The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050916	Acinetobacter baumannii strain DT-Ab003 chromosome, complete genome	4015142	1163818	1178615	4015142		Acinetobacter_phage(100.0%)	10	NA	NA
WP_001187844.1|1163818_1164367_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
WP_000893683.1|1164629_1166129_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
WP_001076817.1|1166130_1168506_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
WP_001164226.1|1168512_1169496_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
WP_000066126.1|1169506_1170202_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_000608304.1|1170211_1171018_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
WP_001982145.1|1171027_1172077_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000281127.1|1172432_1175165_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
WP_000960548.1|1175244_1177944_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
WP_000566784.1|1178039_1178615_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
>prophage 2
NZ_CP050916	Acinetobacter baumannii strain DT-Ab003 chromosome, complete genome	4015142	1282141	1322655	4015142	capsid,plate,integrase	Acinetobacter_phage(94.74%)	60	1282123:1282139	1323918:1323934
1282123:1282139	attL	CACCAAATCTACACCAA	NA	NA	NA	NA
WP_000775332.1|1282141_1283161_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	43.1	3.2e-68
WP_000512308.1|1283157_1283448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000927773.1|1283448_1283718_-	hypothetical protein	NA	A0A172Q0P4	Acinetobacter_phage	57.3	3.9e-18
WP_001094953.1|1283719_1284220_-	N-6-adenine-methyltransferase	NA	A0A0C5AN16	Bacteriophage	62.0	1.5e-47
WP_000132376.1|1284216_1284654_-	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	84.5	7.0e-33
WP_000132012.1|1284658_1285027_-	hypothetical protein	NA	A0A1B1P9I4	Acinetobacter_phage	96.7	2.2e-64
WP_001057139.1|1285037_1285916_-	AAA family ATPase	NA	A0A1B1P9H8	Acinetobacter_phage	97.9	1.2e-145
WP_000505394.1|1285918_1286233_-	hypothetical protein	NA	A0A1B1P9H1	Acinetobacter_phage	94.2	1.2e-53
WP_001056649.1|1286240_1286450_-	hypothetical protein	NA	A0A1B1P9G5	Acinetobacter_phage	95.7	3.8e-29
WP_000371053.1|1286514_1287279_-	hypothetical protein	NA	I2GUJ1	Acinetobacter_phage	66.2	6.4e-90
WP_001058895.1|1287271_1287535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076126.1|1287534_1287726_-	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	68.2	1.1e-14
WP_001129670.1|1287932_1288436_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	82.6	1.2e-65
WP_000048049.1|1288438_1289440_-	hypothetical protein	NA	A0A0P0IRH5	Acinetobacter_phage	100.0	4.2e-182
WP_001065785.1|1289490_1289706_-	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	98.6	1.6e-30
WP_000357169.1|1289726_1290401_-	helix-turn-helix domain-containing protein	NA	A0A0P0IYD9	Acinetobacter_phage	96.9	5.8e-119
WP_001077693.1|1290502_1290703_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	100.0	3.5e-32
WP_000048916.1|1290713_1291034_+	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_001095608.1|1291089_1291380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033653.1|1291376_1292423_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	1.7e-109
WP_001110396.1|1292419_1293370_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	64.2	2.9e-100
WP_000544510.1|1293362_1294112_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	100.0	9.6e-139
WP_000647820.1|1294108_1294531_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	100.0	2.9e-76
WP_002018225.1|1294580_1294943_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
WP_001288422.1|1294935_1295160_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
WP_000100185.1|1295159_1295555_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	100.0	1.6e-68
WP_000783470.1|1295551_1296052_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	3.1e-93
WP_002001437.1|1296247_1296898_+	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	99.5	2.1e-94
WP_000715269.1|1297159_1297918_+	hypothetical protein	NA	A0A0P0J0C5	Acinetobacter_phage	100.0	2.9e-143
WP_000787534.1|1298012_1298660_+	hypothetical protein	NA	A0A0N7IRF1	Acinetobacter_phage	100.0	5.0e-128
WP_000113271.1|1298707_1299217_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	100.0	1.2e-89
WP_000220360.1|1299213_1300872_+	hypothetical protein	NA	A0A0P0IVT4	Acinetobacter_phage	100.0	0.0e+00
WP_000522918.1|1300882_1302295_+	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	100.0	4.6e-259
WP_000635838.1|1302317_1302953_+|capsid	minor capsid protein	capsid	A0A0P0IKX5	Acinetobacter_phage	100.0	7.1e-119
WP_000473611.1|1303241_1304558_+	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	100.0	3.5e-213
WP_000525986.1|1304561_1305038_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	100.0	3.0e-85
WP_000040568.1|1305102_1306128_+	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	100.0	1.7e-194
WP_000041170.1|1306137_1306569_+	hypothetical protein	NA	A0A0P0IYA6	Acinetobacter_phage	100.0	8.1e-58
WP_000622625.1|1306572_1306959_+	DUF4054 domain-containing protein	NA	A0A0P0IKR4	Acinetobacter_phage	100.0	2.3e-67
WP_000094499.1|1306955_1307516_+	hypothetical protein	NA	A0A0P0J0D1	Acinetobacter_phage	100.0	5.2e-97
WP_071211248.1|1307502_1307871_+	hypothetical protein	NA	A0A0P0HSK8	Acinetobacter_phage	99.2	1.1e-63
WP_000502801.1|1307873_1308413_+	hypothetical protein	NA	A0A0P0IVT9	Acinetobacter_phage	100.0	3.3e-101
WP_000174797.1|1308416_1309892_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	100.0	3.7e-275
WP_000109247.1|1309906_1310350_+	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	99.3	9.5e-78
WP_001165481.1|1310349_1310814_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	66.2	4.2e-52
WP_001285939.1|1311009_1313034_+	hypothetical protein	NA	A0A0P0IE11	Acinetobacter_phage	99.1	0.0e+00
WP_000821708.1|1313030_1313387_-	DUF1311 domain-containing protein	NA	A0A0P0IRF2	Acinetobacter_phage	99.2	1.3e-61
WP_001051325.1|1313386_1313614_-	hypothetical protein	NA	A0A0P0I8G2	Acinetobacter_phage	100.0	1.5e-31
WP_001018608.1|1313973_1314570_+	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	100.0	7.9e-104
WP_001240305.1|1314572_1314869_+	hypothetical protein	NA	A0A0P0J0D9	Acinetobacter_phage	90.8	3.7e-46
WP_000003733.1|1314865_1315825_+	hypothetical protein	NA	A0A0P0HSL6	Acinetobacter_phage	99.1	2.2e-180
WP_001218526.1|1315827_1316490_+	hypothetical protein	NA	A0A0N7IRF4	Acinetobacter_phage	99.5	2.0e-127
WP_001270575.1|1316524_1316878_+	hypothetical protein	NA	A0A0P0IVU6	Acinetobacter_phage	99.1	6.9e-63
WP_001229407.1|1316880_1318065_+|plate	baseplate J/gp47 family protein	plate	A0A0P0I499	Acinetobacter_phage	99.7	3.5e-220
WP_001192560.1|1318064_1318655_+	DUF2612 domain-containing protein	NA	A0A0P0IKZ0	Acinetobacter_phage	92.9	3.5e-104
WP_000359221.1|1318647_1319256_+	hypothetical protein	NA	A0A0P0IE19	Acinetobacter_phage	98.5	2.6e-110
WP_168177855.1|1319319_1321374_+	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	95.5	0.0e+00
WP_001104855.1|1321375_1321603_+	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	96.0	5.6e-34
WP_000433900.1|1321680_1322070_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	100.0	1.1e-66
WP_001019738.1|1322112_1322655_+	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	92.2	1.6e-95
1323918:1323934	attR	CACCAAATCTACACCAA	NA	NA	NA	NA
>prophage 3
NZ_CP050916	Acinetobacter baumannii strain DT-Ab003 chromosome, complete genome	4015142	1383609	1404453	4015142	transposase	Escherichia_phage(33.33%)	19	NA	NA
WP_001067855.1|1383609_1384314_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|1384567_1385383_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|1385495_1386200_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014454105.1|1387229_1387784_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_002075262.1|1387876_1388509_+	type B-3 chloramphenicol O-acetyltransferase CatB8	NA	A0A2R8FE91	Brazilian_cedratvirus	40.1	3.5e-25
WP_001206316.1|1388566_1389358_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|1389521_1389869_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|1389862_1390702_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000050481.1|1391106_1392648_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000359986.1|1394046_1394820_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|1394800_1395082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026779.1|1395301_1395487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001451.1|1395535_1396720_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_000052512.1|1397118_1398594_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|1398649_1399534_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000753551.1|1400177_1401737_-|transposase	IS66-like element ISAba24 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	4.0e-70
WP_000781558.1|1401829_1402186_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.9	1.6e-22
WP_000555098.1|1402188_1402473_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|1403748_1404453_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 4
NZ_CP050916	Acinetobacter baumannii strain DT-Ab003 chromosome, complete genome	4015142	2437602	2508340	4015142	plate,transposase	uncultured_Caudovirales_phage(25.0%)	58	NA	NA
WP_085940413.1|2437602_2438692_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000342966.1|2438867_2439155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001007559.1|2439581_2440241_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_085916980.1|2440558_2441014_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000204295.1|2441093_2442251_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000813815.1|2442384_2443563_-	cyanate transporter	NA	NA	NA	NA	NA
WP_000646729.1|2443562_2444045_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	40.6	8.3e-19
WP_085916981.1|2444060_2444708_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000460184.1|2444880_2445732_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000972583.1|2445734_2446688_-	M15 family metallopeptidase	NA	A0A0H4TGB9	Bacillus_phage	33.3	2.8e-10
WP_000046451.1|2446695_2447298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000083625.1|2447310_2448117_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000471445.1|2448134_2449499_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000020713.1|2449515_2450610_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002001416.1|2450633_2453315_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.8	1.3e-81
WP_000168112.1|2453534_2453798_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001072410.1|2453814_2454582_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000557241.1|2454584_2455544_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_000556914.1|2455581_2459406_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000591882.1|2459436_2460849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001190395.1|2460845_2461844_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000568832.1|2461807_2463619_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001047031.1|2463635_2464112_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000653195.1|2464191_2464695_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001066523.1|2464744_2466226_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001119042.1|2466218_2466722_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000869709.1|2466738_2467431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070792.1|2468519_2468921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542525.1|2469016_2469961_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001000091.1|2469960_2470842_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	1.1e-37
WP_000591252.1|2470893_2471916_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000916831.1|2471912_2473724_-	allophanate hydrolase	NA	NA	NA	NA	NA
WP_001118704.1|2473736_2474171_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001000631.1|2474175_2474301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000821714.1|2474472_2475012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038350232.1|2475545_2476082_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000475274.1|2476120_2479726_-	urea carboxylase	NA	NA	NA	NA	NA
WP_000217385.1|2479728_2480382_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_001090541.1|2480397_2481138_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_001202390.1|2481451_2482615_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.7	5.3e-11
WP_000921216.1|2482867_2483299_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_001133095.1|2483358_2483919_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001117238.1|2484596_2484899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000414792.1|2485095_2485446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465125.1|2485579_2486488_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000698627.1|2486597_2487818_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	29.7	1.2e-32
WP_001090993.1|2488119_2489838_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001211799.1|2489837_2491421_-	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_000276191.1|2491453_2492260_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_000496072.1|2492271_2493036_-	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_001989322.1|2493070_2494324_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_001049897.1|2494668_2495580_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014462757.1|2495863_2496172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001010300.1|2496612_2497143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015582.1|2497159_2502067_-	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	52.4	9.3e-49
WP_000934999.1|2502076_2505253_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	64.1	9.7e-257
WP_001989630.1|2505875_2507120_+	serine hydrolase	NA	NA	NA	NA	NA
WP_085940413.1|2507249_2508340_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP050916	Acinetobacter baumannii strain DT-Ab003 chromosome, complete genome	4015142	2585660	2641539	4015142	tRNA,integrase,transposase	Escherichia_phage(28.57%)	53	2629923:2629982	2641543:2642365
WP_002000926.1|2585660_2586401_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_000912930.1|2586571_2587198_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000703552.1|2587208_2587988_-	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_000026482.1|2588074_2589490_-	OmpA family protein	NA	NA	NA	NA	NA
WP_001987632.1|2589703_2590948_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_000546639.1|2590951_2591968_-	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_000654268.1|2592091_2592436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000498918.1|2592653_2594879_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_001060738.1|2594904_2595321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000941316.1|2595589_2596078_+	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
WP_001210050.1|2596134_2598714_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
WP_001237344.1|2599015_2599822_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	35.9	9.0e-18
WP_001026230.1|2599818_2600244_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001195082.1|2600335_2600758_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000203219.1|2601196_2601862_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_085940413.1|2601918_2603008_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001159802.1|2603253_2604303_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_001034598.1|2604362_2605142_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000776215.1|2605258_2605576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517792.1|2605698_2607018_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
WP_000155680.1|2607082_2608249_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_001188823.1|2608524_2609550_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000199457.1|2609819_2612456_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
WP_001185176.1|2612521_2613802_+	aspartate kinase	NA	NA	NA	NA	NA
WP_000906487.1|2614048_2614303_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_000495836.1|2614372_2614939_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
WP_000735756.1|2615004_2615394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111760.1|2615632_2616190_+	cytochrome b	NA	NA	NA	NA	NA
WP_001077405.1|2616233_2617232_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000729980.1|2617343_2618663_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
WP_002001404.1|2618985_2619183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256760.1|2619581_2621132_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000599996.1|2621155_2621986_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000226456.1|2622051_2623014_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000459997.1|2623524_2624247_+	pirin family protein	NA	NA	NA	NA	NA
WP_000107496.1|2624311_2624935_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000626177.1|2625459_2626419_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000600025.1|2626481_2627315_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001067855.1|2628147_2628852_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
2629923:2629982	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|2629985_2630690_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376623.1|2631329_2631830_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|2631957_2632797_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2632790_2633138_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|2633301_2634093_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001102919.1|2634505_2635018_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_168177452.1|2635043_2635703_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002089484.1|2635674_2636139_-	aminoglycoside N-acetyltransferase AAC(3)-Ia	NA	NA	NA	NA	NA
WP_002075255.1|2636309_2637323_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_000454193.1|2637525_2637876_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|2638585_2639290_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|2639419_2640235_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_000902128.1|2640388_2640568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|2640834_2641539_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
2641543:2642365	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCAGTCCGAGAACATGCTTTCCATGGTCTCTGAGCTCGCCTTTGGGACCGACATATCGGTAGAGAGTGACGCGCTCGATGCCGAGTTCCTTGCAGAGATCGGAAACTGAAGTATCGCGCTGGGCCATGGCGGCTTGCGCGAGACGCACCTGAGCTTTGGTGAGCGCGAATTTTCGTCCGCCCTTGCGACCGCGCGCTCTCGCGGAGGCGAGACCCGCCATGGTGCGCTCTCGGATCAGATCCCGCTCGAACTCGGCCAAGGTGGCGAAGATTCCGAACACCATGCGACCGGACGCAGTCGTGGTGTCGATCTGAGCGCCCTTTCCAGTCAGAACCCGCAGGCCGATCTTGCGGTCTGACAGCTCCTTCACCGTGTTGACCAGATGGGCAAGCGATCGTCCGAGGCGATCGAGCTTCCAGACCACCAGCACATCGCCGTCACGCAATGACTTGAGGCAGGCAGTCAAGCCAGGGCGATCATCACGACCGCCGGAAGCAAGATCATCATAGATATTGTCCCGTTCGACACCTGCGGCGCGCAAGGCGTCGTGCTGCAGGTCGAGAGACTGCGAGCCATCGGCTTTGGAGACGCGGGCATATCCGATCAGCATGTATCACAAACGTTGGTTTGAGGCGGCGCTTCGGCCACGATTGCATTGACCTCTGGAAATGTATCTCAACCAGCTTCGGGGTTCAAGGTCCAATGATGTAAAAAACCACGCTAAGAGGTTAATTCATTGTTTGTATTGAAATTTAATGGTCTTAA	NA	NA	NA	NA
>prophage 6
NZ_CP050916	Acinetobacter baumannii strain DT-Ab003 chromosome, complete genome	4015142	2716027	2748063	4015142	terminase,integrase,tail,capsid,portal,head,protease	Acinetobacter_phage(43.33%)	46	2715814:2715867	2751900:2751953
2715814:2715867	attL	ACCTTGAACTTTAGGGTTCAAGGGTAACGACATGCAGCGGCATCTTCGGAGCAT	NA	NA	NA	NA
WP_000115731.1|2716027_2717392_+|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	42.7	2.9e-85
WP_001186629.1|2717375_2717570_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	54.1	2.7e-13
WP_002018743.1|2717664_2717835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265243.1|2717803_2718172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000095892.1|2718171_2718681_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	57.4	3.8e-46
WP_000774828.1|2718664_2718931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104854.1|2719005_2719230_-	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	95.9	1.6e-33
WP_168177858.1|2719231_2721268_-	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	94.7	0.0e+00
WP_000078482.1|2721321_2724156_-	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	36.1	4.9e-167
WP_001026372.1|2724106_2724502_-	hypothetical protein	NA	A0A1B1P9H4	Acinetobacter_phage	52.8	1.6e-28
WP_000587324.1|2724498_2725008_-	DUF1833 family protein	NA	NA	NA	NA	NA
WP_000882463.1|2725010_2725472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030423549.1|2725487_2729081_-	transglycosylase SLT domain-containing protein	NA	A0A0U4JEA4	Pseudomonas_phage	39.9	3.0e-44
WP_001031955.1|2729143_2729476_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	43.1	1.1e-14
WP_000498808.1|2729552_2729768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001074127.1|2729803_2730319_-|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_001062223.1|2730320_2730797_-	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	66.2	6.4e-56
WP_000598741.1|2730868_2731243_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	44.5	1.7e-19
WP_000235306.1|2731242_2731728_-	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	45.3	6.4e-27
WP_001139340.1|2731731_2732088_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	50.0	1.9e-20
WP_000631202.1|2732089_2732377_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	46.5	2.5e-18
WP_000666093.1|2732373_2732550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137059.1|2732597_2733770_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	47.2	9.2e-88
WP_000375469.1|2733762_2734425_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	62.3	6.2e-73
WP_000108390.1|2734417_2735644_-|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.9	3.9e-182
WP_000125540.1|2735640_2737335_-|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	82.6	2.2e-271
WP_001191044.1|2737506_2737698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001219090.1|2737717_2738200_-|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	48.4	5.9e-25
WP_000202128.1|2738346_2738571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776297.1|2738615_2738915_-	HNH endonuclease	NA	A0A0R6PH58	Moraxella_phage	61.2	1.1e-21
WP_001079329.1|2738844_2739138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063945.1|2739143_2739326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433065.1|2739315_2739846_-	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.0	4.4e-37
WP_000856318.1|2739861_2740260_-	hypothetical protein	NA	T1S9H7	Salmonella_phage	38.0	4.8e-12
WP_000238616.1|2740335_2740554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000780217.1|2741263_2741539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060708.1|2741918_2742416_-	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	34.2	1.4e-16
WP_001003589.1|2742415_2742586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000360556.1|2742582_2742963_-	hypothetical protein	NA	A0A0D4DBZ8	Acinetobacter_phage	44.4	3.0e-16
WP_001288609.1|2742964_2743249_-	hypothetical protein	NA	A0A1B1P9J7	Acinetobacter_phage	63.8	3.5e-33
WP_095374904.1|2743241_2743604_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	99.2	6.6e-69
WP_000801891.1|2743653_2743998_-	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	75.2	8.0e-40
WP_000180364.1|2744269_2745682_-	replicative DNA helicase	NA	I2GUI4	Acinetobacter_phage	41.6	6.5e-80
WP_000543838.1|2745678_2746749_-	DUF1376 domain-containing protein	NA	A9YWY6	Burkholderia_phage	44.5	5.4e-34
WP_001005282.1|2746748_2747045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000418954.1|2747406_2748063_+	helix-turn-helix domain-containing protein	NA	A0A0R6PJ00	Moraxella_phage	36.9	1.2e-31
2751900:2751953	attR	ACCTTGAACTTTAGGGTTCAAGGGTAACGACATGCAGCGGCATCTTCGGAGCAT	NA	NA	NA	NA
>prophage 7
NZ_CP050916	Acinetobacter baumannii strain DT-Ab003 chromosome, complete genome	4015142	2759094	2787768	4015142	capsid,terminase	Acinetobacter_phage(93.55%)	38	NA	NA
WP_001019739.1|2759094_2759640_-	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
WP_000433907.1|2759681_2760071_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_000598554.1|2760138_2763564_-	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
WP_000835160.1|2763556_2763919_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_000368388.1|2763915_2764422_-	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000277448.1|2764421_2764820_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000721057.1|2764912_2765500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046573.1|2765590_2769901_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
WP_001275792.1|2770028_2770292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721572.1|2770293_2770974_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_000274931.1|2771078_2771537_-	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000335868.1|2771545_2771845_-	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_001185585.1|2772347_2772863_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000094278.1|2772932_2773850_-	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_000002408.1|2773902_2775081_-	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
WP_000064593.1|2775080_2775434_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000749909.1|2775530_2776052_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_001277696.1|2776160_2776379_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_001984404.1|2776380_2776824_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	94.6	2.0e-75
WP_000539749.1|2776780_2777149_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
WP_000248411.1|2777120_2777531_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
WP_000235282.1|2777582_2777876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000540685.1|2777883_2778081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000524257.1|2778149_2778518_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
WP_000008459.1|2778518_2778899_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
WP_000524488.1|2778902_2779238_-	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
WP_000852265.1|2779282_2780233_-	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
WP_000056390.1|2780246_2781038_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
WP_000589038.1|2781124_2781439_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
WP_001291451.1|2781490_2781643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004550.1|2781658_2781889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000146970.1|2781885_2782992_-|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
WP_000301495.1|2783001_2784342_-	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
WP_001132930.1|2784381_2785674_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
WP_000729387.1|2785633_2786149_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_000435230.1|2786207_2786849_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
WP_000378523.1|2786817_2787252_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
WP_001136773.1|2787312_2787768_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
>prophage 8
NZ_CP050916	Acinetobacter baumannii strain DT-Ab003 chromosome, complete genome	4015142	2791726	2804074	4015142		Acinetobacter_phage(95.45%)	23	NA	NA
WP_001277128.1|2791726_2792203_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
WP_000100162.1|2792199_2792601_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
WP_000462878.1|2792600_2792993_-	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
WP_000647826.1|2792985_2793324_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
WP_001003671.1|2793320_2794121_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
WP_000064627.1|2794123_2795005_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
WP_000602535.1|2794997_2795222_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
WP_001180660.1|2795293_2795566_-	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.0	7.2e-36
WP_000048916.1|2795627_2795948_-	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_000703023.1|2795958_2796147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052252.1|2796251_2797004_+	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
WP_000370485.1|2797018_2797234_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000048052.1|2797285_2798293_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_001129676.1|2798294_2798798_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000845537.1|2798936_2799140_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_000051960.1|2799146_2799389_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_001101038.1|2799582_2800026_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000656405.1|2800025_2800316_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
WP_000064463.1|2800308_2800632_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
WP_000698529.1|2801761_2802694_+	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
WP_000654846.1|2802695_2802947_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
WP_000147323.1|2802947_2803355_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000004579.1|2803351_2804074_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
>prophage 9
NZ_CP050916	Acinetobacter baumannii strain DT-Ab003 chromosome, complete genome	4015142	3038694	3051478	4015142		Acinetobacter_phage(53.85%)	19	NA	NA
WP_001136753.1|3038694_3039150_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
WP_000990950.1|3039605_3040139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000994866.1|3040135_3040900_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	6.7e-63
WP_000124473.1|3040896_3041940_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
WP_002052057.1|3042016_3043087_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	59.6	4.6e-110
WP_002018225.1|3043158_3043521_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
WP_032015776.1|3043570_3043993_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	99.3	5.0e-76
WP_001031749.1|3043979_3044114_-	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
WP_023897136.1|3044110_3044860_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	99.6	6.2e-138
WP_001110396.1|3044852_3045803_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	64.2	2.9e-100
WP_020752534.1|3045799_3046846_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	4.5e-110
WP_020752533.1|3046842_3048513_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	45.9	1.8e-153
WP_001205618.1|3048518_3049157_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	46.2	1.1e-47
WP_000575725.1|3049153_3049609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200037.1|3049605_3049791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290738.1|3049787_3049988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818521.1|3050021_3050396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335919.1|3050428_3050662_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000550612.1|3050788_3051478_+	helix-turn-helix domain-containing protein	NA	A0A0R6PCY1	Moraxella_phage	37.1	5.0e-25
>prophage 1
NZ_CP050917	Acinetobacter baumannii strain DT-Ab003 plasmid unnamed1, complete sequence	71194	8710	16298	71194		Alteromonadaceae_phage(14.29%)	9	NA	NA
WP_000389917.1|8710_9400_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	30.9	3.4e-13
WP_000072937.1|9404_9641_+	hypothetical protein	NA	A0A2H4J8L3	uncultured_Caudovirales_phage	43.1	2.2e-09
WP_000535991.1|9646_9853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166686228.1|10366_11458_+	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	32.2	1.1e-15
WP_000844619.1|11515_12289_+	hypothetical protein	NA	A0A2K9VK66	Klebsiella_phage	44.5	1.3e-53
WP_001067227.1|12769_13267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086346.1|13295_14072_+	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	34.3	7.6e-22
WP_000724905.1|14264_15038_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.8e-08
WP_166686227.1|15041_16298_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	28.2	9.5e-06
