The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047628	Lactococcus raffinolactis strain Lr_19_14 chromosome, complete genome	2368909	524094	566889	2368909	plate,head,capsid,portal,tail,terminase,integrase,transposase,holin	Enterococcus_phage(18.42%)	56	529282:529299	567365:567382
WP_167841645.1|524094_525474_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_061775465.1|525688_527395_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-29
WP_096040065.1|527394_529299_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	2.1e-49
529282:529299	attL	CAATTTGTGTTTGAGTAG	NA	NA	NA	NA
WP_167841076.1|529392_530523_-|integrase	site-specific integrase	integrase	A0A0S2MYI6	Enterococcus_phage	32.6	6.4e-46
WP_167841077.1|530651_531443_-	DUF1828 domain-containing protein	NA	Q6SEA4	Lactobacillus_prophage	38.4	3.4e-33
WP_167841078.1|531455_531908_-	hypothetical protein	NA	Q6SEA3	Lactobacillus_prophage	32.0	2.3e-10
WP_167841079.1|532114_532312_+	hypothetical protein	NA	A0A0A7NNT6	Lactobacillus_phage	64.3	7.3e-14
WP_167841080.1|532308_532896_-	molecular chaperone Tir	NA	A0A0S2MYG4	Enterococcus_phage	67.5	9.3e-73
WP_167841081.1|532885_533371_-	DUF4231 domain-containing protein	NA	A0A0S2MYH2	Enterococcus_phage	49.3	1.4e-29
WP_167841082.1|533418_533619_-	hypothetical protein	NA	A0A097BY73	Enterococcus_phage	77.3	8.7e-23
WP_167841646.1|533630_534335_-	helix-turn-helix transcriptional regulator	NA	E8ZDN4	Streptococcus_phage	51.9	4.6e-58
WP_167841083.1|534717_535506_-	DUF4393 domain-containing protein	NA	A0A0R6PH66	Moraxella_phage	37.2	2.7e-35
WP_167841084.1|535669_535915_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167841085.1|536111_536258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841086.1|536254_536482_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	63.9	5.6e-18
WP_167841087.1|536631_536817_+	helix-turn-helix transcriptional regulator	NA	D7RWH5	Brochothrix_phage	54.1	1.2e-10
WP_167841088.1|536892_537126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841089.1|537137_537359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061774525.1|537522_537882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841090.1|537914_539171_+	AAA family ATPase	NA	Q5YA97	Bacillus_phage	61.9	1.6e-141
WP_167841091.1|539182_540247_+	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	48.5	9.6e-84
WP_061774521.1|540870_541131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841092.1|541105_542701_+	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	67.4	5.1e-206
WP_167841093.1|542706_544998_+	AAA family ATPase	NA	Q5YA88	Bacillus_phage	55.4	2.5e-238
WP_167841094.1|545253_545475_+	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	43.7	3.8e-11
WP_167841095.1|545467_545626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841096.1|545618_545849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841097.1|545835_546240_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220G9T0	Streptococcus_phage	42.2	5.2e-22
WP_167840129.1|546369_546525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841098.1|546795_547203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841099.1|547356_548148_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_167841647.1|548289_548718_+	universal stress protein	NA	NA	NA	NA	NA
WP_167841100.1|548775_549207_+|terminase	terminase small subunit	terminase	D7RWC4	Brochothrix_phage	67.6	1.1e-43
WP_167841101.1|549199_550462_+|terminase	PBSX family phage terminase large subunit	terminase	D7RWC5	Brochothrix_phage	82.4	2.2e-204
WP_167841102.1|550476_551931_+|portal	phage portal protein	portal	A0A1S5SAI0	Streptococcus_phage	55.6	1.3e-144
WP_167841103.1|551923_553627_+	hypothetical protein	NA	A0A1P8BLD7	Lactococcus_phage	51.8	2.8e-162
WP_031366594.1|553630_553849_+	hypothetical protein	NA	A0A1P8BLD4	Lactococcus_phage	81.9	1.6e-30
WP_167841104.1|554034_554613_+	scaffolding protein	NA	D2J060	Enterococcus_phage	41.7	2.5e-25
WP_167841105.1|554630_555545_+|capsid	capsid protein	capsid	Q20DD4	Lactobacillus_phage	53.7	5.9e-82
WP_167840120.1|555556_555838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841106.1|555868_556399_+	hypothetical protein	NA	D2J063	Enterococcus_phage	47.2	1.0e-38
WP_167841107.1|556395_556713_+|head,tail	phage head-tail adapter protein	head,tail	A0A1S5S9Y9	Streptococcus_phage	35.6	5.5e-11
WP_167840118.1|556712_557111_+	HK97 gp10 family phage protein	NA	A0A1S5SAB8	Streptococcus_phage	59.4	7.3e-37
WP_167841108.1|557110_557488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841109.1|557488_558109_+	hypothetical protein	NA	A0A1S5S9Y8	Streptococcus_phage	48.7	8.4e-48
WP_167841110.1|558164_558407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841111.1|558403_558925_+	hypothetical protein	NA	D2J068	Enterococcus_phage	27.5	5.5e-08
WP_143188716.1|558993_559242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841112.1|559198_561496_+|tail	phage tail protein	tail	A5GYM8	Lactococcus_phage	68.4	3.8e-77
WP_167841113.1|561497_563450_+|plate	phage baseplate protein	plate	A0A126HC01	Lactococcus_phage	67.2	2.4e-64
WP_167841114.1|563446_564490_+	hypothetical protein	NA	Q5K5I4	Oenococcus_phage	33.5	7.3e-44
WP_167841115.1|564500_565292_+	hypothetical protein	NA	A8ATQ5	Listeria_phage	26.6	4.7e-11
WP_167841648.1|565304_565595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841116.1|565597_565810_+|holin	holin	holin	A0A1U9WRD5	Streptococcus_virus	51.5	1.1e-10
WP_167841117.1|565809_566604_+	hypothetical protein	NA	A0A0N6WMQ4	Lactococcus_phage	44.4	4.0e-26
WP_167840107.1|566718_566889_+	hypothetical protein	NA	A0A182BQ76	Lactococcus_phage	61.1	3.1e-05
567365:567382	attR	CAATTTGTGTTTGAGTAG	NA	NA	NA	NA
>prophage 2
NZ_CP047628	Lactococcus raffinolactis strain Lr_19_14 chromosome, complete genome	2368909	808443	818123	2368909	bacteriocin,integrase	Lactococcus_phage(80.0%)	16	808410:808432	820475:820497
808410:808432	attL	TTAACTAGCCTTTTAACTAGCCC	NA	NA	NA	NA
WP_167841185.1|808443_809628_-|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	47.8	2.8e-92
WP_167841186.1|809742_809949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138492423.1|810230_810395_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_167841187.1|810680_810860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841188.1|810984_811446_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	57.8	3.2e-12
WP_167841189.1|811601_811805_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I5U5	Streptococcus_phage	52.5	1.0e-10
WP_167841190.1|811945_812392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841191.1|812388_812673_+	hypothetical protein	NA	Q9AZJ1	Lactococcus_phage	58.0	1.5e-20
WP_167841192.1|812685_813102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841193.1|813146_813476_+	hypothetical protein	NA	Q9AZI7	Lactococcus_phage	71.7	1.3e-36
WP_167841194.1|813479_814280_+	hypothetical protein	NA	Q9AZI6	Lactococcus_phage	67.0	4.6e-107
WP_167841195.1|814290_815937_+	DNA primase	NA	Q9AZI5	Lactococcus_phage	73.1	5.2e-238
WP_167841196.1|816382_816847_+	hypothetical protein	NA	Q9AZI4	Lactococcus_phage	48.6	8.9e-10
WP_167841197.1|816903_817053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841198.1|817172_817748_+	hypothetical protein	NA	Q9AZG7	Lactococcus_phage	79.8	2.1e-77
WP_167841199.1|817760_818123_+	hypothetical protein	NA	Q9AZG6	Lactococcus_phage	94.2	1.7e-53
820475:820497	attR	TTAACTAGCCTTTTAACTAGCCC	NA	NA	NA	NA
>prophage 3
NZ_CP047628	Lactococcus raffinolactis strain Lr_19_14 chromosome, complete genome	2368909	1004044	1113508	2368909	plate,head,capsid,tRNA,protease,portal,tail,terminase,integrase,holin	Bacillus_phage(16.67%)	113	1091485:1091500	1113649:1113664
WP_061775007.1|1004044_1004563_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_138491569.1|1004559_1005177_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_167841240.1|1005166_1007566_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.9	5.9e-57
WP_061775009.1|1007721_1008069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156470231.1|1008163_1008328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004261808.1|1008772_1009114_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_061775011.1|1009233_1009719_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_061775012.1|1009808_1010063_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_167841241.1|1010323_1010917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841242.1|1010913_1011615_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167841243.1|1011621_1012866_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_096040353.1|1012942_1014601_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_061775017.1|1014672_1015383_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_167841244.1|1015366_1016581_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_138491574.1|1016755_1018261_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_167841245.1|1018324_1018972_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_167841246.1|1018986_1020000_-	lactonase family protein	NA	NA	NA	NA	NA
WP_061775021.1|1020245_1021403_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_167838762.1|1021593_1022583_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_096040358.1|1022587_1023163_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_061775024.1|1023159_1023531_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_167841247.1|1023571_1025023_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167841248.1|1025076_1025541_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_167838760.1|1025703_1027200_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_061774289.1|1027232_1029068_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_167841249.1|1029067_1029781_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	33.7	7.7e-29
WP_138491705.1|1029850_1031347_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	35.1	3.7e-25
WP_167372321.1|1031420_1032125_-	response regulator	NA	W8CYM9	Bacillus_phage	32.9	4.0e-22
WP_167841250.1|1032515_1032653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841251.1|1032727_1033933_-|integrase	site-specific integrase	integrase	A0A1X9I6A9	Streptococcus_phage	42.2	9.5e-80
WP_167841252.1|1034015_1034924_-	exonuclease	NA	G3MAD3	Bacillus_virus	28.3	8.3e-12
WP_167841253.1|1034955_1035336_-	helix-turn-helix domain-containing protein	NA	Q9AZQ8	Lactococcus_phage	39.1	2.0e-15
WP_167841254.1|1035478_1035697_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167841255.1|1035847_1036021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841256.1|1036119_1036278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841257.1|1036725_1036992_+	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_167841258.1|1037067_1037442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841259.1|1037428_1037617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841657.1|1037637_1038567_+	site-specific DNA-methyltransferase	NA	X2KR14	Campylobacter_phage	60.1	1.1e-86
WP_167841260.1|1038712_1039096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841261.1|1039245_1039446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839997.1|1039445_1039727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840888.1|1039716_1040058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841262.1|1040044_1040269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841263.1|1040270_1040606_+	hypothetical protein	NA	M1NRW0	Streptococcus_phage	56.4	2.8e-29
WP_167841264.1|1040753_1041305_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	50.8	2.7e-42
WP_167841265.1|1041313_1042105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841266.1|1042331_1043171_+	hypothetical protein	NA	H7BUL9	unidentified_phage	33.3	4.8e-22
WP_167841267.1|1043174_1043588_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220G9T0	Streptococcus_phage	50.7	4.8e-31
WP_167841268.1|1043598_1044042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138491606.1|1044059_1044494_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_167841269.1|1044624_1044921_+	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	40.6	2.1e-09
WP_138491608.1|1044917_1045286_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	70.7	3.8e-48
WP_167841270.1|1045387_1045813_+|terminase	P27 family phage terminase small subunit	terminase	A0A1B0T688	Bacillus_phage	65.0	1.6e-45
WP_167841271.1|1045809_1047534_+|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	84.8	8.8e-297
WP_138491611.1|1047547_1048753_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	73.3	4.4e-170
WP_138491613.1|1048715_1049297_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	71.4	2.5e-70
WP_167841272.1|1049296_1050628_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.8	1.2e-128
WP_167841273.1|1050629_1050896_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J865	uncultured_Caudovirales_phage	74.4	7.0e-28
WP_167841274.1|1050879_1051203_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	52.4	1.9e-19
WP_167841275.1|1051192_1051534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841276.1|1051523_1051889_+	HK97 gp10 family phage protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	40.5	2.6e-17
WP_167841277.1|1051891_1052533_+|tail	phage tail protein	tail	A0A0P0I7R6	Lactobacillus_phage	32.8	2.8e-22
WP_138491618.1|1052532_1052991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841278.1|1053179_1055489_+|tail	phage tail tape measure protein	tail	R4IBU8	Listeria_phage	39.9	2.5e-76
WP_167841279.1|1055485_1056199_+|tail	phage tail protein	tail	Q9T1E6	Lactobacillus_phage	25.1	1.4e-06
WP_167841280.1|1056195_1058829_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1L2JXP5	Streptococcus_phage	69.1	2.2e-222
WP_167841281.1|1058839_1061311_+|plate	BppU family phage baseplate upper protein	plate	A0A1P8BM97	Lactococcus_phage	75.8	4.4e-124
WP_167841282.1|1061450_1061852_+|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	61.5	1.4e-40
WP_167841283.1|1061848_1062532_+	CHAP domain-containing protein	NA	D3W0F3	Lactococcus_phage	38.2	6.5e-25
WP_096040362.1|1064318_1064999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138491633.1|1064991_1065516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841284.1|1065512_1066808_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_138491636.1|1066807_1067110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061774231.1|1067223_1067553_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_061774232.1|1067693_1069214_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_061774233.1|1069290_1069773_+	shikimate kinase	NA	NA	NA	NA	NA
WP_167838746.1|1069769_1070597_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_096040367.1|1070790_1071138_+	YxeA family protein	NA	NA	NA	NA	NA
WP_061774236.1|1071137_1071890_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	6.6e-31
WP_167841285.1|1071889_1073866_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_096040369.1|1073965_1074622_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_096040370.1|1074618_1075575_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_167841286.1|1075934_1085705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040372.1|1085898_1087245_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_096040373.1|1087331_1088582_+	diaminopimelate decarboxylase	NA	A0A1V0SKK0	Klosneuvirus	20.7	3.9e-12
WP_003140136.1|1088646_1088883_+	YneF family protein	NA	NA	NA	NA	NA
WP_167841287.1|1089048_1089843_+	glutamate racemase	NA	NA	NA	NA	NA
WP_138491652.1|1089839_1090766_+	nucleoside-triphosphate diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.7	3.2e-11
WP_138491654.1|1090773_1091292_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_167841288.1|1091288_1091756_+	CBS domain-containing protein	NA	NA	NA	NA	NA
1091485:1091500	attL	TTATCAACTTTGAAAT	NA	NA	NA	NA
WP_167841289.1|1091736_1092459_+	site-specific tyrosine recombinase XerD	NA	NA	NA	NA	NA
WP_096040377.1|1092474_1093215_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.5	1.1e-06
WP_061774249.1|1093215_1093788_+	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.8	6.6e-15
WP_061774250.1|1093777_1094497_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_096040378.1|1094861_1095455_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_061774252.1|1095674_1096175_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_031365550.1|1096290_1096656_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_167841290.1|1096980_1098435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167838749.1|1098838_1099603_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_167838750.1|1099637_1100408_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_167841291.1|1100443_1101562_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_167841292.1|1101663_1101996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841293.1|1101976_1104565_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_096040386.1|1104712_1105057_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_138491667.1|1105175_1106246_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_082785373.1|1106384_1107026_+	cytochrome O ubiquinol oxidase	NA	NA	NA	NA	NA
WP_096040388.1|1107093_1108443_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_096040389.1|1108601_1109633_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_061774261.1|1109776_1110532_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_167841294.1|1110528_1111299_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	40.8	1.1e-25
WP_061774263.1|1111285_1112161_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_167841295.1|1112251_1113508_-|integrase	site-specific integrase	integrase	A0A1X9I6A9	Streptococcus_phage	26.3	1.2e-21
1113649:1113664	attR	ATTTCAAAGTTGATAA	NA	NA	NA	NA
>prophage 4
NZ_CP047628	Lactococcus raffinolactis strain Lr_19_14 chromosome, complete genome	2368909	1119208	1176599	2368909	integrase,transposase	Streptococcus_phage(30.77%)	52	1116089:1116105	1120613:1120629
1116089:1116105	attL	AAATATTTTTAAAATTT	NA	NA	NA	NA
WP_167841301.1|1119208_1120489_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZF9	Lactococcus_phage	27.7	1.2e-27
WP_138491701.1|1120588_1120816_-	DNA-binding protein	NA	Q9AZF3	Lactococcus_phage	53.4	6.9e-16
1120613:1120629	attR	AAATTTTAAAAATATTT	NA	NA	NA	NA
WP_167841302.1|1120996_1121197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138491703.1|1121202_1121421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841303.1|1121432_1121834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841304.1|1122797_1123316_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	44.2	1.4e-32
WP_167841305.1|1123350_1124136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096814528.1|1124162_1124501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096814529.1|1124515_1124944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841306.1|1124954_1126013_-	CHAP domain-containing protein	NA	Q4Z9D9	Staphylococcus_phage	38.5	1.7e-08
WP_167841307.1|1126009_1128358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096814532.1|1128373_1130878_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_167838932.1|1130849_1131251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094783918.1|1131255_1131495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841308.1|1131501_1132746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157905767.1|1132723_1132876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841309.1|1132889_1133324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841310.1|1133399_1137584_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_167841311.1|1137702_1138296_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_096814538.1|1138516_1138798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096814539.1|1138870_1140145_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_167838940.1|1140386_1142057_-	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	32.8	3.5e-48
WP_096814541.1|1142071_1142539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096814542.1|1142538_1142841_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_167841312.1|1142973_1143216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096814544.1|1143437_1143878_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_167841313.1|1144142_1146029_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6C7	Streptococcus_phage	32.3	2.3e-80
WP_001048115.1|1146376_1147375_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_167841659.1|1147500_1148379_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.1	2.0e-31
WP_167841314.1|1148381_1148669_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167841315.1|1148757_1149904_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	3.5e-47
WP_024047037.1|1150050_1151049_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_167841316.1|1151408_1152290_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.0	5.7e-74
WP_167841317.1|1152419_1153592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841318.1|1153668_1154802_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	62.3	2.5e-138
WP_167841319.1|1155035_1156205_-	nucleotide sugar dehydrogenase	NA	M1IAF7	Acanthocystis_turfacea_Chlorella_virus	50.5	7.5e-106
WP_167841320.1|1156215_1160085_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	35.8	6.9e-07
WP_167841321.1|1160226_1161690_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_167841322.1|1161696_1162113_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A0K0KVL9	Prochlorococcus_phage	37.5	3.6e-10
WP_167841323.1|1162109_1163219_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_167841324.1|1163215_1164394_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_167841325.1|1164397_1164844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841326.1|1164858_1165668_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_167841660.1|1167676_1169056_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_167841327.1|1169237_1170119_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_167841328.1|1170121_1171039_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_167841329.1|1171164_1172112_-	LCP family protein	NA	NA	NA	NA	NA
WP_167841330.1|1172118_1172511_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_167841331.1|1172512_1173496_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_003138303.1|1173470_1173701_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_167841660.1|1173856_1175236_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001048115.1|1175600_1176599_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP047628	Lactococcus raffinolactis strain Lr_19_14 chromosome, complete genome	2368909	1197242	1206165	2368909		Enterococcus_phage(28.57%)	10	NA	NA
WP_061774280.1|1197242_1199060_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	37.2	1.7e-88
WP_167838731.1|1199181_1199874_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SD15	Streptococcus_phage	50.0	1.9e-64
WP_061774282.1|1199973_1200615_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_061774283.1|1200719_1200938_+	glutaredoxin-like protein NrdH	NA	A0A1W6JHV4	Lactococcus_phage	47.6	1.3e-11
WP_061774284.1|1200934_1201291_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	D9J0S1	Brochothrix_phage	35.2	3.7e-16
WP_061774285.1|1201295_1203449_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.4	5.2e-254
WP_167372353.1|1203569_1204529_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	67.1	1.1e-123
WP_167841342.1|1204584_1205454_-	glutathione-dependent reductase	NA	NA	NA	NA	NA
WP_004260832.1|1205489_1205627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061774287.1|1205754_1206165_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	45.9	3.1e-30
>prophage 6
NZ_CP047628	Lactococcus raffinolactis strain Lr_19_14 chromosome, complete genome	2368909	1817763	1877164	2368909	integrase,tRNA,protease,transposase	Streptococcus_phage(36.36%)	57	1817014:1817029	1882642:1882657
1817014:1817029	attL	GTTTTTAGCTTCTTGA	NA	NA	NA	NA
WP_061775221.1|1817763_1818360_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.0	1.3e-53
WP_167841496.1|1818559_1819996_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_061775219.1|1820704_1821703_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_061775218.1|1821806_1822733_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	73.9	6.3e-124
WP_061775217.1|1822866_1823478_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	57.1	4.0e-66
WP_061775224.1|1823673_1824510_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_167841674.1|1824633_1825494_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	67.2	3.6e-97
WP_096040505.1|1825493_1825820_-	DUF972 family protein	NA	M1PFV3	Streptococcus_phage	41.9	4.4e-16
WP_061775215.1|1825831_1826602_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_061775214.1|1826644_1827508_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	47.1	2.8e-65
WP_061775213.1|1827494_1828142_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	60.0	7.6e-68
WP_061775212.1|1828155_1828887_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_061775211.1|1828919_1829588_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_061775210.1|1829606_1830290_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_167841497.1|1830360_1831167_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_061775208.1|1831247_1831988_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	2.0e-35
WP_061775207.1|1832227_1832935_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.3	3.7e-39
WP_096039498.1|1832924_1834367_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.3	7.0e-37
WP_061775205.1|1834450_1835257_+	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	38.0	3.9e-37
WP_082785431.1|1835285_1835405_-	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_061775222.1|1835881_1836172_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_061775204.1|1836313_1837774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061774877.1|1838040_1838922_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_061774876.1|1839128_1842542_-	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_061774881.1|1842665_1843922_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_072353592.1|1844224_1844371_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_167841675.1|1844360_1845566_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_138492023.1|1845707_1846295_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_061774874.1|1846384_1846690_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_167841676.1|1846752_1847631_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.1	2.0e-31
WP_167841498.1|1847633_1847921_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167841499.1|1848037_1849441_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_096039504.1|1849650_1851951_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	32.9	2.1e-115
WP_061774871.1|1852151_1853066_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_096039505.1|1853089_1854214_-	teicoplanin resistance protein VanZ	NA	NA	NA	NA	NA
WP_061774869.1|1854313_1855639_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	81.2	9.4e-198
WP_096039506.1|1855869_1856421_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_167841500.1|1856511_1858956_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.6	4.8e-123
WP_167372298.1|1858984_1859449_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061774866.1|1859814_1860516_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SD15	Streptococcus_phage	48.1	2.8e-55
WP_167841501.1|1860562_1862008_+	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	58.6	2.8e-155
WP_167372299.1|1862004_1862175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061774864.1|1862210_1862612_+	YbgA family protein	NA	NA	NA	NA	NA
WP_167841502.1|1862595_1862958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003140218.1|1863046_1863529_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_167841503.1|1863620_1865264_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_068164079.1|1865494_1866445_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.0	2.5e-35
WP_167841504.1|1866491_1867076_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_061774860.1|1867419_1867932_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.1	2.0e-31
WP_167841505.1|1867933_1870159_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.0	1.3e-74
WP_167841506.1|1870155_1870887_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_138492409.1|1870883_1871825_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_061774856.1|1872123_1873020_-	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	36.7	4.1e-35
WP_061774855.1|1873016_1873691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841507.1|1873665_1874931_-	GTPase HflX	NA	NA	NA	NA	NA
WP_061774853.1|1874917_1875829_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_061774852.1|1876000_1877164_-|integrase	site-specific integrase	integrase	C9E2L6	Enterococcus_phage	36.2	6.8e-51
1882642:1882657	attR	GTTTTTAGCTTCTTGA	NA	NA	NA	NA
>prophage 7
NZ_CP047628	Lactococcus raffinolactis strain Lr_19_14 chromosome, complete genome	2368909	1951985	2055843	2368909	tRNA,protease,transposase,holin	Streptococcus_phage(33.33%)	95	NA	NA
WP_068164079.1|1951985_1952936_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.0	2.5e-35
WP_061774678.1|1953199_1953757_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_167841538.1|1953787_1954507_-	UMP kinase	NA	NA	NA	NA	NA
WP_096039558.1|1954746_1955940_-	acetate kinase	NA	NA	NA	NA	NA
WP_167841539.1|1956248_1957184_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_167841540.1|1957345_1957834_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_138492113.1|1957944_1959279_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_138492112.1|1959547_1960159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096039562.1|1960294_1963408_-	DEAD/DEAH box helicase family protein	NA	E5ER62	Bathycoccus_sp._RCC1105_virus	30.6	8.3e-43
WP_138492110.1|1963673_1964678_-	serine hydrolase	NA	NA	NA	NA	NA
WP_167841541.1|1964674_1965343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841542.1|1965613_1966324_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_096039564.1|1966408_1967311_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_167841543.1|1967581_1969894_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_096039566.1|1969890_1970613_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_096039567.1|1970830_1970962_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_167839074.1|1971122_1971611_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096039569.1|1971613_1973062_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_096039570.1|1973206_1973689_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_061774662.1|1973675_1974437_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_167841544.1|1974492_1975173_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_061774660.1|1975169_1976243_-	TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_167841545.1|1976471_1977833_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_061774658.1|1977834_1978281_-	dUTP diphosphatase	NA	Q332E8	Clostridium_botulinum_C_phage	49.3	7.9e-32
WP_167839076.1|1978363_1980115_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	3.6e-43
WP_167841546.1|1980107_1981826_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	1.2e-46
WP_001048115.1|1982223_1983222_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_071519144.1|1983355_1983643_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096815456.1|1984754_1985387_-	FusB/FusC family EF-G-binding protein	NA	NA	NA	NA	NA
WP_167841547.1|1985622_1986303_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	3.4e-127
WP_003129983.1|1986386_1986764_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_096040574.1|1987036_1987987_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.0	1.7e-95
WP_096040575.1|1988922_1989876_-	ribonucleotide-diphosphate reductase subunit beta	NA	NA	NA	NA	NA
WP_167841548.1|1989885_1992042_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	57.7	1.5e-240
WP_096040577.1|1992076_1992844_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_096040578.1|1993001_1993673_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_001015311.1|1993743_1994424_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_167840890.1|1995141_1995324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021464853.1|1995363_1996032_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001015311.1|1996171_1996852_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_167840280.1|1997162_1998068_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_138492587.1|1998510_1999035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047916692.1|1999358_2000039_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	5.0e-110
WP_167841549.1|2000176_2000410_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_167841550.1|2000684_2001674_-	permease	NA	NA	NA	NA	NA
WP_167841551.1|2001673_2002006_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047916692.1|2002324_2003005_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	5.0e-110
WP_167841552.1|2003361_2004642_-	McrC family protein	NA	NA	NA	NA	NA
WP_167841679.1|2004643_2006206_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.1	2.9e-36
WP_167841676.1|2006911_2007790_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.1	2.0e-31
WP_167841498.1|2007792_2008080_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001048115.1|2008213_2009212_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003135293.1|2010016_2010166_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003138753.1|2010184_2010352_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_167841553.1|2010450_2011692_-	MFS transporter	NA	NA	NA	NA	NA
WP_167841554.1|2011768_2014432_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	39.3	4.6e-143
WP_167841555.1|2014633_2015842_-	YdcF family protein	NA	NA	NA	NA	NA
WP_096039596.1|2016140_2016440_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_167841556.1|2016622_2017525_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061774646.1|2017883_2018180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061774645.1|2018198_2019389_+	MFS transporter	NA	NA	NA	NA	NA
WP_061775372.1|2019803_2020058_-	DUF1912 family protein	NA	NA	NA	NA	NA
WP_167841557.1|2020101_2020599_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096039598.1|2020595_2021933_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	33.2	6.6e-66
WP_096039599.1|2021969_2022764_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_167840298.1|2022790_2023504_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_061775367.1|2023669_2023981_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_003140392.1|2024156_2024402_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_096039601.1|2024450_2024960_-	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	67.8	1.6e-52
WP_061775365.1|2024996_2025296_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_096039602.1|2025491_2025803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167372301.1|2025944_2026289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841558.1|2026299_2026953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841559.1|2027029_2032402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841560.1|2032394_2032904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841561.1|2033376_2034189_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167841562.1|2034382_2035216_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_167840300.1|2035411_2037007_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_096039607.1|2037003_2037744_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	9.4e-30
WP_167839102.1|2037800_2039429_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	43.2	6.9e-49
WP_061775450.1|2039425_2039926_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_061775449.1|2039982_2040252_+	chorismate mutase	NA	NA	NA	NA	NA
WP_096039609.1|2040248_2041466_+	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	47.7	9.9e-85
WP_096039610.1|2041540_2041921_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_096039611.1|2041993_2044102_-	glutamine synthetase type III	NA	NA	NA	NA	NA
WP_061774151.1|2044286_2045627_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_061774152.1|2045734_2046097_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096039613.1|2046212_2046527_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_096039614.1|2046530_2047550_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	34.2	1.7e-08
WP_061774155.1|2048011_2048593_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_096039615.1|2048718_2050641_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.5	3.9e-67
WP_096040512.1|2050707_2053224_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.3	2.4e-40
WP_061774161.1|2053258_2053636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061774162.1|2053616_2054093_-	arginine repressor	NA	NA	NA	NA	NA
WP_138492152.1|2054151_2055843_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	35.0	3.0e-79
>prophage 8
NZ_CP047628	Lactococcus raffinolactis strain Lr_19_14 chromosome, complete genome	2368909	2265427	2322308	2368909	bacteriocin,tRNA,transposase	Streptococcus_phage(28.57%)	57	NA	NA
WP_061774689.1|2265427_2265883_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_096039749.1|2266138_2268349_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	35.5	2.2e-10
WP_167841600.1|2268540_2269287_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_096039751.1|2269293_2270250_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_061774682.1|2270343_2270769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096039752.1|2270786_2271257_-	DUF3013 family protein	NA	NA	NA	NA	NA
WP_096039753.1|2271503_2272025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841601.1|2272264_2273521_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.1	3.5e-93
WP_096039755.1|2273588_2274314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096039756.1|2274318_2274504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841602.1|2274576_2275287_-	sortase	NA	NA	NA	NA	NA
WP_167840360.1|2275334_2276450_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_061775328.1|2276696_2277470_+	NUDIX hydrolase	NA	A0A142EZP1	Stenotrophomonas_phage	31.8	1.7e-10
WP_167841603.1|2277554_2277803_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_061775326.1|2277803_2278805_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_096039760.1|2278984_2279797_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_096039761.1|2280016_2280637_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_167841604.1|2280761_2282570_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_061775322.1|2282581_2283382_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_061775321.1|2283435_2285058_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.1	1.7e-47
WP_061775288.1|2286192_2287215_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_061775287.1|2287214_2287853_+	HD domain-containing protein	NA	A0A1S5XYU7	Kurlavirus	32.4	1.8e-13
WP_167372340.1|2287953_2288688_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	34.0	2.7e-13
WP_138492446.1|2288950_2289706_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_061775285.1|2289826_2291002_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_138492447.1|2291662_2291899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841605.1|2292126_2294214_+	copper-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.2	2.3e-20
WP_046125153.1|2294267_2294825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156470234.1|2296009_2296147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167841682.1|2296274_2297666_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_061775281.1|2297927_2298143_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_167372358.1|2298142_2298940_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_167841606.1|2299136_2300531_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011669094.1|2300518_2301187_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.9	1.2e-36
WP_167841607.1|2301479_2301953_+	type I restriction endonuclease	NA	NA	NA	NA	NA
WP_167841608.1|2302026_2302614_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.1	1.8e-20
WP_040526183.1|2302606_2302873_-	DUF3781 domain-containing protein	NA	NA	NA	NA	NA
WP_146978469.1|2303289_2303787_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_167841609.1|2303955_2304801_-	helix-turn-helix domain-containing protein	NA	A0A1B0RXG1	Streptococcus_phage	42.9	2.8e-22
WP_167841610.1|2304915_2305143_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167841611.1|2305170_2305851_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	1.7e-110
WP_047916764.1|2306843_2307413_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_037619900.1|2307495_2307819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841612.1|2307846_2308581_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_071519144.1|2309604_2309892_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_061775570.1|2310695_2311034_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_167841613.1|2311382_2312063_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.4	8.5e-110
WP_081144397.1|2312224_2313229_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_167841614.1|2313351_2313903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138491985.1|2314076_2314601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841615.1|2314947_2315091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047916692.1|2315122_2315803_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	5.0e-110
WP_167841616.1|2316213_2316768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841617.1|2317183_2319523_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_167841618.1|2319571_2319913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167841047.1|2321139_2321427_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167841643.1|2321429_2322308_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.1	1.2e-31
