The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048837	[Clostridium] innocuum strain LC-LUMC-CI-001 chromosome, complete genome	4289702	16609	79826	4289702	transposase,protease,tRNA	Paenibacillus_phage(26.67%)	58	NA	NA
WP_167871276.1|16609_17314_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	42.5	1.6e-39
WP_167871277.1|17490_18252_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	48.9	3.2e-49
WP_021421091.1|18521_19592_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_021421090.1|19610_20333_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021421089.1|20335_21046_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021421088.1|21102_21936_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_021421087.1|22003_22831_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_021421086.1|22820_23597_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_036745434.1|23621_24092_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_036745432.1|24112_24526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021421084.1|24670_25342_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_021421083.1|25408_26443_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_167871278.1|26759_27464_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	42.9	1.2e-39
WP_167871279.1|27640_28402_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	48.9	8.4e-50
WP_035303967.1|29349_29601_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_009270083.1|29597_30155_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_008816032.1|30214_30988_+	NAD kinase	NA	NA	NA	NA	NA
WP_009270084.1|31255_32476_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_021420135.1|32700_35232_+	DNA mismatch repair protein MutS	NA	A0A2P0VN50	Tetraselmis_virus	25.6	3.7e-41
WP_021420136.1|35292_37380_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	37.4	8.2e-55
WP_008816028.1|37512_38424_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_009588980.1|38425_39166_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_009589002.1|39155_39935_+	nitroreductase	NA	NA	NA	NA	NA
WP_008816026.1|39973_40819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008816025.1|41138_41477_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009270089.1|41454_42015_+	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_002606703.1|42196_42847_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_008816023.1|43583_44216_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	47.5	4.1e-50
WP_008816022.1|44208_45186_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_008816021.1|45182_46253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002606707.1|46262_47120_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	46.2	5.0e-59
WP_021420139.1|47229_47925_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008816019.1|47989_48670_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.9	7.8e-47
WP_021420140.1|48653_50297_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.7	3.2e-30
WP_021420142.1|50695_53041_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	42.5	6.6e-162
WP_021420143.1|53033_53582_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0A8WJI9	Clostridium_phage	44.2	8.8e-33
WP_021420144.1|54063_54552_+	helix-turn-helix transcriptional regulator	NA	Q38607	Lactococcus_phage	39.7	1.3e-06
WP_036744980.1|54553_54805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021420146.1|54962_55406_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_008816012.1|55409_56447_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002606723.1|56467_56782_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_021420147.1|56796_59439_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_008816008.1|59773_61717_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_008816007.1|61781_62150_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_008816006.1|62247_64023_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	4.4e-57
WP_009270095.1|64854_65622_+	nucleoside/nucleotide kinase family protein	NA	NA	NA	NA	NA
WP_009270096.1|65575_66340_-	YwaF family protein	NA	NA	NA	NA	NA
WP_009270097.1|66667_67609_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_008818051.1|67620_68469_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_009270098.1|68465_69728_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_008818053.1|69728_70745_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_009270099.1|70789_71887_-	chorismate synthase	NA	NA	NA	NA	NA
WP_002606736.1|71883_72897_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	33.2	1.3e-29
WP_002606737.1|73354_74440_+	chorismate mutase	NA	NA	NA	NA	NA
WP_008818055.1|74442_75678_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_008818056.1|76281_77205_+	DUF1848 domain-containing protein	NA	NA	NA	NA	NA
WP_009588965.1|77582_77933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021420154.1|78380_79826_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP048837	[Clostridium] innocuum strain LC-LUMC-CI-001 chromosome, complete genome	4289702	902725	913017	4289702		Streptococcus_phage(62.5%)	9	NA	NA
WP_002323345.1|902725_903229_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	60.8	7.5e-55
WP_021419667.1|903403_904069_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.4	2.3e-19
WP_021419666.1|904157_905072_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.1	5.2e-38
WP_021419665.1|905064_905832_+	ABC-2 transporter family protein	NA	NA	NA	NA	NA
WP_079747650.1|905866_906739_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.3	5.2e-11
WP_003061368.1|906973_907372_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	73.0	4.1e-48
WP_021419663.1|907349_909800_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.3	0.0e+00
WP_131040423.1|909799_912013_+	YtxH domain-containing protein	NA	A0A1S5SF30	Streptococcus_phage	60.8	1.9e-190
WP_002606089.1|912009_913017_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	70.5	7.8e-136
>prophage 3
NZ_CP048837	[Clostridium] innocuum strain LC-LUMC-CI-001 chromosome, complete genome	4289702	929265	937021	4289702		Staphylococcus_phage(50.0%)	8	NA	NA
WP_008690020.1|929265_930366_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	37.8	4.3e-47
WP_008394622.1|930350_930986_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	46.0	9.9e-44
WP_008394621.1|931005_932211_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.7	1.4e-102
WP_008394619.1|932211_932679_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.0	8.3e-40
WP_021419907.1|933087_934302_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	54.8	9.4e-128
WP_008787514.1|934807_934996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008394616.1|935086_935296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008394611.1|935407_937021_+	DUF4368 domain-containing protein	NA	W8CYE4	Bacillus_phage	25.1	1.1e-22
>prophage 4
NZ_CP048837	[Clostridium] innocuum strain LC-LUMC-CI-001 chromosome, complete genome	4289702	2777135	2887081	4289702	transposase,integrase,head,portal,holin,capsid,tail,protease,terminase	Erysipelothrix_phage(40.48%)	100	2771459:2771482	2784175:2784198
2771459:2771482	attL	AAATGGTGGTCCCGGTCGGAATCG	NA	NA	NA	NA
WP_008817704.1|2777135_2777594_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_008817706.1|2777784_2778216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008817707.1|2778234_2778861_-	hypothetical protein	NA	A0A0X8WPC5	Ralstonia_phage	50.0	6.2e-06
WP_008817708.1|2778878_2779520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148558595.1|2779531_2780896_-	dockerin	NA	NA	NA	NA	NA
WP_008817711.1|2782888_2783995_-|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	30.6	4.4e-31
WP_009270750.1|2785011_2785371_-	hypothetical protein	NA	NA	NA	NA	NA
2784175:2784198	attR	AAATGGTGGTCCCGGTCGGAATCG	NA	NA	NA	NA
WP_009588252.1|2785694_2785886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008817713.1|2785882_2787235_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_008817714.1|2787355_2788018_-	V-type ATP synthase subunit D	NA	NA	NA	NA	NA
WP_008817715.1|2788020_2789463_-	V-type ATP synthase subunit B	NA	NA	NA	NA	NA
WP_008817716.1|2789475_2791227_-	V-type ATP synthase subunit A	NA	NA	NA	NA	NA
WP_009270752.1|2791261_2791858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008817718.1|2791868_2792177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002609959.1|2792195_2792639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008817719.1|2792653_2794576_-	V-type ATP synthase subunit I	NA	NA	NA	NA	NA
WP_008817720.1|2794590_2795637_-	V-type ATPase subunit	NA	NA	NA	NA	NA
WP_008817721.1|2795676_2795988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008817722.1|2796785_2798042_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_021420042.1|2798456_2799410_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	23.7	2.4e-09
WP_008817724.1|2799618_2801964_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_008817725.1|2802272_2802527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002609938.1|2802771_2803962_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_002609936.1|2804010_2804727_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_008817726.1|2804868_2805570_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_008817727.1|2805570_2806215_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_079747663.1|2806458_2806533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009588251.1|2806921_2807161_-	DUF4143 domain-containing protein	NA	NA	NA	NA	NA
WP_009270757.1|2808227_2808533_-	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_036744947.1|2809967_2811020_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	54.1	9.4e-92
WP_021420036.1|2811016_2812054_-	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_021420035.1|2812050_2814537_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.9	6.0e-20
WP_021420034.1|2814560_2817110_-	DUF45 domain-containing protein	NA	E4ZFJ9	Streptococcus_phage	31.1	2.5e-82
WP_021420033.1|2817113_2820254_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.0	3.4e-60
WP_021420032.1|2820268_2821495_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_021420031.1|2821488_2824158_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	34.4	4.3e-64
WP_004851913.1|2824193_2824388_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	47.4	9.7e-11
WP_021420029.1|2824937_2825456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021420028.1|2825745_2826066_+	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	39.3	2.0e-08
WP_021420027.1|2826067_2827207_+	DUF2800 domain-containing protein	NA	A0A1X9I6D8	Streptococcus_phage	57.6	3.3e-122
WP_036744945.1|2827199_2827772_+	DUF2815 family protein	NA	Q6DMW3	Streptococcus_phage	75.1	2.0e-75
WP_021420024.1|2828040_2828226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021420023.1|2828280_2830221_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	70.9	3.9e-277
WP_021420022.1|2830371_2830791_+	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	53.9	6.3e-39
WP_021420021.1|2830794_2831124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021420020.1|2831123_2833397_+	phage/plasmid primase P4 family C-terminal domain protein	NA	A0A1X9I6B6	Streptococcus_phage	47.9	5.2e-196
WP_008817758.1|2833536_2833818_+	VRR-NUC domain-containing protein	NA	M1PFY8	Streptococcus_phage	60.0	4.1e-26
WP_021420019.1|2833798_2835142_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	70.3	2.1e-160
WP_008817760.1|2835208_2835628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036744943.1|2835751_2836111_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	60.7	1.6e-38
WP_021420016.1|2836928_2838179_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	69.5	1.3e-172
WP_021420015.1|2838297_2838984_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	51.8	1.1e-51
WP_036744942.1|2838967_2839198_+	DUF4314 domain-containing protein	NA	A0A2K5B281	Erysipelothrix_phage	64.8	2.2e-22
WP_021420014.1|2839321_2839690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021420013.1|2839693_2839936_+	hypothetical protein	NA	A0A2K5B284	Erysipelothrix_phage	47.5	1.2e-13
WP_036744940.1|2840039_2841647_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	84.0	3.3e-269
WP_036744939.1|2841688_2842018_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021420010.1|2842014_2842320_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_021420009.1|2842441_2843812_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	75.3	5.2e-183
WP_153903700.1|2843696_2844440_+|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	58.1	9.7e-67
WP_021420007.1|2844455_2845640_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	50.5	1.2e-103
WP_021420006.1|2845705_2845978_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0RXK2	Streptococcus_phage	51.1	2.0e-14
WP_021420005.1|2845977_2846310_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_021420004.1|2846311_2846695_+	HK97 gp10 family phage protein	NA	Q9AZY1	Lactococcus_phage	36.8	4.6e-12
WP_021420003.1|2846687_2847005_+	hypothetical protein	NA	A6XMK2	Bacillus_virus	45.5	3.0e-17
WP_008817782.1|2847010_2847583_+|tail	tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	47.6	7.5e-43
WP_008817783.1|2847597_2847972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021420001.1|2851296_2851947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021420000.1|2851943_2853665_+	phage protein	NA	A0A1X9IGI5	Lactococcus_phage	28.0	6.0e-27
WP_021419999.1|2853679_2855575_+	hypothetical protein	NA	A0A097PAT0	Streptococcus_pyogenes_phage	32.6	2.8e-46
WP_009587688.1|2855645_2856059_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	72.1	1.1e-51
WP_021419998.1|2856060_2857014_+	amidase	NA	H7BV89	unidentified_phage	56.9	3.8e-92
WP_036744938.1|2857140_2857362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021419997.1|2857416_2858982_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	49.1	2.1e-140
WP_021419995.1|2859309_2860878_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	55.6	1.5e-154
WP_021419994.1|2860942_2861944_-	caspase family protein	NA	NA	NA	NA	NA
WP_021419993.1|2861933_2862134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021419992.1|2862157_2863000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021419991.1|2863275_2864640_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	37.5	2.7e-78
WP_008817800.1|2864626_2865244_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_021419990.1|2865540_2866455_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_021419989.1|2866675_2867482_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_008817803.1|2867510_2869892_-	glycyl radical protein	NA	A0A1S6UAD4	Serratia_phage	50.9	3.3e-07
WP_009588237.1|2869895_2870810_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_008817805.1|2870806_2871382_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009588235.1|2871778_2872183_-	DUF2752 domain-containing protein	NA	NA	NA	NA	NA
WP_008817807.1|2872184_2872511_-	DUF4234 domain-containing protein	NA	NA	NA	NA	NA
WP_009588243.1|2872610_2873072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009270798.1|2873111_2875055_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	35.0	1.3e-102
WP_008817810.1|2875550_2876345_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.2	5.7e-49
WP_009588242.1|2876345_2877593_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.5	1.1e-99
WP_009270800.1|2877893_2878514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008817813.1|2878776_2879001_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_008817814.1|2879087_2879459_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_021419988.1|2879505_2879697_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_021419987.1|2879934_2880933_-	isocitrate/isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_021419986.1|2880934_2882269_-	citrate synthase	NA	NA	NA	NA	NA
WP_009270805.1|2882389_2884312_+	aconitate hydratase	NA	NA	NA	NA	NA
WP_009270806.1|2884526_2885846_+	serpin family protein	NA	A0A1B3B6C3	Lumpy_skin_disease_virus	24.7	1.7e-18
WP_021419985.1|2886154_2887081_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP048837	[Clostridium] innocuum strain LC-LUMC-CI-001 chromosome, complete genome	4289702	3175621	3184215	4289702	integrase	Streptococcus_phage(66.67%)	10	3168497:3168510	3178676:3178689
3168497:3168510	attL	TCTATGATTTTTTC	NA	NA	NA	NA
WP_021419654.1|3175621_3176533_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.9e-19
WP_167871352.1|3177387_3178578_-|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	67.3	1.8e-155
WP_002347229.1|3178656_3178860_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	82.1	1.9e-25
3178676:3178689	attR	TCTATGATTTTTTC	NA	NA	NA	NA
WP_004613734.1|3179234_3179483_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021419827.1|3179486_3179906_-	DNA-directed RNA polymerase sigma-70 factor	NA	A0A1S5SEW0	Streptococcus_phage	37.2	4.1e-22
WP_036744813.1|3180896_3181085_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	59.6	3.7e-15
WP_021419830.1|3181099_3181537_-	gyrI-like small molecule-binding domain protein	NA	NA	NA	NA	NA
WP_021419832.1|3181835_3182198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153903697.1|3182262_3182694_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_021419833.1|3182706_3184215_-	recombinase family protein	NA	M9Q2G2	Clostridium_phage	29.2	3.7e-49
>prophage 6
NZ_CP048837	[Clostridium] innocuum strain LC-LUMC-CI-001 chromosome, complete genome	4289702	3216191	3232391	4289702		Streptococcus_phage(91.67%)	16	NA	NA
WP_021419871.1|3216191_3217094_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	52.0	8.1e-84
WP_021419872.1|3217113_3218118_-	lysozyme-like family protein	NA	A0A1S5SEZ8	Streptococcus_phage	69.6	1.5e-131
WP_021419873.1|3218114_3220229_-	MFS transporter	NA	A0A1S5SF30	Streptococcus_phage	60.3	9.2e-187
WP_021419874.1|3220228_3222679_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	74.7	0.0e+00
WP_021419875.1|3222665_3223055_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	74.6	2.8e-49
WP_021419876.1|3223168_3223672_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	50.6	1.1e-40
WP_021419877.1|3223689_3224187_-	antirestriction family protein	NA	NA	NA	NA	NA
WP_021361464.1|3224382_3224868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003436839.1|3224955_3225117_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.0	4.4e-17
WP_003436850.1|3225283_3227194_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.4	6.4e-38
WP_021419879.1|3227935_3228070_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_153903696.1|3228084_3229320_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	61.2	3.2e-139
WP_021419881.1|3229466_3230831_-	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	65.8	9.2e-172
WP_021419882.1|3230939_3231587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021419883.1|3231670_3232054_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.9	2.2e-38
WP_036744848.1|3232067_3232391_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	73.5	2.8e-39
>prophage 7
NZ_CP048837	[Clostridium] innocuum strain LC-LUMC-CI-001 chromosome, complete genome	4289702	3401158	3414575	4289702		Streptococcus_phage(60.0%)	12	NA	NA
WP_008977178.1|3401158_3401662_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	60.8	1.3e-54
WP_004843362.1|3401770_3402169_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	73.0	3.2e-48
WP_167871360.1|3402146_3404597_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	74.6	0.0e+00
WP_167871361.1|3404596_3406783_+	YtxH domain-containing protein	NA	A0A1S5SF30	Streptococcus_phage	68.3	1.1e-171
WP_004843365.1|3406779_3407787_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	70.8	9.2e-137
WP_167871362.1|3407803_3408715_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	52.1	9.1e-83
WP_077712409.1|3408857_3409526_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.5	2.2e-30
WP_144017116.1|3409522_3410644_+	HAMP domain-containing protein	NA	A0A1B0VMK3	Pseudomonas_phage	25.5	9.3e-05
WP_167871363.1|3410760_3412128_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_144017118.1|3412333_3412981_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.2	6.1e-25
WP_144017119.1|3413013_3413238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167871364.1|3413282_3414575_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.3	5.0e-18
>prophage 8
NZ_CP048837	[Clostridium] innocuum strain LC-LUMC-CI-001 chromosome, complete genome	4289702	3646447	3682591	4289702	holin,capsid,coat,tail,terminase	Paenibacillus_phage(27.78%)	45	NA	NA
WP_167871437.1|3646447_3646906_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_167871377.1|3647545_3648175_-	hypothetical protein	NA	A0A0X8WPC5	Ralstonia_phage	50.0	6.2e-06
WP_167871378.1|3648192_3648834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871379.1|3648845_3650546_-	dockerin	NA	NA	NA	NA	NA
WP_167871380.1|3650556_3651207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871381.1|3651210_3654438_-|tail	phage tail tape measure protein	tail	A0A090D808	Clostridium_phage	40.7	8.3e-54
WP_167871382.1|3654470_3655034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871383.1|3655026_3655401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871384.1|3655411_3655930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871385.1|3655940_3656399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871386.1|3656388_3656799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871387.1|3656791_3657193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871388.1|3657189_3657576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871389.1|3657588_3658776_-|capsid	phage capsid protein	capsid	A0A1J0MCK3	Streptomyces_phage	42.2	2.9e-57
WP_167871390.1|3658789_3659335_-	hypothetical protein	NA	X2CYF9	Lactobacillus_phage	29.6	2.4e-06
WP_167871391.1|3659658_3659859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871392.1|3659872_3661393_-	hypothetical protein	NA	A0A2K9V3K1	Faecalibacterium_phage	35.2	3.9e-46
WP_167871393.1|3661392_3662946_-	hypothetical protein	NA	A0A1B1P863	Bacillus_phage	26.7	6.8e-30
WP_167871394.1|3662956_3664183_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2K9V3G6	Faecalibacterium_phage	52.6	3.1e-62
WP_167871395.1|3664160_3664871_-|terminase	terminase	terminase	X5JB33	Clostridium_phage	45.5	4.1e-38
WP_065531786.1|3664927_3665161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065531787.1|3665258_3665723_-	hypothetical protein	NA	K4I1Q3	Salmonella_phage	38.6	2.6e-17
WP_167871396.1|3665915_3666377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871397.1|3666397_3666550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871398.1|3666546_3666726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871399.1|3666839_3667658_-	HNH endonuclease	NA	A0A1S5SBA6	Streptococcus_phage	36.6	4.5e-41
WP_167871438.1|3667654_3667891_-	hypothetical protein	NA	A0A0E3TAK6	Staphylococcus_phage	50.6	1.6e-12
WP_167871400.1|3667987_3668371_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7SC39	Paenibacillus_phage	64.8	1.8e-45
WP_167871401.1|3668825_3669092_-	hypothetical protein	NA	A0A0K2CZH7	Paenibacillus_phage	52.9	9.5e-17
WP_167871402.1|3669353_3671567_-	AAA family ATPase	NA	Q5YA88	Bacillus_phage	66.0	5.6e-296
WP_167871403.1|3671570_3673157_-	DEAD/DEAH box helicase	NA	A0A0K2CZF8	Paenibacillus_phage	69.6	3.6e-220
WP_167871404.1|3673675_3674749_-	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	53.5	1.7e-104
WP_167871405.1|3676094_3676493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871406.1|3676603_3676933_-	sporulation transcription factor Spo0A	NA	NA	NA	NA	NA
WP_167871407.1|3676933_3677215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871408.1|3677211_3677436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871409.1|3677432_3677624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871410.1|3677681_3677888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871411.1|3677950_3678265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167871412.1|3678277_3678505_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167871413.1|3678568_3678706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167871414.1|3678909_3679638_+	LexA family transcriptional regulator	NA	A0A0D4DD29	Staphylococcus_phage	28.9	4.8e-18
WP_167871415.1|3679674_3680667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167871416.1|3680815_3682363_+	recombinase family protein	NA	R9W007	Paenibacillus_phage	47.0	2.7e-127
WP_128577713.1|3682336_3682591_-|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
