040569_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|2040561_2041707_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_033923708.1|2041821_2042697_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036776195.1|2043108_2044356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047180.1|2044998_2045202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300304.1|2045254_2045533_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209473.1|2045605_2045989_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016209489.1|2045985_2046717_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_016209497.1|2046719_2047463_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_016209492.1|2047476_2048376_-	GTPase Era	NA	NA	NA	NA	NA
WP_016209466.1|2048381_2049056_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	8.9e-27
WP_129556644.1|2049461_2050349_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016209482.1|2050399_2052202_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	39.2	5.1e-21
WP_016209457.1|2052501_2053083_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_036776203.1|2053226_2054801_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_155046977.1|2054808_2055129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209486.1|2055247_2055499_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_016209469.1|2055579_2056578_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_016209471.1|2056724_2057051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209462.1|2057060_2057204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209474.1|2057213_2057624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209468.1|2057765_2058077_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_155047182.1|2058782_2060813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209467.1|2060882_2061908_-	FUSC family protein	NA	NA	NA	NA	NA
WP_036776209.1|2064347_2065343_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_016209459.1|2065602_2066769_+	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016209478.1|2066932_2067886_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036776213.1|2067908_2069927_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_016209490.1|2070017_2070341_-	YqcC family protein	NA	NA	NA	NA	NA
WP_016209463.1|2070767_2071151_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032126730.1|2071505_2071994_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016209472.1|2072096_2073467_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_016209456.1|2073580_2074312_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	M1IDP9	Pelagibacter_phage	35.8	5.3e-09
WP_016209491.1|2074336_2075434_-	alanine racemase	NA	NA	NA	NA	NA
WP_032126729.1|2075466_2076891_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.7e-152
WP_016209484.1|2077097_2077550_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|2077561_2077789_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_016209481.1|2077838_2078165_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_052104552.1|2078367_2079057_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016209488.1|2079206_2079695_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_016209465.1|2079735_2080836_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_016209460.1|2080882_2081965_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.1	1.0e-72
WP_075274651.1|2081954_2082521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007071.1|2082511_2083867_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209485.1|2083868_2084891_-	chorismate mutase	NA	NA	NA	NA	NA
WP_155047183.1|2084915_2085689_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209496.1|2085718_2085931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047184.1|2086336_2087356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047185.1|2087455_2088341_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047186.1|2088345_2089575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|2089604_2090468_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046981.1|2091466_2091643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300299.1|2091732_2092815_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	2096721	2170855	3275517	transposase,integrase	Staphylococcus_phage(28.57%)	55	2105326:2105385	2116883:2117820
WP_075273524.1|2096721_2097687_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212247.1|2099328_2100084_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_054300392.1|2100313_2101375_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|2101530_2103081_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
2105326:2105385	attL	AAACTCTTGTTTCATCGTGCGATGAAAGCGTTCACAAATACCATTTGTTTGAGGTGAACG	NA	NA	NA	NA
WP_155047187.1|2106516_2107491_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_168183178.1|2108182_2109121_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_016212247.1|2109487_2110243_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_054300271.1|2110867_2111842_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212246.1|2113369_2114026_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_168183179.1|2114961_2115339_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168183222.1|2115344_2116028_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|2116090_2117173_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210771.1|2117264_2120666_-	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	23.1	2.2e-09
2116883:2117820	attR	CGTTCACCTCAAACAAATGGTATTTGTGAACGCTTTCATCGCACGATGAAACAAGAGTTTTATGACATTGCTTTTCGTAAAAAAGTCTATAATTCACTTGAGGAGCTGCAAGTTGATGTTGATGAGTGGTTGATAAAGTACAATCAGCATCGGCCACATTCTGGGAAATACTGTTATGGAAAAACACCAATGCAAACATTTCAGGACTCAAAACATTTAGCACAAGAAAAAATAATCAATAAAAATGTGCAATCTGACAGTCTGATCAATCAGACAAATGTTGTCAGATGATTTAAGCTTGTCAGATCATATCTGGAGTTTTACACCTTCAGAAAAAAAATCATCGCCTAACACAACGCAATCGATTAAAATTCAGACCCAATCAAATAAATTGCTGATAAACTACAAGTTGATCCAACCATGGAAAATACAATGCAGATTGCACAGTTTTATCACCTTTATCAATGAAAAGCTGCCAATAGCGCTTCATTTGACTCTCATAGTTCTTTTTTTCATTTTTTAAAAAGTCATCTATCTGTTTAACACTACTATTTATAGGAGGCTGAGCTGTTTTAAAGTCAATTATCCAACGTATACCTTGCTCATCATAAAAAGTTCGATCAATAACATGCCGATTGACACGCCCATATTTTTTATTTAAAAGAACATATTCAGAGCGTGCATTGATACGCCCAGGATCAAGCAAGTATGCCGCCAGCTCTGACTGTTCAATACATTTTATTAGCTTATAAATACTTTCTAGTGCATGGTCTTTTTTCAATCCAATCAGGCCATAGCGCCGCAATAAACTTGTTAATACCCTTGCATCACATACTGTCTTTTTCCACTTGCAAATACCTACTCGGCTTATTGCACATAACAACTGATGACAAACCTGGCCAAAAGCCCGTTCATTCATTGCATGCCAATGAAAATGC	NA	NA	NA	NA
WP_016210773.1|2120662_2123356_-	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210769.1|2123659_2125162_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_033923762.1|2125462_2125696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|2125823_2126633_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_016210772.1|2126716_2128270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210397.1|2129478_2131653_+	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210388.1|2131649_2132324_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210399.1|2132349_2134341_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_162034430.1|2134355_2134658_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_032126670.1|2134701_2135139_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210394.1|2135164_2136550_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_122940572.1|2136660_2137086_-	flaG family protein	NA	NA	NA	NA	NA
WP_032126669.1|2137197_2138775_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210398.1|2138999_2140592_-	B-type flagellin	NA	NA	NA	NA	NA
WP_016210393.1|2141080_2143282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778065.1|2143375_2144809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|2144851_2145367_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155046736.1|2145366_2146320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211168.1|2146297_2146957_-	wbqC-like family protein	NA	NA	NA	NA	NA
WP_036778066.1|2146953_2147682_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307350.1|2147671_2148418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211166.1|2148401_2149454_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_016211172.1|2149654_2150851_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_036778145.1|2150900_2152022_-	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_036781047.1|2152634_2153492_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_129556646.1|2154809_2156195_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_016211278.1|2156246_2157506_-	threonine synthase	NA	NA	NA	NA	NA
WP_016211277.1|2157492_2158461_-	homoserine kinase	NA	NA	NA	NA	NA
WP_016211279.1|2158474_2160943_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_054300294.1|2161686_2162748_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300293.1|2163019_2163385_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047188.1|2163441_2163606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|2163595_2163769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|2163741_2163894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155082073.1|2164349_2165030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155082072.1|2165059_2165197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779544.1|2165605_2166613_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|2166612_2166870_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300291.1|2167132_2167507_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155047265.1|2169163_2169757_-	reverse transcriptase	NA	A0A0N7AE80	Bacillus_phage	28.9	4.0e-07
WP_155047189.1|2170046_2170220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2170279_2170855_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	2236410	2291298	3275517	transposase,protease,tRNA	Orpheovirus(16.67%)	56	NA	NA
WP_016209434.1|2236410_2237832_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_129556553.1|2237921_2239514_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209439.1|2239677_2240304_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_054300277.1|2240384_2243066_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209445.1|2243548_2244505_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016209435.1|2244605_2244977_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209404.1|2245003_2245867_+	chemotaxis phosphatase CheX family protein	NA	NA	NA	NA	NA
WP_155047194.1|2245856_2246615_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_036776598.1|2246903_2247389_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_016209443.1|2247463_2247985_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209405.1|2248030_2248924_-	cheW-like domain protein	NA	NA	NA	NA	NA
WP_016209406.1|2248920_2249742_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209408.1|2250056_2250227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209427.1|2250380_2251784_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_016209446.1|2251877_2253101_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_016209402.1|2253114_2253843_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016209424.1|2253857_2255135_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|2255234_2255609_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|2255693_2256581_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|2256638_2257367_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_016209409.1|2257363_2258473_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_016209444.1|2258624_2259053_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|2259147_2259507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776605.1|2259496_2260708_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|2260704_2261493_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|2261655_2262450_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300271.1|2262655_2263630_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126933.1|2263798_2265100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2265103_2265403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2265392_2265557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2265613_2265979_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|2266318_2267059_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_016211549.1|2267062_2269567_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|2269829_2270786_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|2270769_2271531_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_054300275.1|2271608_2272484_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2272608_2272854_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|2272913_2275187_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|2275241_2275595_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2275784_2276078_+	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|2276250_2276430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|2276505_2277081_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|2277363_2278680_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2278690_2279059_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|2279089_2279752_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032126362.1|2279926_2280292_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2280237_2280813_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126519.1|2280980_2281700_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_016211478.1|2281679_2282495_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126518.1|2282511_2284713_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211474.1|2284795_2286145_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_016211473.1|2286219_2286819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211476.1|2286802_2287012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777061.1|2287329_2288517_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211932.1|2288712_2290002_+	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_129556478.1|2290412_2291298_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	2303807	2348930	3275517	transposase,tRNA	Moraxella_phage(16.67%)	44	NA	NA
WP_054300268.1|2303807_2304869_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776407.1|2305117_2306254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211446.1|2306437_2308165_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_016211448.1|2308154_2309363_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211450.1|2309461_2310484_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155047009.1|2311259_2311433_+	phosphatase	NA	NA	NA	NA	NA
WP_052104774.1|2311577_2312210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556557.1|2312257_2312569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047067.1|2312713_2313607_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|2313770_2314043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|2314270_2315482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211037.1|2315832_2316462_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|2316510_2317527_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|2317773_2317989_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|2318041_2318491_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_036779409.1|2318570_2320316_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|2320407_2322279_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_075275207.1|2322626_2323076_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|2323123_2324185_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273494.1|2324775_2325336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|2326400_2328881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047195.1|2328955_2329858_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_033923708.1|2329870_2330746_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210899.1|2331355_2333239_-	APC family permease	NA	NA	NA	NA	NA
WP_016210896.1|2333292_2334375_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210904.1|2334417_2335068_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210903.1|2335289_2335661_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_129556487.1|2335779_2337117_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_054300270.1|2337195_2338173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210894.1|2338513_2338816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|2339290_2339581_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210898.1|2339669_2340020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2340276_2341005_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155047196.1|2341075_2341657_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_054300269.1|2341801_2342170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2342191_2342557_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2342613_2342778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007012.1|2342767_2342938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|2342932_2343994_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273492.1|2344102_2344222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556486.1|2344312_2344660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779112.1|2344745_2346182_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2346404_2347652_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_054300173.1|2347868_2348930_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	2369471	2415693	3275517	transposase,integrase	Staphylococcus_phage(21.43%)	52	2372074:2372133	2419322:2419761
WP_168183183.1|2369471_2370356_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2370739_2371078_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2371037_2371298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047198.1|2371442_2371610_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300263.1|2371597_2372038_+	hypothetical protein	NA	NA	NA	NA	NA
2372074:2372133	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_075273474.1|2372109_2373084_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016212461.1|2373459_2373834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2373837_2374413_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2374358_2374724_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307332.1|2374932_2375139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300262.1|2375186_2375477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104721.1|2375468_2377175_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_051307331.1|2377246_2379025_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_036779374.1|2379379_2379946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210553.1|2380070_2380724_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_155047199.1|2380750_2382193_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210545.1|2382289_2383267_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_129556482.1|2383415_2384021_+	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_026063577.1|2384092_2384386_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556629.1|2384612_2385359_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_017376905.1|2385589_2385817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|2385881_2386064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|2386500_2387055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034432.1|2387308_2387482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046716.1|2387752_2387899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046984.1|2388320_2389439_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047108.1|2390250_2390649_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155049808.1|2390733_2391342_-	DNA polymerase	NA	NA	NA	NA	NA
WP_032126362.1|2391426_2391792_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168183224.1|2391737_2392316_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211578.1|2392385_2392730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2392745_2392940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2393006_2393360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2393532_2394507_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_168183184.1|2394582_2395347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211585.1|2395405_2395963_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_075273486.1|2396197_2397172_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_054300257.1|2397148_2397958_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
WP_016211583.1|2399342_2400251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211579.1|2400318_2400804_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168183185.1|2401002_2401164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047202.1|2401308_2402373_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.2	4.7e-139
WP_036781361.1|2402655_2403045_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_155047203.1|2403064_2404126_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212302.1|2404426_2404726_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_081007067.1|2404946_2410421_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_036780532.1|2410932_2411973_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_054300162.1|2412050_2413133_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036781387.1|2413250_2413523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|2413515_2413794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2414137_2415112_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047204.1|2415135_2415693_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V4T7	Roseobacter_phage	33.3	8.4e-15
2419322:2419761	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTA	NA	NA	NA	NA
>prophage 27
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	2420136	2477063	3275517	transposase,protease	Staphylococcus_phage(16.67%)	48	NA	NA
WP_075273327.1|2420136_2420712_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|2421336_2421747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047205.1|2421921_2422143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556523.1|2422630_2423516_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|2424141_2424552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047205.1|2424726_2424948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2424967_2425942_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211528.1|2426501_2426807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|2426787_2427486_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211529.1|2428048_2428201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046745.1|2428659_2429226_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168183186.1|2429273_2429549_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047205.1|2430036_2430258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212436.1|2430432_2430843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183187.1|2431181_2431454_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168183225.1|2431501_2432071_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923634.1|2432060_2432609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126157.1|2432813_2433218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2433504_2435397_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_036780074.1|2435739_2436546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307360.1|2437637_2438567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275067.1|2440653_2441721_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_059372266.1|2442053_2442539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776625.1|2442628_2444143_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016209659.1|2444269_2445298_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_016209654.1|2445362_2446505_+	galactokinase	NA	NA	NA	NA	NA
WP_016209656.1|2446623_2448327_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209642.1|2448323_2450444_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209652.1|2450440_2451790_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209662.1|2451761_2453909_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209657.1|2454336_2454732_+	CrcB family protein	NA	NA	NA	NA	NA
WP_016209643.1|2454740_2455625_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_075273480.1|2455656_2457555_-	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209655.1|2457637_2457910_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_032126161.1|2458013_2460446_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209663.1|2460513_2461815_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|2461896_2462502_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209645.1|2462614_2463919_-	trigger factor	NA	NA	NA	NA	NA
WP_016209661.1|2464522_2465398_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_075273478.1|2465513_2466185_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209658.1|2466361_2467717_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126165.1|2467837_2468569_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032126159.1|2468654_2469368_-	aldolase	NA	NA	NA	NA	NA
WP_016209651.1|2470013_2471288_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2471318_2471894_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209649.1|2471938_2472904_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209640.1|2473362_2474382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047206.1|2476553_2477063_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	2505201	2553128	3275517	transposase,tRNA	Staphylococcus_phage(33.33%)	36	NA	NA
WP_168183189.1|2505201_2505744_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300362.1|2505740_2506265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210741.1|2506950_2507274_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_016210746.1|2507280_2511177_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_054300242.1|2511222_2511759_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210743.1|2511799_2513380_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210739.1|2513448_2514906_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_054300241.1|2515061_2517038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|2517356_2517977_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210742.1|2518142_2518418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2518568_2519543_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047208.1|2519562_2521035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2521337_2522312_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300240.1|2522611_2522815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|2523071_2523956_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036777316.1|2524265_2524679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211818.1|2525035_2526292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2526494_2526995_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211819.1|2527291_2527522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034436.1|2528130_2528295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2529646_2530708_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2530734_2531310_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2531255_2531621_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047266.1|2532336_2532768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2533875_2534762_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047210.1|2534823_2535186_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273456.1|2535145_2535445_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209398.1|2537093_2538320_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2538918_2540625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007011.1|2540792_2542013_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209395.1|2542261_2544952_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209384.1|2545243_2546059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047211.1|2546409_2547351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047212.1|2547892_2549536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209368.1|2550111_2551641_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209374.1|2551676_2553128_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 29
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	2588545	2626941	3275517	transposase,tRNA	Pseudomonas_phage(40.0%)	37	NA	NA
WP_075273327.1|2588545_2589121_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2589066_2589432_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047215.1|2590337_2591591_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_054300237.1|2591568_2592630_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210612.1|2593915_2595166_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016210605.1|2595154_2596036_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210611.1|2596028_2597114_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210607.1|2597110_2598370_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_036778813.1|2598538_2599198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210600.1|2599348_2600011_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_168183191.1|2600358_2601306_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.7	5.8e-40
WP_016210606.1|2601402_2602029_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210603.1|2602034_2602616_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2602687_2603779_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2603861_2604575_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2604668_2605373_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_168183192.1|2605695_2606757_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210612.1|2608042_2609293_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016210605.1|2609281_2610163_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210611.1|2610155_2611241_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210607.1|2611237_2612497_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_036778813.1|2612665_2613325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210600.1|2613475_2614138_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_168183191.1|2614485_2615433_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.7	5.8e-40
WP_016210606.1|2615529_2616156_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210603.1|2616161_2616743_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210601.1|2616814_2617906_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210599.1|2617988_2618702_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_122940948.1|2618795_2619500_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300148.1|2619822_2620884_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126800.1|2621008_2621743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046954.1|2621969_2622143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034437.1|2622315_2622669_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|2623631_2623877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2624176_2625062_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300223.1|2625299_2626271_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_075273327.1|2626365_2626941_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	2644356	2695302	3275517	transposase,plate,protease	Bacillus_phage(18.18%)	57	NA	NA
WP_054300221.1|2644356_2644854_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_036777003.1|2644899_2647854_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_016209901.1|2647883_2648216_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_016209923.1|2648333_2648852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209908.1|2649326_2650037_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209899.1|2650033_2651068_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_032126651.1|2651171_2651357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|2652368_2652815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212599.1|2654049_2654259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047217.1|2654308_2655370_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2655444_2656350_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_164997254.1|2656356_2656509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2657114_2657453_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2657412_2657868_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_036780649.1|2657978_2658965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126181.1|2658980_2659601_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_016210401.1|2659721_2660774_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_016210400.1|2660770_2661619_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210403.1|2661650_2662874_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210413.1|2662948_2663191_-	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210415.1|2663279_2664017_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210406.1|2664044_2664989_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210405.1|2665042_2665993_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210402.1|2665999_2667049_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210404.1|2667107_2667281_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_075273448.1|2667298_2667829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210411.1|2668070_2668712_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_016210409.1|2668874_2670704_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210408.1|2670871_2671744_+	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_155047218.1|2671735_2673904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273445.1|2674176_2674434_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_016209511.1|2674519_2675203_-	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_016209508.1|2675253_2676144_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016209527.1|2676205_2676964_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209518.1|2676966_2678235_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209505.1|2678311_2678563_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209517.1|2678596_2678944_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209507.1|2678947_2679601_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209535.1|2679623_2680088_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_036780687.1|2680084_2680852_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209539.1|2680855_2681656_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_016209498.1|2681795_2682776_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209499.1|2682781_2683339_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_168183193.1|2683271_2683898_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209538.1|2683894_2684626_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_016209519.1|2684781_2686173_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209537.1|2686197_2686509_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209512.1|2686865_2687720_+	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209502.1|2687720_2688323_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016209504.1|2688398_2689238_-	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_164997271.1|2689415_2690063_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209534.1|2690079_2690466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|2690685_2691618_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209515.1|2691722_2692238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|2692280_2693237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209524.1|2693218_2694907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126187.1|2694903_2695302_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 31
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	2726739	2774694	3275517	transposase,tRNA	Synechococcus_phage(33.33%)	51	NA	NA
WP_081007066.1|2726739_2727078_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300215.1|2727072_2727567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|2728370_2728661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047073.1|2728710_2729268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047260.1|2729460_2729619_+	phosphatase	NA	NA	NA	NA	NA
WP_016210530.1|2730459_2731140_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036776215.1|2731136_2731949_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210534.1|2732022_2735703_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_036776217.1|2735712_2737200_-	ribonuclease G	NA	NA	NA	NA	NA
WP_016210527.1|2737209_2737827_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016210528.1|2737896_2738415_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016210536.1|2738411_2739311_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2739326_2740370_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210537.1|2740559_2740847_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210532.1|2740958_2742410_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_032126195.1|2742451_2743888_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155046713.1|2744182_2744347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047072.1|2744484_2744799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2744788_2744953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2745009_2745375_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212074.1|2745401_2745623_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_142396463.1|2745709_2745826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047032.1|2745936_2746170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212075.1|2746382_2746580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779278.1|2746693_2747647_+	DMT family transporter	NA	NA	NA	NA	NA
WP_168183197.1|2747766_2748282_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300208.1|2748805_2749597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|2749726_2750038_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_155047071.1|2750385_2750709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779281.1|2750733_2751189_-	arginine repressor	NA	NA	NA	NA	NA
WP_016211489.1|2751178_2752231_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211493.1|2752233_2753697_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211491.1|2753979_2754276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210915.1|2755728_2756193_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_032126715.1|2756390_2757206_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210906.1|2757334_2759647_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_051307343.1|2759766_2760294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210909.1|2760986_2762264_+	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_036779246.1|2762266_2762521_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.4e-20
WP_016210913.1|2762554_2763076_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_032126716.1|2763246_2764230_-	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210908.1|2764320_2765136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2766347_2767409_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212580.1|2768144_2768495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2768582_2768948_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2768893_2769469_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211662.1|2770073_2771186_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_032126810.1|2771228_2771927_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211661.1|2772185_2773142_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_016211663.1|2773206_2773872_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_054300202.1|2773965_2774694_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 32
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	2788969	2890865	3275517	transposase,integrase,tRNA	Escherichia_phage(44.83%)	102	2796530:2796589	2819701:2819874
WP_155047067.1|2788969_2789863_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052104773.1|2790911_2791355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|2791462_2791729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211639.1|2791843_2792146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036781052.1|2792525_2793128_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300203.1|2794504_2794963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556455.1|2794967_2795570_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_162034407.1|2795889_2796129_+	hypothetical protein	NA	NA	NA	NA	NA
2796530:2796589	attL	GGCACTGTTGCAAAAAATTTAGATTTGAGTAGGGTGTAGCAATCAACGGAAGTTAAGAGT	NA	NA	NA	NA
WP_017375910.1|2796597_2797326_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016212268.1|2797482_2798067_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|2798070_2798754_-	Fic family protein	NA	NA	NA	NA	NA
WP_155047066.1|2798922_2799651_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.5e-43
WP_155047065.1|2800144_2800822_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.1	7.0e-40
WP_162034407.1|2801052_2801292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2802981_2803710_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211642.1|2804012_2804366_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016211646.1|2804358_2804598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211918.1|2804969_2805938_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_051307368.1|2805937_2807218_-	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_054300477.1|2807924_2808653_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_155047063.1|2809102_2809354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155082071.1|2809355_2809535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047061.1|2809679_2809946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273432.1|2810206_2810941_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_016212023.1|2810937_2811930_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_016212022.1|2812704_2812923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|2812922_2813522_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212024.1|2813518_2813767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047060.1|2813911_2814586_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.9	5.2e-27
WP_054300201.1|2814615_2815344_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212159.1|2815703_2815901_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_155047059.1|2816168_2817083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183198.1|2817191_2817920_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.9	4.7e-42
WP_016212159.1|2818279_2818477_-	antirestriction family protein	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_155047059.1|2818744_2819659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2819937_2820303_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2819701:2819874	attR	GGCACTGTTGCAAAAAATTTAGATTTGAGTAGGGTGTAGCAATCAACGGAAGTTAAGAGTGAATTGCTGTGGTAAAACGTAAACGATTTAAGAAGAATCAACCCTTTAAATGGAAGCATTATTCCGGTGAGATTATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTAT	NA	NA	NA	NA
WP_168183199.1|2820359_2820695_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168183200.1|2820651_2820825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|2822677_2823454_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212070.1|2824130_2824730_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|2824704_2824872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034404.1|2825170_2828452_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|2828526_2829255_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016212477.1|2829415_2829661_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032126794.1|2829657_2830050_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_054300501.1|2830061_2830790_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|2831150_2831927_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_168183201.1|2833294_2833474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|2833448_2834048_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|2834457_2835186_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_155046941.1|2835857_2836121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|2836522_2838262_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155047058.1|2838264_2838627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126799.1|2839688_2840501_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_054300481.1|2840581_2841310_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300506.1|2841381_2841789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779353.1|2842279_2843191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|2843458_2843755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210487.1|2843783_2844029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210475.1|2844330_2844879_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_032126625.1|2844982_2845555_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210486.1|2845762_2846521_+	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_016210484.1|2847069_2848827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210482.1|2849036_2850614_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210485.1|2850746_2851688_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210472.1|2851689_2852463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|2852504_2853197_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_155047057.1|2853433_2853850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780545.1|2854013_2854724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273615.1|2855208_2855307_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2856207_2857182_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300509.1|2857306_2857504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133265.1|2857648_2858125_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2858396_2858684_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_036777440.1|2858689_2861071_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211706.1|2861083_2862079_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_016210495.1|2862498_2862858_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016210493.1|2862900_2863095_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2863129_2863660_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_036777444.1|2863664_2865596_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	1.0e-120
WP_016210496.1|2866474_2867869_+	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_036777447.1|2867935_2868985_-	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210500.1|2869005_2870496_-	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210502.1|2870630_2871326_-	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_032126129.1|2871322_2872483_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210501.1|2872479_2873466_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_032126128.1|2873483_2874890_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_155047056.1|2875806_2876169_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2876158_2876734_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_168183202.1|2876729_2877047_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300510.1|2877189_2877372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210644.1|2877642_2877798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210649.1|2878006_2879995_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210650.1|2880072_2881257_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_054300512.1|2881362_2882472_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_129556624.1|2882803_2883790_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210645.1|2883855_2885433_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_122940481.1|2885444_2886416_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210643.1|2886551_2887121_-	elongation factor P	NA	NA	NA	NA	NA
WP_051307335.1|2887169_2888204_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_032126126.1|2888225_2889782_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_054300513.1|2890001_2890865_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	3007683	3065034	3275517	transposase,tRNA	Acinetobacter_phage(33.33%)	60	NA	NA
WP_075273298.1|3007683_3008259_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046705.1|3008204_3008372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300397.1|3008612_3008858_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212130.1|3009052_3009229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126495.1|3009263_3010148_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_016212128.1|3010238_3010985_-	solute symporter family protein	NA	NA	NA	NA	NA
WP_016210870.1|3011898_3012690_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|3012841_3013087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210861.1|3013238_3013469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778898.1|3013494_3014274_-	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_016210868.1|3014305_3014605_-	pilZ domain protein	NA	NA	NA	NA	NA
WP_032126490.1|3014601_3015567_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_129556441.1|3015915_3017142_+	MFS transporter	NA	NA	NA	NA	NA
WP_168183204.1|3020569_3021725_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.5	3.9e-54
WP_016212102.1|3023235_3024876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211029.1|3025049_3025412_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016211023.1|3025625_3026060_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211034.1|3026070_3026250_-	rubredoxin	NA	NA	NA	NA	NA
WP_032126377.1|3026366_3027368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|3027533_3028826_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_016211032.1|3028937_3029735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211031.1|3030044_3030524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047049.1|3030688_3032770_-	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_075273367.1|3032778_3033555_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|3033847_3034252_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_105962174.1|3034350_3034515_+	phosphatase	NA	NA	NA	NA	NA
WP_054300526.1|3034663_3034960_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047048.1|3035068_3035533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047047.1|3035737_3036172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211607.1|3036354_3036579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|3036607_3037138_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211605.1|3037354_3037588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126373.1|3037701_3039888_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211609.1|3039920_3040229_-	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_155047046.1|3040843_3042403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|3042811_3043697_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211899.1|3043794_3044088_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_129556440.1|3044430_3045039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211903.1|3045292_3046261_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_052104757.1|3046518_3047907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210634.1|3048015_3048747_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_036779427.1|3048743_3049280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126367.1|3049333_3050098_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210636.1|3050101_3051679_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_016210637.1|3051685_3052162_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|3052137_3052593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210633.1|3052598_3053354_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|3053528_3053816_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210640.1|3054201_3054426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779423.1|3054890_3056054_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126366.1|3056092_3057070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126365.1|3057063_3057717_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_016210630.1|3057688_3058804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300529.1|3059084_3059486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183205.1|3059657_3059966_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|3059969_3060545_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046703.1|3060548_3060686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126861.1|3060879_3061194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300533.1|3063416_3063842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|3063880_3065034_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 34
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	3069085	3126767	3275517	transposase	Staphylococcus_phage(25.0%)	49	NA	NA
WP_054300271.1|3069085_3070060_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047045.1|3070036_3070732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|3070784_3071189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211354.1|3071718_3073680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211355.1|3073777_3074887_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211357.1|3074949_3076431_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211358.1|3076854_3077316_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_054300534.1|3077363_3077564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300535.1|3077708_3078428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|3078431_3079007_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3078952_3079318_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211800.1|3080014_3080800_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_036778206.1|3080796_3081780_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211802.1|3081836_3083108_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_016210038.1|3088855_3089818_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|3090004_3091264_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|3091487_3091814_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|3092008_3092959_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|3093016_3095083_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|3095088_3096084_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|3096669_3098250_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|3098406_3099816_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|3099875_3101009_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|3101148_3101973_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|3102200_3102830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|3103166_3103538_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|3103841_3104129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|3104280_3105129_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|3105256_3106297_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_155047244.1|3106369_3108307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|3108590_3109250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3109404_3110379_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|3110454_3111474_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|3111872_3112082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|3112956_3114039_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300161.1|3114086_3115148_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|3115228_3115537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|3115651_3116968_-	MFS transporter	NA	NA	NA	NA	NA
WP_036778698.1|3117429_3118647_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|3118788_3119685_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|3119771_3120770_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|3120878_3121403_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|3121650_3122889_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_168183206.1|3123033_3123399_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273512.1|3123576_3123921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211207.1|3124115_3124259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212222.1|3124396_3124870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|3124866_3125262_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3126191_3126767_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP050938	Piscirickettsia salmonis strain Ps-2192A chromosome, complete genome	3275517	3139333	3194448	3275517	transposase,tRNA	Acinetobacter_phage(40.0%)	55	NA	NA
WP_155047248.1|3139333_3140020_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168183209.1|3140272_3140734_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168183210.1|3140717_3141377_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556605.1|3141771_3142881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212095.1|3143063_3143393_-	PLD-like domain protein	NA	A0A1B2LRT6	Wolbachia_phage	55.3	6.1e-13
WP_054300209.1|3143923_3144289_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|3144303_3144909_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|3145279_3146677_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|3146796_3147744_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|3147740_3148256_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|3148242_3149442_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|3149438_3149762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|3149763_3150993_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|3150992_3152036_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|3152035_3152719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|3152715_3155205_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|3155221_3155476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3155476_3155833_-	TrbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_032126705.1|3156618_3157776_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|3157795_3160903_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|3160904_3162410_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|3162437_3162719_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3162867_3163209_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|3163328_3165209_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_155049898.1|3165293_3166811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|3166909_3168025_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|3168152_3169151_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_052104582.1|3169154_3169913_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|3169914_3171114_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|3171097_3171769_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|3171790_3172567_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|3172570_3173569_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|3173570_3174149_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|3174145_3175615_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3175658_3175946_-	trp operon repressor	NA	NA	NA	NA	NA
WP_168183211.1|3176206_3176743_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300152.1|3176769_3177135_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|3177191_3177347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|3177491_3177944_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047251.1|3177981_3178206_+	EamA family transporter	NA	NA	NA	NA	NA
WP_155047003.1|3179801_3180687_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|3180873_3181095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047252.1|3181210_3181789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047253.1|3181933_3182128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3182186_3183161_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|3183214_3184276_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|3185003_3185543_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|3185627_3186164_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|3186815_3187118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|3187567_3187876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|3188484_3188934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|3189216_3189927_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|3190153_3190552_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_036778156.1|3191419_3192370_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|3192369_3194448_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP050939	Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p1, complete sequence	49531	21737	34941	49531	portal,transposase,head,terminase,tail,protease,capsid	Erysipelothrix_phage(25.0%)	15	NA	NA
WP_054300271.1|21737_22712_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047322.1|23046_23439_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	4.4e-26
WP_016212234.1|23515_23995_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_155047321.1|23997_25680_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.7	6.9e-137
WP_155047320.1|25676_26399_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	40.8	2.6e-40
WP_155047319.1|27760_28381_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	50.9	5.5e-39
WP_016211130.1|28343_29000_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.9	3.9e-43
WP_016211140.1|29057_30251_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_155047318.1|30371_31706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211131.1|31744_31900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|31896_32208_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|32204_32528_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|32520_32916_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_155047317.1|32995_33832_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	1.9e-42
WP_054300271.1|33966_34941_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
>prophage 1
NZ_CP050941	Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p3, complete sequence	66586	13896	48304	66586	portal,terminase,capsid,integrase,protease,tail,head,transposase	Streptococcus_phage(19.05%)	43	46921:46980	54986:55273
WP_016211080.1|13896_14883_+	helix-turn-helix domain-containing protein	NA	A0A0S2MVA0	Bacillus_phage	45.4	4.3e-14
WP_036780304.1|14923_15460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047314.1|15428_15791_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_155047315.1|15783_16131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210963.1|16127_16367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923627.1|16462_16750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047311.1|16746_17049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126916.1|17036_17507_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	48.8	1.5e-33
WP_052047121.1|17651_18053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126915.1|18231_18615_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	4.7e-25
WP_155047310.1|18701_19184_+	hypothetical protein	NA	Q9B019	Phage_GMSE-1	33.3	1.1e-13
WP_162034501.1|19451_20342_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	55.7	2.3e-83
WP_155047308.1|20361_21336_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	8.3e-26
WP_155047307.1|21379_21976_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.3	2.0e-38
WP_054300593.1|21972_23214_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	43.6	2.7e-85
WP_054300592.1|23176_23833_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.9	5.4e-45
WP_155047306.1|23888_25055_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	38.7	1.2e-66
WP_036778347.1|25090_25672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183246.1|25839_25995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274765.1|25991_26303_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_075274764.1|26299_26623_+|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_075274763.1|26615_27011_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	39.1	6.0e-07
WP_075274762.1|27007_27358_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_155047305.1|27357_27780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274761.1|27781_28105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|28161_28428_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_155047313.1|30016_30370_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155047304.1|31096_31228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|32834_33098_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_036780292.1|33403_34153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211377.1|34176_35199_-	AAA family ATPase	NA	A0A1V0DZZ0	Clostridioides_phage	27.5	3.2e-12
WP_032126388.1|35959_36985_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126623.1|37097_38330_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|38506_39481_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_027242955.1|39729_39990_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_036780061.1|39982_40336_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	35.8	1.1e-12
WP_017375910.1|40612_41341_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420837.1|41727_42660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|42801_43530_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_168183247.1|43559_45590_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_155047303.1|45961_46963_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.3e-29
46921:46980	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_081007075.1|47308_47650_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032126152.1|47713_48304_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.8	1.4e-20
54986:55273	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCG	NA	NA	NA	NA
>prophage 1
NZ_CP050945	Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p7, complete sequence	212888	2381	58176	212888	transposase,integrase	Streptococcus_phage(18.75%)	56	18642:18701	40108:41060
WP_168183281.1|2381_3110_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	2.7e-37
WP_075273804.1|3194_3533_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|3492_3948_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273806.1|4053_4617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047269.1|4878_5274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962174.1|5422_5587_-	phosphatase	NA	NA	NA	NA	NA
WP_080728342.1|5730_6234_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081007042.1|6548_7364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273810.1|9523_10231_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_105962623.1|10251_11404_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_168183282.1|12388_12835_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046709.1|13075_13276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|14364_14745_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212398.1|14911_15373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|15635_16472_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_129556717.1|16797_18024_+	hypothetical protein	NA	NA	NA	NA	NA
18642:18701	attL	CCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTA	NA	NA	NA	NA
WP_054300271.1|18678_19653_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212260.1|19810_20083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|20102_20327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|20663_20867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212255.1|20863_21034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|21220_22303_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_075273822.1|22747_23248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274741.1|23349_23607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104769.1|25976_26900_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_081377909.1|27861_28326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|28322_28622_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556706.1|28712_29342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211885.1|29355_30396_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_033923686.1|30504_31554_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|31678_32653_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212150.1|32716_33031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212151.1|33054_34017_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_105962625.1|34618_35505_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_016212121.1|35938_36862_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016212122.1|36815_37517_-	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_168183277.1|38438_38717_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168183278.1|39097_39265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047296.1|40178_40814_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	42.5	1.4e-34
WP_155047300.1|40922_41195_+	hypothetical protein	NA	NA	NA	NA	NA
40108:41060	attR	TAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGGAGTGAATTGCTGTGGGTAGACGTAAACGATTTAAGAAGAATCAACCCTTTAAATGGAAGCATTATTCCGGTGAGATCATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGCTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTCTTGGCGGTTAGATGAAACGTTGGTGAAAATCAAAGGTCGTTGGTATTACCTTTATCGAGCCATTGATAAATATGGCCATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTGTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTCACTT	NA	NA	NA	NA
WP_054300162.1|41314_42397_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155047295.1|42426_43488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047294.1|43733_44396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|44602_45331_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155047014.1|45549_45891_+	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_036780017.1|45961_46336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780014.1|46496_47939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212118.1|48292_48754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|48848_49145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183283.1|49496_49856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047293.1|50800_51526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047019.1|52015_52168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273751.1|52180_53911_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_168183284.1|54260_55413_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	3.7e-57
WP_155047292.1|56203_57121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|57198_58176_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 2
NZ_CP050945	Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p7, complete sequence	212888	64277	124422	212888	transposase,integrase	Streptococcus_phage(25.0%)	56	109506:109565	130283:131083
WP_155047289.1|64277_64454_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|64526_65504_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027242576.1|65696_67559_+	UvrD-helicase domain-containing protein	NA	A0A088C4M0	Shewanella_sp._phage	30.9	1.0e-56
WP_027242575.1|67592_68078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275154.1|70049_70706_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_016211955.1|70842_71823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|72279_73008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556703.1|73065_73554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377344.1|74667_75795_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273757.1|76034_76484_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_168183287.1|76827_78474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183288.1|78424_79228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047021.1|79330_79486_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300202.1|79509_80238_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273760.1|80660_83063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047021.1|83165_83321_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300202.1|83344_84073_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075275153.1|84317_85115_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_017375910.1|85611_86340_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377658.1|86587_87274_+	Fic family protein	NA	NA	NA	NA	NA
WP_155047286.1|87277_87844_+	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.0	1.4e-20
WP_155047299.1|87933_89292_+	DEAD/DEAH box helicase family protein	NA	D2J050	Enterococcus_phage	50.5	2.6e-126
WP_017375910.1|89475_90204_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_082300623.1|91675_91894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894761.1|91874_92021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774631.1|92383_92848_-	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_155047285.1|93981_94239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|94257_95235_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_016211890.1|95351_97928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274742.1|98888_99770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211879.1|99782_100802_-	ParA family protein	NA	NA	NA	NA	NA
WP_036780064.1|101756_102347_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.3	2.0e-22
WP_168183289.1|102592_103087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183290.1|103099_103408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047013.1|103737_103884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273826.1|104104_105232_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.9e-18
WP_155047284.1|106635_107664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183291.1|108292_109446_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	1.3e-54
109506:109565	attL	AATTGCTGTGGGTAGACGTAAACGATTTAAGAAGAATCAACCCTTTAAATGGAAGCATTA	NA	NA	NA	NA
WP_054300202.1|109512_110241_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|110338_110752_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_155047016.1|111155_111383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927838.1|111412_111658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962690.1|111654_111930_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_105962623.1|113796_114950_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273826.1|114909_116037_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.9e-18
WP_168183292.1|116233_116404_+	phosphatase	NA	NA	NA	NA	NA
WP_016212019.1|116760_117456_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_155047298.1|117842_118028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183293.1|118557_119133_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_168183294.1|119098_119335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047283.1|119523_119856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|120020_120398_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|120704_121088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377351.1|122580_123360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183295.1|123548_123734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|124044_124422_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	46.0	1.2e-17
130283:131083	attR	TAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCCAATTGGAGCTACCCAACCACTTCATAAAATCGACCCAAACCTTAAACTTAACCTTTCAACATCACATCAATTAGCCCCTGAACTCTTTCAAGAGATTTTTTATCGAGCTTATCAGCATGATTCCAGCCCCTAGCACGGAAATCTTTTGTTGTTAGTTGGTTAACCAACACTGCTCCGTGAACGCTATTGTTTTTAGGTAGCTCAACTTCAAAAGGATATCCTTTAATCTTTGAAGTAACCGGGCACCCCGTCACAAGTCCCACCTTTAAGTTATAGGGCTTGGAAGTCAACACTAAAAAGGGTCGGTTTCCTCTTTGTTCACTACCTAATGTAGGGTCTAAACTAAGAAAAATAATATCACCACGTTCAGGCACTTTATTCAAAGCGCTCCCCTCCTAATTCTTCACCCCAATCTACTAAATCATGACTATTTTCAGGGGTAATTTCTGATAATAATAATTCAAGGGTCTGCGTATGAGTCAAAGGTTTAATGTGAATCTCATCCCCGACCTTATCAATCGTCACATGACTACCATCATTGATATGAAGTTCACGTGCGATGCTCAAGGGTAGCAACAACCCCAAGCTATTCCCCCATTTTCTAACAACTGCATCCATCGTACATACTCCTAATATTGGTTATACAATGTTTAGACATAAGTATAGCACAAAATTCTTAA	NA	NA	NA	NA
>prophage 3
NZ_CP050945	Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p7, complete sequence	212888	128069	184982	212888	capsid,protease,tail,integrase,transposase,head	Streptococcus_phage(14.81%)	59	120399:120458	128448:129983
120399:120458	attL	CCAGAACAGATCATGGTTTACCTTAAACAAAAACCAGTATCATATCATCAAATCAAATTG	NA	NA	NA	NA
WP_016212154.1|128069_128447_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|128753_129137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|129606_130335_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
128448:129983	attR	CCAGAACAGATCATGGTTTACCTTAAACAAAAACCAGTATCATATCATCAAATCAAATTGCGACAGAACCAAGCAACTTACCAGCAATTTTACTTGCTCGCAGCCTAACTATGCCTGAAGAAAAGTGCTCCTCTGTGAAAATTTCAAATTGCGACAGAACCGTAAAATGTGTTGTTAAACTTTTAACTGAAACCGCCGTATGCGGCATAGCACGTATGGTGGTGATAGAGGACGGAGACCGCAAAGCCCCTCCTCCTGGATTTAATTGTTTACCATTATCGATATGACTAAGCTAACGTACATGAATTAATATGTTTCTCTTGTCACCGATGGTTTTCCAGACTCATCTCGATACACGACAAATTGACTATAAGAAGTTCCTGGGCTTTCATAAGAATGGCCAGAATCTCCACTATCAATACCTGTAGCAGTTATTTCTGATACTAAACATACGCCTCTTGACTGAGAACTCCAAGAAGCATATGACCCCACAACATAACTCTCATTACTGCACAAAGCAGAGTCATAAGTTATAGTGCCTTTTATGTCATAACCAGCGCTATTAATAATATGTACAACAGGGTAACTACTAACATTTTGATTGTTGTTCGCAGCTTGTGAAGCAATAGGAAGGCTTAAACTTAAAAAAACAAAAACCAATAATCGATTTAAATGCTTGATTTTAATCATAAAGTCTACTCTCTTTAACCTAAAAATAAATAGATCATATATTTTCTATAAACGTAAAGAATTTTAACATTTATTTTTTCCACCCTCCGTCATCTGAAGTGTAATATCGAGGCTATAAAAACTCTTGTTAAAAATTATAATCATCTTCAATCGCTAAGGGTCTGATTCCCCGCAGCTTGCTGCGAAAAAAAACAAAGCGCATTACGACCCGAAGGGGTAATTTTCCGAAATACCTCGTAGCTTGCCGCGAGGATAGGTAAATTGAGTTTTGCGCAAATTTATTTTCTTGTACTATATCGATTATTTTTACAATAAGGAAGTATATTTTTATAAAAATAGCACTCAACCAACATCTTCTGAAAGAATATCAGCAAGTTAAATAATACAGAAAAGGCAAGCTAGAGGGCACTGTTGCGAAAAATTATAGTGAACTTCAGAAAGGTTATTTTCTTGTGCTCTCTGCTTAGAATTAAGCAGCTAATCCAAATAATTTATCAATGAGCTGATTTTGGGCACAGATATTCTGTTTTTTAATATAACGTAATTGACCTTTTTGAACCATGCGCATCGCTTCCATTATGTCAATGGTAGGCCGTGCTGTAGAAAGTGATTGGTACCATTGGCGGAAACGGGATTTGCGCTTTACCGCTTTGTGATCATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGACACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCAT	NA	NA	NA	NA
WP_036781349.1|130450_130777_-	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_016212365.1|130778_131021_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_075274745.1|131733_132462_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_052047129.1|132744_134328_+	protein kinase	NA	NA	NA	NA	NA
WP_016212311.1|134448_135180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|135333_136068_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_016212404.1|136844_137078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273881.1|137198_139385_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_036779532.1|139394_139796_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|139792_140080_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_016212579.1|141700_141898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047246.1|143394_144369_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.0	1.9e-25
WP_075274748.1|144509_144710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183303.1|144975_145356_+|transposase	transposase family protein	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	70.8	3.6e-33
WP_016212061.1|145479_147522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|148426_148792_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|148737_149313_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075274752.1|149309_149609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047018.1|149644_150448_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_155047281.1|150515_150845_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.8	5.5e-06
WP_052104629.1|151071_152097_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_052047135.1|152277_153090_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.0	4.9e-56
WP_032126637.1|153172_153466_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075273747.1|153528_154119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|154380_154881_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|154880_155042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162034469.1|156781_157162_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211936.1|157651_158674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047277.1|159408_160017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168183304.1|160081_160831_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556718.1|161428_162615_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155047276.1|162643_163423_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	31.7	1.8e-18
WP_052047108.1|163973_164372_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|164505_164796_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_016210655.1|164809_165406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210656.1|165572_165728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210663.1|165724_166036_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210667.1|166032_166356_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|166348_166744_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|166740_167091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|167090_167513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|167810_168716_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_129556697.1|169100_169493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211776.1|169975_171313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|171480_171849_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211773.1|171950_172625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|173211_173946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211895.1|174068_175127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|175635_176382_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211897.1|176382_176787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|177180_177996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|178626_179512_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_155047273.1|179651_179789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047272.1|181309_182038_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_016212298.1|183938_184265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|184505_184982_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
>prophage 1
NZ_CP050946	Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p8, complete sequence	35950	14192	24529	35950	transposase,tail	Moraxella_phage(33.33%)	12	NA	NA
WP_054300271.1|14192_15167_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155047336.1|15163_15448_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047337.1|15466_15829_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211141.1|15828_16251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275196.1|16252_16576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211142.1|16632_16899_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075275195.1|16902_18981_+	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.4	2.5e-56
WP_036776958.1|18973_19315_+|tail	phage minor tail family protein	tail	NA	NA	NA	NA
WP_016210666.1|19311_19983_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|19951_20698_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_054300696.1|20687_21245_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_075275194.1|21241_24529_+	host specificity protein J	NA	A0A0R6PIC0	Moraxella_phage	33.2	5.2e-112
