The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048852	Bacillus tequilensis strain EA-CB0015 chromosome, complete genome	4012371	664499	672883	4012371		Synechococcus_phage(50.0%)	8	NA	NA
WP_167871783.1|664499_665795_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.5	1.7e-18
WP_167871784.1|665869_666595_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.2	3.5e-45
WP_024715848.1|666587_666842_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_024715847.1|666838_667522_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_167871785.1|667505_669734_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.3	1.0e-159
WP_167871786.1|669709_671140_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	5.3e-53
WP_167871787.1|671240_672281_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	4.4e-65
WP_024715843.1|672277_672883_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.9	1.2e-27
>prophage 2
NZ_CP048852	Bacillus tequilensis strain EA-CB0015 chromosome, complete genome	4012371	1144430	1178458	4012371	coat,tRNA	Planktothrix_phage(20.0%)	39	NA	NA
WP_167872094.1|1144430_1145423_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024714109.1|1146166_1147807_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_167872095.1|1147901_1148837_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_024714111.1|1148840_1149758_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_081719799.1|1149762_1150839_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.4	3.5e-17
WP_024714113.1|1150840_1151758_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_167873833.1|1151863_1153081_+	MFS transporter	NA	NA	NA	NA	NA
WP_024714115.1|1153254_1153833_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003224599.1|1154013_1154409_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_167872096.1|1154567_1155227_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	2.9e-30
WP_141770187.1|1155395_1155536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872097.1|1155502_1156159_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_167872098.1|1156316_1157468_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_167872099.1|1157696_1159526_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_019713977.1|1159564_1159732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024714120.1|1160045_1160945_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003224612.1|1160941_1161340_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_167873834.1|1161594_1162140_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	72.0	2.5e-40
WP_167872100.1|1162343_1162916_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_167872101.1|1163039_1163408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024714124.1|1163436_1164072_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_024714125.1|1164090_1164891_+	NAD kinase	NA	NA	NA	NA	NA
WP_024714126.1|1164905_1165805_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_167872102.1|1165817_1166552_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	S4TNS0	Salmonella_phage	21.4	3.8e-07
WP_167872103.1|1166784_1168629_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_024714129.1|1168878_1169592_+	thiaminase II	NA	NA	NA	NA	NA
WP_167872104.1|1169566_1170184_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_167872105.1|1170167_1171277_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_167873835.1|1171276_1171477_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_167872106.1|1171473_1172244_+	thiazole synthase	NA	NA	NA	NA	NA
WP_167872107.1|1172240_1173251_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_167872108.1|1173269_1174085_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_024714136.1|1174221_1174998_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_167872109.1|1175099_1175777_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_024714138.1|1175869_1176319_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_024714139.1|1176446_1176935_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_167872110.1|1177087_1177609_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_167872111.1|1177703_1178030_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_167872112.1|1178071_1178458_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP048852	Bacillus tequilensis strain EA-CB0015 chromosome, complete genome	4012371	1200297	1264252	4012371	portal,plate,tail,terminase,holin,tRNA,coat,transposase	Bacillus_phage(30.77%)	81	NA	NA
WP_024716442.1|1200297_1200597_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_024716441.1|1200615_1200810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167872126.1|1200827_1201964_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.2	9.1e-16
WP_167872127.1|1201982_1202351_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_167872128.1|1202367_1202613_-	spore gernimation protein GerQ	NA	NA	NA	NA	NA
WP_167871450.1|1203049_1203223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167872129.1|1203381_1204545_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	29.3	4.0e-43
WP_024716435.1|1204762_1205065_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_167872130.1|1205282_1205681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024716433.1|1205870_1206353_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_167872131.1|1206409_1206604_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_167871451.1|1207682_1207877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167871594.1|1207919_1209070_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	2.7e-39
WP_167872132.1|1209186_1210176_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_167872133.1|1210297_1210510_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_167872134.1|1210759_1212160_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_167872135.1|1212210_1212684_-	YjfA family protein	NA	NA	NA	NA	NA
WP_032682202.1|1212812_1212980_-	putative motility protein	NA	NA	NA	NA	NA
WP_167872136.1|1213105_1214005_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_024716425.1|1214014_1214413_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_167872137.1|1214513_1215086_-	YjgB family protein	NA	NA	NA	NA	NA
WP_167872138.1|1215234_1218192_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_024716422.1|1218184_1218745_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_024716421.1|1218942_1219584_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_167872139.1|1219659_1220286_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024716420.1|1220318_1220597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167872140.1|1220988_1222185_+	cytochrome P450	NA	NA	NA	NA	NA
WP_167872141.1|1222204_1223383_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	27.6	6.1e-07
WP_003232781.1|1223424_1223613_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	3.4e-21
WP_167872142.1|1223779_1224592_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_167872143.1|1224637_1225390_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_167872144.1|1225389_1226142_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.2	7.6e-19
WP_167872145.1|1226258_1227233_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
WP_167872146.1|1227363_1227861_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024716413.1|1228253_1228676_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_167872147.1|1228715_1229894_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024716410.1|1230405_1231170_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_024716409.1|1231395_1231860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167872148.1|1232008_1233280_+	AAA family ATPase	NA	A0A1V0SEI6	Indivirus	38.6	1.0e-15
WP_081719943.1|1233424_1234561_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	46.8	5.4e-93
WP_024716407.1|1234550_1234688_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_167872149.1|1235085_1236039_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	72.9	3.1e-65
WP_167872150.1|1236080_1236458_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	44.4	1.4e-16
WP_024716404.1|1236564_1237167_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.8	1.3e-42
WP_167872151.1|1237948_1238545_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.6e-40
WP_003232719.1|1238705_1239047_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_167872152.1|1239224_1239404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872153.1|1239390_1240227_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	28.3	1.4e-21
WP_167872154.1|1240126_1240927_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	7.7e-62
WP_032682200.1|1240926_1241094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872155.1|1241178_1241538_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_167872156.1|1241524_1241731_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	4.2e-12
WP_024716395.1|1241845_1242355_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	40.4	1.0e-22
WP_167872157.1|1242472_1243270_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.8	8.0e-59
WP_167872158.1|1243266_1244568_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.5	2.2e-154
WP_167873837.1|1244571_1246059_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.3e-139
WP_167872159.1|1246078_1246906_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
WP_024716390.1|1246930_1247866_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.5e-104
WP_167872160.1|1247887_1248271_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	41.4	3.7e-14
WP_167872161.1|1248267_1248624_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_167872162.1|1248620_1249106_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	45.6	1.1e-37
WP_167872163.1|1249118_1249559_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_167872164.1|1249562_1249781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872165.1|1249777_1251178_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	39.8	6.5e-80
WP_024716383.1|1251179_1251623_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003232676.1|1251716_1252163_+	phage-like element PBSX protein XkdN	NA	A0A249XXA9	Clostridium_phage	33.6	7.5e-14
WP_081719940.1|1252192_1252342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167873838.1|1252343_1256348_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	9.6e-44
WP_167872166.1|1256340_1257000_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	8.1e-25
WP_167873839.1|1257015_1257993_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	33.1	3.9e-39
WP_024716379.1|1257992_1258259_+	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	2.2e-05
WP_167872167.1|1258318_1258744_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	7.3e-11
WP_167873840.1|1258736_1259783_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.2	1.6e-70
WP_167872168.1|1259766_1260345_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	8.7e-15
WP_167872169.1|1260341_1260614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872170.1|1260616_1262092_+	hypothetical protein	NA	M4ZRP1	Bacillus_phage	59.4	2.1e-20
WP_167872171.1|1262104_1262545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872172.1|1262534_1262726_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	62.3	4.0e-17
WP_167872173.1|1262788_1263067_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	68.1	3.7e-27
WP_167872174.1|1263079_1263343_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.7e-24
WP_167872175.1|1263355_1264252_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	68.3	1.1e-80
>prophage 4
NZ_CP048852	Bacillus tequilensis strain EA-CB0015 chromosome, complete genome	4012371	1702312	1708550	4012371		Bacillus_phage(50.0%)	6	NA	NA
WP_024715969.1|1702312_1702705_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	57.4	1.2e-28
WP_024715968.1|1702664_1704767_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	87.0	0.0e+00
WP_014113879.1|1704784_1705774_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	84.1	1.1e-155
WP_167872404.1|1705823_1706444_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.8	5.4e-47
WP_167872405.1|1706504_1707272_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	48.2	1.0e-50
WP_167872406.1|1707908_1708550_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	41.9	1.1e-26
>prophage 5
NZ_CP048852	Bacillus tequilensis strain EA-CB0015 chromosome, complete genome	4012371	1712905	1719602	4012371		Bacillus_phage(100.0%)	8	NA	NA
WP_167872411.1|1712905_1713796_-	thermonuclease family protein	NA	O64020	Bacillus_phage	91.2	6.3e-105
WP_167872412.1|1714291_1714849_+	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	94.6	1.7e-100
WP_167872413.1|1714948_1716859_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	89.7	1.4e-210
WP_167872414.1|1716865_1717354_+	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_167873848.1|1717454_1717931_+	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	65.8	1.1e-60
WP_167872415.1|1718035_1718488_+	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	89.3	3.6e-72
WP_167872416.1|1718534_1718960_+	selenium binding protein	NA	NA	NA	NA	NA
WP_167872417.1|1719485_1719602_-	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	97.4	9.8e-11
>prophage 6
NZ_CP048852	Bacillus tequilensis strain EA-CB0015 chromosome, complete genome	4012371	1723045	1764458	4012371	holin,integrase,tail	Bacillus_phage(88.24%)	38	1737154:1737170	1763123:1763139
WP_167872420.1|1723045_1723378_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	93.6	3.0e-52
WP_167873849.1|1723756_1724365_+	DNA repair protein	NA	A0A1P8CWP4	Bacillus_phage	95.5	1.7e-109
WP_167873850.1|1724434_1724623_+	hypothetical protein	NA	A0A1P8CWP4	Bacillus_phage	88.7	1.7e-23
WP_167872421.1|1724750_1726592_+	methyltransferase domain-containing protein	NA	A0A1V0SCZ9	Indivirus	32.0	3.5e-09
WP_167872422.1|1726581_1727310_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	30.0	2.8e-18
WP_167872423.1|1727465_1728689_+	MFS transporter	NA	NA	NA	NA	NA
WP_167872424.1|1728713_1730420_+	hypothetical protein	NA	E3SL71	Synechococcus_phage	32.9	1.4e-60
WP_153801665.1|1730759_1730903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167872425.1|1730892_1732023_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	50.0	3.5e-100
WP_167872426.1|1732156_1732408_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	94.0	3.9e-36
WP_167872427.1|1732428_1732821_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	98.5	3.2e-61
WP_167872428.1|1732937_1733984_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	52.0	2.7e-83
WP_167872429.1|1734212_1734350_-	XkdX family protein	NA	NA	NA	NA	NA
WP_167872430.1|1734350_1734716_-	hypothetical protein	NA	O64053	Bacillus_phage	44.1	7.0e-18
WP_167873851.1|1736529_1737348_-	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	66.1	7.3e-100
1737154:1737170	attL	ATCTTCAATTTCTCGCC	NA	NA	NA	NA
WP_167872431.1|1737363_1740006_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	92.5	0.0e+00
WP_167872432.1|1740019_1740781_-|tail	phage tail protein	tail	A0A1P8CWP8	Bacillus_phage	95.3	2.9e-127
WP_167872433.1|1740821_1747715_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	80.6	0.0e+00
WP_167872434.1|1747912_1748905_-	hypothetical protein	NA	O64047	Bacillus_phage	37.1	8.0e-16
WP_167872435.1|1749037_1750045_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H3V0P2	Geobacillus_virus	65.7	9.9e-123
WP_167872436.1|1750058_1750478_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	84.2	1.9e-59
WP_167872437.1|1750477_1750966_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	73.6	3.7e-59
WP_167872438.1|1751051_1752386_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	27.7	1.8e-42
WP_167872439.1|1752385_1752742_-	hypothetical protein	NA	O64055	Bacillus_phage	94.1	4.1e-55
WP_167872440.1|1752816_1753284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167872441.1|1753303_1754095_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	39.2	2.5e-20
WP_167872442.1|1754131_1754860_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	42.6	3.5e-45
WP_167872443.1|1754856_1755363_-	hypothetical protein	NA	O64060	Bacillus_phage	84.5	1.3e-78
WP_167872444.1|1755359_1756010_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	97.2	1.4e-117
WP_167872445.1|1755993_1756248_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	95.2	1.8e-36
WP_167872446.1|1756244_1756640_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	93.9	3.7e-65
WP_167872447.1|1756654_1757125_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	98.7	3.3e-81
WP_014472029.1|1757160_1758177_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	97.9	4.6e-184
WP_010328108.1|1758215_1758752_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	99.4	1.4e-94
WP_167872448.1|1758776_1760213_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	95.8	5.2e-258
WP_167872449.1|1760243_1761764_-	hypothetical protein	NA	O64068	Bacillus_phage	97.0	2.0e-276
WP_167872450.1|1761781_1763551_-	hypothetical protein	NA	O64069	Bacillus_phage	99.7	0.0e+00
1763123:1763139	attR	ATCTTCAATTTCTCGCC	NA	NA	NA	NA
WP_167872451.1|1763537_1764458_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	97.7	1.5e-173
>prophage 7
NZ_CP048852	Bacillus tequilensis strain EA-CB0015 chromosome, complete genome	4012371	1769544	1809563	4012371	integrase	Bacillus_phage(88.64%)	64	1774147:1774168	1796214:1796235
WP_167872457.1|1769544_1769820_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	95.6	3.5e-38
WP_167872458.1|1770076_1770700_-	hypothetical protein	NA	O64076	Bacillus_phage	73.5	1.8e-82
WP_167872459.1|1770921_1771824_-	GIY-YIG nuclease family protein	NA	G3MAX5	Bacillus_virus	36.1	1.4e-06
WP_167872460.1|1772005_1773883_-	hypothetical protein	NA	A0A1P8CWS8	Bacillus_phage	99.0	0.0e+00
WP_167872461.1|1773922_1774117_-	hypothetical protein	NA	O64077	Bacillus_phage	92.2	8.2e-26
1774147:1774168	attL	TATACATATTATTTGTATTTGT	NA	NA	NA	NA
WP_032721653.1|1775141_1775318_+	hypothetical protein	NA	O64080	Bacillus_phage	97.4	2.0e-10
WP_167872462.1|1775336_1775588_+	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	95.8	7.1e-30
WP_167872463.1|1775632_1775794_+	hypothetical protein	NA	O64081	Bacillus_phage	96.1	4.0e-18
WP_167872464.1|1775904_1777137_+	hypothetical protein	NA	O64082	Bacillus_phage	98.0	4.5e-234
WP_167872465.1|1777475_1779344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872466.1|1779392_1780994_+	DUF4942 domain-containing protein	NA	A0A2I7RNS1	Vibrio_phage	31.7	1.9e-14
WP_167872467.1|1781204_1781465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872468.1|1781515_1781797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872469.1|1781873_1782113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872470.1|1782171_1782507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872471.1|1782570_1782972_+	UPF0715 family protein	NA	NA	NA	NA	NA
WP_167872472.1|1783162_1783390_+	helix-turn-helix transcriptional regulator	NA	O64085	Bacillus_phage	90.7	1.1e-32
WP_167872473.1|1783709_1784693_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_167872474.1|1784728_1785559_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_116315615.1|1785601_1785823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872475.1|1785867_1786269_+	UPF0715 family protein	NA	O64087	Bacillus_phage	83.6	7.6e-50
WP_167872476.1|1786280_1786511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167872477.1|1786624_1786849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872478.1|1787122_1787374_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	98.8	3.5e-37
WP_167872479.1|1787377_1787593_+	hypothetical protein	NA	O64089	Bacillus_phage	87.3	8.2e-27
WP_167872480.1|1787603_1787738_+	hypothetical protein	NA	O64090	Bacillus_phage	100.0	1.8e-19
WP_167873852.1|1787893_1788427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072692929.1|1788503_1788920_+	hypothetical protein	NA	O64093	Bacillus_phage	92.0	6.0e-66
WP_167872481.1|1789095_1790256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967508.1|1790269_1790395_+	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_167872482.1|1790727_1790928_+	hypothetical protein	NA	O64096	Bacillus_phage	98.5	1.2e-27
WP_167873853.1|1790930_1791248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144453792.1|1791296_1791509_+	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	95.7	2.1e-27
WP_167872483.1|1791498_1792575_+|integrase	site-specific integrase	integrase	O64099	Bacillus_phage	98.9	8.5e-197
WP_167872484.1|1792681_1794064_+	hypothetical protein	NA	O64100	Bacillus_phage	99.1	3.1e-260
WP_167872485.1|1794087_1795065_+	hypothetical protein	NA	O64101	Bacillus_phage	99.4	4.4e-176
WP_004399410.1|1795253_1795478_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	100.0	1.9e-34
WP_003231034.1|1795659_1795878_+	YopT family protein	NA	O64103	Bacillus_phage	100.0	6.6e-32
WP_010330351.1|1795947_1796145_+	hypothetical protein	NA	O64104	Bacillus_phage	96.9	1.2e-27
WP_161986113.1|1796256_1796451_+	hypothetical protein	NA	O64105	Bacillus_phage	95.3	2.2e-26
1796214:1796235	attR	ACAAATACAAATAATATGTATA	NA	NA	NA	NA
WP_167872486.1|1796819_1797218_+	hypothetical protein	NA	M4ZRL6	Bacillus_phage	52.8	9.2e-32
WP_167872487.1|1797214_1797397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872488.1|1797456_1798212_+	phage regulatory protein/antirepressor Ant	NA	A0A1P8CWY0	Bacillus_phage	80.5	3.6e-109
WP_167872489.1|1798266_1798488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872490.1|1798651_1799104_+	hypothetical protein	NA	O64117	Bacillus_phage	82.0	2.5e-65
WP_069323063.1|1799165_1799426_+	hypothetical protein	NA	A0A1P8CWY6	Bacillus_phage	97.7	1.9e-41
WP_167873854.1|1800135_1800318_+	hypothetical protein	NA	O64120	Bacillus_phage	96.6	2.4e-27
WP_167872491.1|1800354_1800543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872492.1|1800693_1800909_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	90.1	8.8e-29
WP_167872493.1|1800927_1801302_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	93.5	1.0e-56
WP_167872494.1|1801425_1801827_+	hypothetical protein	NA	K4JWE2	Caulobacter_phage	39.1	4.1e-19
WP_167872495.1|1801918_1802296_-	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	46.0	4.8e-22
WP_167872496.1|1802442_1802856_+	hypothetical protein	NA	A0A1P8CWZ8	Bacillus_phage	96.4	1.8e-75
WP_167872497.1|1802921_1803734_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	94.4	1.9e-148
WP_167872498.1|1803803_1804478_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	96.5	1.6e-76
WP_167872499.1|1804548_1804770_+	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	94.5	7.9e-33
WP_167872500.1|1804820_1805708_+	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	96.3	7.8e-164
WP_072589242.1|1805697_1805970_+	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	93.3	2.7e-43
WP_167872501.1|1806000_1806177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167872502.1|1806444_1806741_+	hypothetical protein	NA	O64136	Bacillus_phage	78.7	8.6e-35
WP_167872503.1|1806806_1807187_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	93.7	5.1e-64
WP_167872504.1|1807260_1807614_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_167872505.1|1807828_1808200_+	hypothetical protein	NA	O64139	Bacillus_phage	94.3	3.0e-61
WP_167872506.1|1808222_1809563_+	hypothetical protein	NA	A0A0K2FMB7	Brevibacillus_phage	23.8	1.3e-05
>prophage 8
NZ_CP048852	Bacillus tequilensis strain EA-CB0015 chromosome, complete genome	4012371	1812962	1845997	4012371		Bacillus_phage(95.83%)	63	NA	NA
WP_003231078.1|1812962_1814027_+	hypothetical protein	NA	A0A218KBY7	Bacillus_phage	38.9	1.1e-63
WP_167872509.1|1814038_1815727_+	single-stranded DNA endonuclease	NA	A0A1P8CX07	Bacillus_phage	43.5	4.4e-123
WP_167872510.1|1815744_1818036_+	DNA polymerase I	NA	A0A0K0N6N8	Gordonia_phage	28.0	1.3e-05
WP_167873855.1|1818061_1818778_+	hypothetical protein	NA	O64147	Bacillus_phage	84.0	8.4e-108
WP_004399415.1|1818895_1819045_+	hypothetical protein	NA	O64148	Bacillus_phage	100.0	7.9e-21
WP_087960917.1|1819080_1819278_+	hypothetical protein	NA	O64149	Bacillus_phage	92.2	1.5e-27
WP_167873856.1|1819310_1819526_+	YorP family protein	NA	O64150	Bacillus_phage	95.8	3.3e-36
WP_167872511.1|1819518_1819674_+	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	92.2	2.8e-21
WP_167872512.1|1819673_1820171_+	deoxynucleoside kinase	NA	A0A1P8CX28	Bacillus_phage	90.3	1.5e-79
WP_106294053.1|1820210_1820558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167872513.1|1820682_1820949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872514.1|1821035_1821632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872515.1|1821683_1821902_+	hypothetical protein	NA	A0A1P8CX26	Bacillus_phage	94.4	4.0e-29
WP_167873857.1|1821924_1822269_+	hypothetical protein	NA	O64156	Bacillus_phage	90.4	2.8e-53
WP_167872516.1|1822308_1822536_+	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	81.3	4.6e-28
WP_167872517.1|1822935_1823694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019712334.1|1823983_1824196_+	hypothetical protein	NA	O64159	Bacillus_phage	87.1	6.0e-30
WP_081719797.1|1824312_1824399_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_167872518.1|1824537_1824801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872519.1|1824959_1825136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872520.1|1825295_1825616_+	hypothetical protein	NA	A0A1P8CX20	Bacillus_phage	97.2	5.3e-54
WP_167872521.1|1825682_1826036_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	70.8	1.2e-38
WP_167872522.1|1826050_1826398_+	hypothetical protein	NA	O64164	Bacillus_phage	91.3	7.7e-51
WP_167872523.1|1826411_1826537_+	hypothetical protein	NA	O64165	Bacillus_phage	87.8	1.3e-11
WP_167872524.1|1826578_1826932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041056314.1|1826966_1827158_+	hypothetical protein	NA	U5PY38	Bacillus_phage	43.5	6.2e-10
WP_167873858.1|1827173_1827386_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	85.7	1.3e-29
WP_166851988.1|1827402_1827669_+	hypothetical protein	NA	A0A1P8CX38	Bacillus_phage	96.6	1.4e-39
WP_167872525.1|1827700_1827835_+	hypothetical protein	NA	O64168	Bacillus_phage	97.7	1.6e-17
WP_167872526.1|1827990_1828173_+	hypothetical protein	NA	F8WPL1	Bacillus_phage	66.7	3.4e-18
WP_167872527.1|1828245_1828608_+	hypothetical protein	NA	A0A1P8CX44	Bacillus_phage	89.2	1.1e-52
WP_167872528.1|1828607_1829003_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	94.7	5.3e-64
WP_167872529.1|1828965_1831065_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	61.1	0.0e+00
WP_167872530.1|1831351_1832350_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	82.0	1.1e-150
WP_167872531.1|1832346_1832589_+	thioredoxin	NA	A0A1P8CX24	Bacillus_phage	95.0	7.5e-37
WP_167872532.1|1832631_1832994_+	hypothetical protein	NA	A0A172JI43	Bacillus_phage	41.3	4.6e-14
WP_167872533.1|1833065_1833494_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	90.1	5.4e-70
WP_017697107.1|1833581_1833764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041336532.1|1834138_1834294_+	hypothetical protein	NA	A0A1P8CX64	Bacillus_phage	80.4	3.2e-17
WP_167872534.1|1834311_1834617_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	91.1	4.0e-43
WP_167872535.1|1834600_1834792_+	hypothetical protein	NA	A0A1P8CX47	Bacillus_phage	77.5	1.5e-24
WP_167872536.1|1834906_1835251_+	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	82.5	9.7e-46
WP_167872537.1|1835307_1836147_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	95.0	5.5e-159
WP_167872538.1|1836203_1836941_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_167872539.1|1837097_1837451_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	91.5	6.0e-51
WP_167872540.1|1837463_1837718_+	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	89.6	6.3e-34
WP_134983294.1|1838491_1838692_+	hypothetical protein	NA	A0A1P8CX75	Bacillus_phage	56.1	3.6e-08
WP_134983293.1|1838725_1838944_-	acid-soluble spore protein SspC	NA	Q77YX0	Bacillus_phage	95.8	1.0e-29
WP_167872541.1|1839061_1839889_+	metallophosphoesterase	NA	O64184	Bacillus_phage	90.2	2.8e-155
WP_167872542.1|1839898_1840117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872543.1|1840138_1840507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872544.1|1840543_1840789_+	hypothetical protein	NA	R4JF03	Bacillus_phage	57.3	2.3e-17
WP_167872545.1|1840829_1841243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872546.1|1841217_1841637_+	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	73.5	1.1e-38
WP_167872547.1|1841644_1841809_+	hypothetical protein	NA	O64190	Bacillus_phage	56.4	3.2e-07
WP_167872548.1|1841805_1842069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872549.1|1842275_1842488_+	hypothetical protein	NA	O64192	Bacillus_phage	97.1	3.4e-33
WP_167873859.1|1842571_1842757_+	hypothetical protein	NA	O64193	Bacillus_phage	91.8	4.3e-24
WP_167872550.1|1842761_1843001_-	helix-turn-helix transcriptional regulator	NA	O64194	Bacillus_phage	96.2	2.6e-37
WP_167872551.1|1843074_1843674_+	hypothetical protein	NA	O64195	Bacillus_phage	88.2	1.2e-91
WP_167872552.1|1843670_1843817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167872553.1|1843905_1845606_+	recombinase family protein	NA	W8CYE4	Bacillus_phage	23.7	1.8e-15
WP_167872554.1|1845586_1845997_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	39.9	5.1e-17
>prophage 9
NZ_CP048852	Bacillus tequilensis strain EA-CB0015 chromosome, complete genome	4012371	2297436	2303544	4012371		Staphylococcus_phage(66.67%)	8	NA	NA
WP_167872794.1|2297436_2298030_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
WP_167873870.1|2298019_2298775_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.9	1.2e-08
WP_167872795.1|2299067_2299592_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_024715198.1|2299605_2299980_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|2300092_2300557_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_024715197.1|2300589_2301786_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.7	2.6e-114
WP_167872796.1|2301800_2302448_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	47.2	3.2e-42
WP_167872797.1|2302458_2303544_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	2.3e-56
>prophage 10
NZ_CP048852	Bacillus tequilensis strain EA-CB0015 chromosome, complete genome	4012371	3664723	3710772	4012371	coat,protease,tRNA,bacteriocin	Staphylococcus_phage(25.0%)	49	NA	NA
WP_167873560.1|3664723_3666394_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_167873561.1|3666390_3666819_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_024713849.1|3667130_3667262_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_167873562.1|3667395_3668742_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_024713851.1|3668754_3668916_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_167873563.1|3668912_3669632_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	1.0e-20
WP_167873564.1|3669624_3670935_+|bacteriocin	bacteriocin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_167873923.1|3670924_3672085_+	insulinase family protein	NA	NA	NA	NA	NA
WP_167873565.1|3672089_3673373_+	insulinase family protein	NA	NA	NA	NA	NA
WP_167873566.1|3673369_3674071_+|bacteriocin	bacteriocin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_167873567.1|3674076_3675471_-	YncE family protein	NA	NA	NA	NA	NA
WP_024713858.1|3675467_3675698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024713859.1|3675700_3676846_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.8	5.5e-77
WP_024713860.1|3676829_3676949_+	PhrC/PhrF family phosphatase-inhibitory pheromone	NA	NA	NA	NA	NA
WP_167873568.1|3677478_3678267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167873569.1|3678253_3678928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167873570.1|3678928_3679735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167873571.1|3679737_3680385_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.5	2.2e-27
WP_167873572.1|3680377_3680938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024713867.1|3680983_3681856_-	agmatinase	NA	NA	NA	NA	NA
WP_024713868.1|3681916_3682747_-	spermidine synthase	NA	NA	NA	NA	NA
WP_167873573.1|3682948_3685024_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_167873924.1|3685051_3685474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024713871.1|3685612_3686131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024713872.1|3686143_3686803_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|3686912_3687101_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_167873574.1|3687144_3687564_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167873575.1|3687683_3689600_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	42.5	1.1e-141
WP_167873576.1|3690429_3691839_-	MFS transporter	NA	NA	NA	NA	NA
WP_024713095.1|3691835_3692309_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_167873577.1|3692423_3692924_-	YwgA family protein	NA	NA	NA	NA	NA
WP_167873578.1|3692959_3694261_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|3694422_3694647_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_167873579.1|3694859_3695639_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.7e-06
WP_167873580.1|3695781_3696672_-	DMT family transporter	NA	NA	NA	NA	NA
WP_024713101.1|3696842_3697688_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_024713102.1|3697735_3698635_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_024713103.1|3698779_3699751_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003235942.1|3700021_3700786_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_167873581.1|3700917_3701697_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_024713105.1|3701710_3702910_-	transaminase BacF	NA	NA	NA	NA	NA
WP_167873582.1|3702910_3704095_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_167873583.1|3704091_3705510_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_167873584.1|3705528_3706290_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	6.7e-23
WP_167873585.1|3706292_3707000_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_024713110.1|3706989_3707604_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_167873586.1|3707755_3708994_-	MFS transporter	NA	NA	NA	NA	NA
WP_024713112.1|3709537_3710002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167873587.1|3710316_3710772_-|coat	spore coat protein	coat	NA	NA	NA	NA
