The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047614	Lactococcus raffinolactis strain Lr_19_7 chromosome, complete genome	2381691	101084	147275	2381691	transposase,integrase	Streptococcus_phage(22.22%)	36	144675:144734	149247:150534
WP_024047037.1|101084_102083_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_167839588.1|102386_103274_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.4	5.7e-74
WP_167839589.1|103395_104529_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	62.8	1.1e-138
WP_167839590.1|104611_105376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167839591.1|105394_105772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167839592.1|105930_108450_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_167839593.1|108565_111181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167839594.1|111188_111617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840369.1|111678_113130_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_167839595.1|113116_113548_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A0K0KVL9	Prochlorococcus_phage	37.5	2.8e-10
WP_167839596.1|113544_114654_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_167839597.1|114650_115829_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_167839598.1|115928_116738_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_167840370.1|116765_118295_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.3	3.5e-10
WP_167839599.1|118646_119645_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_167839600.1|120959_121862_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_167839601.1|123442_124345_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048115.1|124580_125579_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_167839170.1|126101_126755_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_167839169.1|126782_127061_-	iron-sulfur cluster repair di-iron protein, ric	NA	NA	NA	NA	NA
WP_031367082.1|127078_127306_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_167839602.1|127385_129236_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	1.4e-103
WP_031367084.1|129365_129944_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_167839603.1|130126_130849_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.7	2.6e-24
WP_096039832.1|130845_132030_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_167839604.1|132055_132694_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167839605.1|134004_137235_+	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_167839606.1|137236_137968_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_167839607.1|138031_139540_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_064686962.1|139625_140822_+	class C sortase	NA	NA	NA	NA	NA
WP_010784089.1|140818_141940_+	class C sortase	NA	NA	NA	NA	NA
WP_167839608.1|142121_143057_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	7.7e-37
144675:144734	attL	ACTGAACAGCTCCTGGTAAAATGGACATGAAATAAAAAAACTATTTCAATCATTTTATCA	NA	NA	NA	NA
WP_071519144.1|144746_145034_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167839609.1|145369_145915_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.7	4.1e-30
WP_003136100.1|146004_146217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167839610.1|146219_147275_-|integrase	site-specific integrase	integrase	Q9ZXG6	Leuconostoc_phage	28.4	7.1e-31
149247:150534	attR	ACTGAACAGCTCCTGGTAAAATGGACATGAAATAAAAAAACTATTTCAATCATTTTATCAAGGAGTTTTTTCATGCGTAAAAATCAGAACTACACGGGCGACTTTAAAGTAAAGGTTGCACAAGCTTATCTTTTTGACCACTTAGGTGGCTATCAATCAGTGGCAGAACATTTTGGTGTCACCAATCGCTCACAAGTACAACATTGGGTTAAATTGTACGAGAACAATCCTCAACTTCTCTATCAAGATAATCGTGGTAGACCGGCACAACTTAAGTCAGAGACGATGACTTTAGAAGAACAAGTCAACTATCTCAAAATGGAGGTAGCTATTCTAAAAAAGCTCAGAAAGCTCTTGTAAAAATCTCTACAAGAGCTAAGTATCAAGTCGTTGATAGTTTAACAGGACAGTATGCCATTACTGCTCTTTGTCATTATCTTGGTATTTCAAGGAGTGGTTATTATAGCTGGATAAAGAAAAACCGCCCCCTTACAAAATCTTGGAATTCTCAGCTGGCAGAGAAGATTCAACTTCTCTTTGATGCCTCTTTTAAGGGCTATCGCTATATCTGGATGCAACTTAAGCGACTTTATGGTATAAGCGTCAACCCAAAGACTGTCCTTCGCTATATGCAAGTTCTCGGTTTGAAATCGCCAATACGCAAGAAACGCTTTACTTCTTGCACGAGGCAAGAAATGAACAAAAAAGCGAGAAAGGTTTTGCCAAACCTTCTCGCAAGACACTTCGTCGCCACACGACCTCATGAAAAGTTAGTGACAGACGTTTCTTATGTGTATCATAAACAGGGTAGACTGTACTTAAGTATTATCAAAGACCTGTATGATAACTCTATTTTAGCTTACAATCTATCAAAATTCAATGATAATCAGTTAGTCTTTGAGAATTTAGACCTTGTTTTCAGAAAAGATTGGGACAAATCAAAATCTTGTCTTTTGCATTCAGATCAAGGATTTCAGTATACGAACAAGCAGTATCACAAAAAACTTGAAACTTTTAATGTGACCGTTTCTCATTCTCGTAAGGGAAACTGTTATGACAACGCTTGTTGTGAAAACTTTTTTTCTCATCTTAAAAGTGAATCTTTGGAATTATTTGTACCTGAAAATGAGACGGAATTGATGCAGCAGATTGACGATTTCATTACATGGTATAACTTTGATAGACCACAACTCAAACTAAAAGGCATGACTCCTATTGAATATAGGCAGACATACCTTTGAGTGGAAATGTGTTTTTTTGAACTGTCTGTTTTATTTGGGGCTTGACA	NA	NA	NA	NA
>prophage 2
NZ_CP047614	Lactococcus raffinolactis strain Lr_19_7 chromosome, complete genome	2381691	408963	445830	2381691	integrase,terminase,head,tail,holin,capsid,portal,protease	Lactococcus_phage(48.72%)	56	411326:411342	445920:445936
WP_167839723.1|408963_410238_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	55.0	3.9e-124
WP_096039992.1|410281_410905_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	54.4	1.4e-55
411326:411342	attL	ACTCCCCTCGGCTCCAT	NA	NA	NA	NA
WP_167839724.1|411473_412556_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	61.4	2.4e-127
WP_167839725.1|412678_413230_-	hypothetical protein	NA	A0A097BY93	Leuconostoc_phage	61.4	5.6e-11
WP_167839726.1|413328_414030_-	helix-turn-helix transcriptional regulator	NA	E8ZDN4	Streptococcus_phage	49.4	4.4e-61
WP_167839727.1|414223_414451_+	hypothetical protein	NA	A0A1P8BLF6	Lactococcus_phage	76.0	4.4e-23
WP_167839728.1|414473_415250_+	phage antirepressor	NA	Q38330	Lactococcus_phage	59.9	1.0e-79
WP_167839729.1|415315_415603_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167839730.1|415858_416341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839731.1|416333_416672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839732.1|416664_416925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839733.1|416926_417328_+	hypothetical protein	NA	A0A1X9IGE4	Lactococcus_phage	56.8	4.5e-34
WP_167839734.1|417339_417915_+	single-stranded DNA-binding protein	NA	A0A097BYA9	Leuconostoc_phage	58.2	1.9e-54
WP_167839735.1|417919_418372_+	single-stranded DNA-binding protein	NA	Q0ILF5	Lactococcus_phage	57.9	2.3e-39
WP_167839736.1|418383_418539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839737.1|418540_419287_+	DNA replication protein	NA	A0A1P8BKE9	Lactococcus_phage	80.5	4.8e-114
WP_167839738.1|419298_419691_+	hypothetical protein	NA	A0A141E189	Streptococcus_phage	49.2	1.1e-08
WP_167839739.1|419703_420582_+	ATP-binding protein	NA	R9QM21	Lactococcus_phage	50.0	2.0e-71
WP_167839740.1|420590_421022_+	DUF3850 domain-containing protein	NA	A0A097BYG6	Leuconostoc_phage	47.3	3.7e-10
WP_167839741.1|421018_421423_+	RusA family crossover junction endodeoxyribonuclease	NA	Q9MC30	Lactococcus_phage	66.2	3.8e-41
WP_167839742.1|421412_421688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839743.1|421692_422088_+	hypothetical protein	NA	A0A059T7T5	Listeria_phage	34.6	2.3e-06
WP_167839744.1|422071_422470_+	hypothetical protein	NA	J7KJ21	Streptococcus_phage	35.9	2.5e-13
WP_167839745.1|422473_422800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839746.1|422792_423011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839747.1|423007_423133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839748.1|423145_423691_+	DUF1642 domain-containing protein	NA	A5GYN8	Lactococcus_phage	27.9	2.4e-06
WP_167839749.1|423726_423873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839750.1|424121_424607_+	class I SAM-dependent methyltransferase	NA	D2IYU6	Enterococcus_phage	55.6	2.3e-48
WP_167839751.1|424855_425065_+	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.0	1.3e-08
WP_167839550.1|425071_425440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839752.1|425475_425877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839753.1|427118_427367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839754.1|427375_427531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839755.1|427588_427906_+	HNH endonuclease	NA	Q9AZZ0	Lactococcus_phage	60.5	5.6e-24
WP_167839756.1|428002_428347_+|terminase	P27 family phage terminase small subunit	terminase	Q9AZY9	Lactococcus_phage	61.1	2.1e-32
WP_167839757.1|428359_430165_+|terminase	terminase large subunit	terminase	Q9AZY8	Lactococcus_phage	69.9	6.7e-247
WP_167839758.1|430174_431371_+|portal	phage portal protein	portal	Q9AZY7	Lactococcus_phage	62.6	2.8e-140
WP_167839759.1|431370_431973_+|head,protease	HK97 family phage prohead protease	head,protease	Q9AZY6	Lactococcus_phage	66.5	3.5e-67
WP_167839760.1|431935_433168_+|capsid	phage major capsid protein	capsid	Q9AZY5	Lactococcus_phage	72.5	1.2e-114
WP_167839761.1|433179_433353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839762.1|433345_433636_+	hypothetical protein	NA	Q9AZY3	Lactococcus_phage	60.7	9.1e-21
WP_167839763.1|433628_433940_+|head	phage head closure protein	head	Q9AZY2	Lactococcus_phage	46.7	2.7e-15
WP_167839764.1|433939_434275_+	HK97 gp10 family phage protein	NA	A0A2H4JAN0	uncultured_Caudovirales_phage	45.0	6.0e-16
WP_167839765.1|434271_434592_+	hypothetical protein	NA	Q0H234	Geobacillus_phage	34.9	1.5e-11
WP_167839766.1|434603_435191_+|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	49.2	4.5e-43
WP_167839767.1|435258_435618_+	hypothetical protein	NA	D2XR24	Bacillus_phage	52.9	4.3e-28
WP_167839768.1|435932_438695_+	hypothetical protein	NA	Q9AZX7	Lactococcus_phage	38.1	3.9e-137
WP_167839769.1|438698_439391_+|tail	phage tail protein	tail	A0A2H4J851	uncultured_Caudovirales_phage	43.7	8.2e-36
WP_167839770.1|439387_443299_+	hypothetical protein	NA	A0A1C8E983	Bacillus_phage	46.4	6.9e-87
WP_167839771.1|443445_443673_+	hypothetical protein	NA	Q9AZX0	Lactococcus_phage	65.8	7.9e-20
WP_167839772.1|443688_444087_+|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	62.3	2.4e-40
WP_167839773.1|444175_444367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839774.1|444356_445205_+	peptidoglycan hydrolase	NA	Q9T1D5	Streptococcus_phage	44.1	1.3e-51
WP_167839775.1|445365_445584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839776.1|445641_445830_+	hypothetical protein	NA	A0A1W6JPV9	Staphylococcus_phage	55.1	6.3e-07
445920:445936	attR	ACTCCCCTCGGCTCCAT	NA	NA	NA	NA
>prophage 3
NZ_CP047614	Lactococcus raffinolactis strain Lr_19_7 chromosome, complete genome	2381691	828610	932533	2381691	tRNA,integrase,terminase,head,tail,holin,plate,capsid,portal,protease	Streptococcus_phage(32.79%)	131	893081:893101	929068:929088
WP_167839861.1|828610_829879_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.0	2.5e-94
WP_061773849.1|830107_830497_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_061773850.1|830573_831485_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_096040261.1|831504_832314_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_061773852.1|832331_833321_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_061773853.1|833570_834467_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	33.7	1.5e-05
WP_096040262.1|834487_835657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061773855.1|835897_836473_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_096040264.1|836725_837220_+	EbsA family protein	NA	NA	NA	NA	NA
WP_096040265.1|837258_837456_-	ferredoxin	NA	NA	NA	NA	NA
WP_061773858.1|837484_837955_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_061773859.1|837951_838620_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_138491912.1|838671_839955_+	LCP family protein	NA	NA	NA	NA	NA
WP_061773861.1|840068_840929_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_061773862.1|840932_842309_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_167839862.1|842474_843698_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_096040534.1|844025_845798_+	alpha-glycosidase	NA	NA	NA	NA	NA
WP_061773865.1|845797_847066_+	alpha-amylase	NA	NA	NA	NA	NA
WP_138491914.1|847287_848904_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_167839863.1|849081_850704_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_096040270.1|850859_853127_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_061773869.1|853128_853791_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_167839864.1|853954_854929_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.3	2.7e-16
WP_061773871.1|855047_855719_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	1.2e-26
WP_167839865.1|855755_857111_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.1	2.4e-15
WP_061773943.1|857168_857420_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_061773873.1|857579_858647_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_061773874.1|858660_859329_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.3e-33
WP_096040272.1|859675_860221_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_061773877.1|860244_860763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839866.1|861088_862132_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	34.8	1.1e-44
WP_167839867.1|862248_862929_-	NYN domain-containing protein	NA	A0A0R6PGY5	Moraxella_phage	43.7	1.7e-41
WP_167839868.1|863243_863432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840384.1|863491_864199_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SD15	Streptococcus_phage	55.4	4.0e-70
WP_167839869.1|864618_865437_-	TIGR02391 family protein	NA	A0A059NT45	Lactococcus_phage	55.2	3.2e-79
WP_167839870.1|865608_865827_+	helix-turn-helix transcriptional regulator	NA	J7KK54	Streptococcus_phage	48.4	1.9e-07
WP_167839871.1|865857_866637_+	phage antirepressor Ant	NA	A0A0C5AFE7	Paenibacillus_phage	61.8	1.7e-82
WP_031366573.1|866687_866879_+	hypothetical protein	NA	Q9AZF4	Lactococcus_phage	74.6	5.6e-19
WP_167839872.1|867101_867374_-	DUF3892 domain-containing protein	NA	A0A059NT53	Lactococcus_phage	42.5	8.0e-11
WP_167839873.1|867564_867750_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SDG0	Streptococcus_phage	47.5	8.7e-09
WP_031366575.1|867819_868080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839874.1|868076_868298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839875.1|868449_869268_+	recombinase RecT	NA	A0A1L2JXR5	Streptococcus_phage	65.3	3.7e-75
WP_167839876.1|869269_870307_+	DUF1351 domain-containing protein	NA	A0A2H4J618	uncultured_Caudovirales_phage	29.0	2.6e-17
WP_167839877.1|870306_871107_+	hypothetical protein	NA	A0A1S5S9Y4	Streptococcus_phage	66.9	7.2e-100
WP_167839878.1|871317_871509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839879.1|871510_872347_+	hypothetical protein	NA	A0A1P8BKN4	Lactococcus_phage	30.8	3.4e-20
WP_167839880.1|872340_872613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839881.1|872650_872866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839882.1|872852_873266_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220G9T0	Streptococcus_phage	48.1	3.6e-23
WP_096824046.1|873258_873693_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_167840385.1|873872_874301_+	universal stress protein	NA	NA	NA	NA	NA
WP_031366590.1|874358_874790_+|terminase	terminase small subunit	terminase	D7RWC4	Brochothrix_phage	66.2	2.5e-43
WP_167839883.1|874782_876069_+|terminase	PBSX family phage terminase large subunit	terminase	D7RWC5	Brochothrix_phage	84.0	1.8e-206
WP_167839884.1|876077_877472_+|portal	phage portal protein	portal	A0A0M4S669	Bacillus_phage	42.6	3.3e-84
WP_167839885.1|877404_878952_+|capsid	minor capsid protein	capsid	A0A2H4J4W7	uncultured_Caudovirales_phage	28.3	2.0e-21
WP_167839886.1|878935_879088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839887.1|879185_879434_+	hypothetical protein	NA	A0A1P8BM59	Lactococcus_phage	90.2	3.5e-37
WP_167839888.1|879551_880130_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_167839889.1|880133_881033_+|capsid	capsid protein	capsid	U3PDP8	Lactobacillus_phage	51.4	7.1e-72
WP_167839890.1|881050_881332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839891.1|881340_881667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839892.1|881650_881977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839893.1|881969_882383_+	HK97 gp10 family phage protein	NA	A0A0A7AQU9	Bacillus_phage	41.0	5.3e-14
WP_167839894.1|882382_882754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839895.1|882755_883310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839896.1|883360_883651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839897.1|883677_883965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839898.1|883964_888098_+	hypothetical protein	NA	A0A1D3SNL5	Enterococcus_phage	33.6	1.1e-55
WP_167839899.1|888098_889499_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_167839900.1|889495_890539_+	hypothetical protein	NA	Q5K5I4	Oenococcus_phage	33.8	5.0e-45
WP_167839901.1|890551_891340_+	hypothetical protein	NA	H9EED1	Lactococcus_phage	39.8	1.0e-37
WP_167839902.1|891390_891792_+|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	63.8	2.2e-41
WP_167839903.1|891788_893054_+	LysM peptidoglycan-binding domain-containing protein	NA	Q8LTP4	Lactococcus_phage	59.5	8.9e-137
893081:893101	attL	ATTGTAGGGCTTTTTTTGTAT	NA	NA	NA	NA
WP_167839904.1|893171_893342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839905.1|893358_893682_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_167839906.1|893844_894972_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	54.1	4.0e-112
WP_167839907.1|895303_895987_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_167840386.1|896107_896503_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_167839908.1|896672_897122_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_167839909.1|897288_897891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167839910.1|897943_898288_-	helix-turn-helix transcriptional regulator	NA	A0A141E1S0	Streptococcus_phage	52.3	1.7e-21
WP_167839911.1|898442_898676_+	helix-turn-helix transcriptional regulator	NA	A0A1Q1PVY0	Staphylococcus_phage	62.0	3.2e-16
WP_167839912.1|898738_898891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839913.1|898871_899066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167839914.1|899122_899287_-	YjzC family protein	NA	NA	NA	NA	NA
WP_167839915.1|899437_899623_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_031365319.1|899904_900231_+	DUF771 domain-containing protein	NA	Q8LTN9	Lactococcus_phage	38.7	4.4e-16
WP_167839916.1|900274_900658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839917.1|900635_900818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839918.1|900819_901212_+	hypothetical protein	NA	J7KJ21	Streptococcus_phage	38.2	1.5e-13
WP_167840387.1|901382_902249_+	site-specific DNA-methyltransferase	NA	X2KR14	Campylobacter_phage	68.6	2.4e-93
WP_167839919.1|902261_902663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839920.1|902856_903126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138491596.1|903137_903425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839921.1|903620_903890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839922.1|903886_904843_+	DNA (cytosine-5-)-methyltransferase	NA	H7BVD3	unidentified_phage	55.0	1.1e-94
WP_167839923.1|904829_905288_+	DUF3850 domain-containing protein	NA	A0A097BYG6	Leuconostoc_phage	37.9	6.9e-07
WP_167839924.1|905272_906076_+	DNA adenine methylase	NA	R4IBV6	Listeria_phage	53.4	4.5e-78
WP_167839925.1|906573_907416_+	hypothetical protein	NA	H7BW41	unidentified_phage	25.7	4.2e-10
WP_167839926.1|907417_907861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839927.1|907884_908229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839928.1|908194_908500_+	HNH endonuclease	NA	A0A1S5SFB3	Streptococcus_phage	60.6	9.5e-29
WP_167839929.1|908605_908911_+|terminase	P27 family phage terminase small subunit	terminase	A3F640	Streptococcus_phage	55.7	2.4e-19
WP_167840388.1|908915_910646_+|terminase	terminase large subunit	terminase	A3F641	Streptococcus_phage	65.5	1.0e-231
WP_167839930.1|910764_911889_+|portal	phage portal protein	portal	A3F643	Streptococcus_phage	35.8	8.1e-57
WP_167840389.1|911888_912653_+|protease	Clp protease ClpP	protease	A3F644	Streptococcus_phage	42.4	3.3e-54
WP_167839931.1|912671_913802_+|capsid	phage major capsid protein	capsid	A3F645	Streptococcus_phage	49.9	5.0e-91
WP_167839932.1|913803_914214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839933.1|914221_914539_+	hypothetical protein	NA	A3F647	Streptococcus_phage	48.7	6.7e-09
WP_167839934.1|914513_914888_+|head,tail	phage head-tail adapter protein	head,tail	A0A1S5SFE6	Streptococcus_phage	38.3	1.3e-19
WP_167839935.1|914889_915285_+	hypothetical protein	NA	A3F649	Streptococcus_phage	41.4	2.7e-15
WP_167839936.1|915281_915659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839937.1|915674_916265_+|tail	phage tail protein	tail	A0A1S5SF75	Streptococcus_phage	47.2	4.3e-41
WP_167839938.1|916314_916608_+	hypothetical protein	NA	A3F652	Streptococcus_phage	40.0	2.7e-12
WP_167839939.1|916655_916799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839940.1|916912_917083_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_167839941.1|917113_917506_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CYJ8	Paenibacillus_phage	37.7	2.1e-12
WP_167839942.1|917579_921887_+|tail	phage tail tape measure protein	tail	A3F654	Streptococcus_phage	40.7	4.5e-148
WP_167839943.1|921883_922609_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_167839944.1|922676_926186_+	hypothetical protein	NA	Q938K1	Temperate_phage	33.8	1.1e-56
WP_167839945.1|926172_926586_+	DUF1617 family protein	NA	Q9AZX1	Lactococcus_phage	61.4	7.1e-19
WP_167839946.1|926663_926933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167839947.1|926993_927263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840390.1|927274_927619_+	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	61.8	4.4e-14
WP_167839948.1|927630_927843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839949.1|927932_928613_+	CHAP domain-containing protein	NA	D3W0F3	Lactococcus_phage	35.9	6.7e-22
WP_167840391.1|928715_929036_+	LysM peptidoglycan-binding domain-containing protein	NA	A5GYL4	Lactococcus_phage	62.6	8.5e-28
WP_167839950.1|929558_930467_+|protease	serine protease	protease	NA	NA	NA	NA
929068:929088	attR	ATTGTAGGGCTTTTTTTGTAT	NA	NA	NA	NA
WP_167839951.1|930490_930697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040273.1|931438_932533_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.7	7.4e-31
>prophage 4
NZ_CP047614	Lactococcus raffinolactis strain Lr_19_7 chromosome, complete genome	2381691	1077457	1162579	2381691	tRNA,integrase,terminase,head,tail,holin,plate,capsid,portal,protease	Bacillus_phage(20.0%)	92	1076122:1076138	1156938:1156954
1076122:1076138	attL	AGATATCAATGTGACTT	NA	NA	NA	NA
WP_061775007.1|1077457_1077976_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_096040349.1|1077972_1078590_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_167839977.1|1078579_1080979_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.9	1.3e-56
WP_138491571.1|1081116_1081482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156470231.1|1081576_1081741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004261808.1|1082185_1082527_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_061775011.1|1082646_1083132_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_061775012.1|1083221_1083476_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_096040351.1|1083736_1084330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061775014.1|1084326_1085028_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167839978.1|1085034_1086279_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_096040353.1|1086355_1088014_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_061775017.1|1088085_1088796_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_096040354.1|1088779_1089994_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_096040355.1|1090168_1091674_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_096040542.1|1091737_1092385_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096040356.1|1092399_1093413_-	lactonase family protein	NA	NA	NA	NA	NA
WP_061775021.1|1093658_1094816_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_167839979.1|1095006_1095996_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_096040358.1|1096000_1096576_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_061775024.1|1096572_1096944_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_167839980.1|1096984_1098436_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_061775026.1|1098489_1098954_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_167839981.1|1099116_1100613_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_167840394.1|1100645_1102481_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_061774226.1|1102480_1103194_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	33.7	1.3e-28
WP_096040544.1|1103263_1104760_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	35.1	4.9e-25
WP_167372321.1|1104833_1105538_-	response regulator	NA	W8CYM9	Bacillus_phage	32.9	4.0e-22
WP_167839982.1|1105927_1106065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839983.1|1106139_1107345_-|integrase	site-specific integrase	integrase	A0A1X9I6A9	Streptococcus_phage	40.8	2.8e-79
WP_167839984.1|1107403_1107862_-	hypothetical protein	NA	C5J978	Streptococcus_phage	37.8	1.4e-10
WP_167839985.1|1107930_1108314_-	helix-turn-helix transcriptional regulator	NA	E9LUS8	Lactobacillus_phage	46.3	1.1e-08
WP_167839986.1|1108468_1108711_+	helix-turn-helix transcriptional regulator	NA	Q9AZW2	Lactococcus_phage	46.1	1.0e-09
WP_167839987.1|1108896_1109148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839988.1|1109136_1109358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167839989.1|1109506_1109692_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167839990.1|1109733_1109940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138491592.1|1110263_1110530_+	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_167839991.1|1110602_1110977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839992.1|1110963_1111149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839993.1|1111148_1112102_+	site-specific DNA-methyltransferase	NA	X2KR14	Campylobacter_phage	60.1	8.3e-87
WP_167839994.1|1112114_1112513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839995.1|1112509_1112650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839996.1|1112646_1112847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839997.1|1112846_1113128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839551.1|1113117_1113459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839998.1|1113445_1113673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167839999.1|1113669_1113927_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	44.0	6.0e-08
WP_167840000.1|1113907_1114222_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	54.4	2.3e-25
WP_167840001.1|1114230_1115022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840002.1|1115248_1116088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840003.1|1116514_1116958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840004.1|1116975_1117410_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_167840005.1|1117470_1117836_+	hypothetical protein	NA	A0A1C8EAA0	Bacillus_phage	45.4	4.5e-09
WP_167840006.1|1117832_1118201_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	70.7	3.8e-48
WP_167840007.1|1118302_1118728_+|terminase	P27 family phage terminase small subunit	terminase	A0A1B0T688	Bacillus_phage	65.7	1.9e-46
WP_167840008.1|1118724_1120449_+|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	84.5	9.8e-296
WP_167840009.1|1120462_1121665_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	75.1	2.1e-172
WP_138491613.1|1121627_1122209_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	71.4	2.5e-70
WP_167840010.1|1122208_1123540_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	70.1	7.9e-128
WP_138491709.1|1123553_1123808_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J865	uncultured_Caudovirales_phage	73.2	8.8e-28
WP_138491615.1|1123791_1124115_+|head,tail	phage head-tail joining protein	head,tail	A0A0N7IRA3	Lactobacillus_phage	51.5	7.3e-19
WP_138491616.1|1124104_1124446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031365342.1|1124435_1124801_+	HK97 gp10 family phage protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	40.5	7.0e-18
WP_167840011.1|1124803_1125445_+|tail	phage tail protein	tail	A0A0P0I7R6	Lactobacillus_phage	34.9	2.3e-24
WP_167840012.1|1125444_1125903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840013.1|1126091_1128401_+|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	44.6	5.1e-74
WP_031365346.1|1128397_1129111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840014.1|1129107_1131741_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1L2JXP5	Streptococcus_phage	69.3	4.9e-222
WP_167840015.1|1131758_1132568_+|plate	BppU family phage baseplate upper protein	plate	Q9AYV5	Lactococcus_phage	32.2	3.2e-23
WP_167840395.1|1132872_1133127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840016.1|1133128_1133557_+	hypothetical protein	NA	V9VFP7	Lactococcus_phage	38.8	1.1e-19
WP_167840396.1|1133578_1133974_+|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	61.1	2.7e-39
WP_167840017.1|1133974_1135303_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1P8BMS7	Lactococcus_phage	61.7	7.6e-155
WP_167840018.1|1135404_1135599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840019.1|1135694_1136738_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_143188721.1|1136969_1137875_+	hypothetical protein	NA	A0A0B5CYL8	Listeria_phage	48.8	1.0e-78
WP_096040362.1|1139652_1140333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138491633.1|1140325_1140850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840020.1|1140846_1142142_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_138491636.1|1142141_1142444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061774231.1|1142557_1142887_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_167840021.1|1143027_1144548_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_061774233.1|1144624_1145107_+	shikimate kinase	NA	NA	NA	NA	NA
WP_096040366.1|1145103_1145931_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_096040367.1|1146124_1146472_+	YxeA family protein	NA	NA	NA	NA	NA
WP_061774236.1|1146471_1147224_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	6.6e-31
WP_167840022.1|1147223_1149200_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_096040369.1|1149299_1149956_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_096040370.1|1149952_1150909_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_167840023.1|1151187_1161039_+	hypothetical protein	NA	NA	NA	NA	NA
1156938:1156954	attR	AGATATCAATGTGACTT	NA	NA	NA	NA
WP_167840024.1|1161232_1162579_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP047614	Lactococcus raffinolactis strain Lr_19_7 chromosome, complete genome	2381691	1201946	1210868	2381691		Enterococcus_phage(28.57%)	10	NA	NA
WP_061774280.1|1201946_1203764_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	37.2	1.7e-88
WP_096040406.1|1203885_1204578_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SD15	Streptococcus_phage	50.0	1.4e-64
WP_061774282.1|1204677_1205319_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_061774283.1|1205422_1205641_+	glutaredoxin-like protein NrdH	NA	A0A1W6JHV4	Lactococcus_phage	47.6	1.3e-11
WP_061774284.1|1205637_1205994_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	D9J0S1	Brochothrix_phage	35.2	3.7e-16
WP_061774285.1|1205998_1208152_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.4	5.2e-254
WP_167372353.1|1208272_1209232_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	67.1	1.1e-123
WP_096040408.1|1209287_1210157_-	glutathione-dependent reductase	NA	NA	NA	NA	NA
WP_004260832.1|1210192_1210330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061774287.1|1210457_1210868_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	45.9	3.1e-30
>prophage 6
NZ_CP047614	Lactococcus raffinolactis strain Lr_19_7 chromosome, complete genome	2381691	1500614	1539411	2381691	transposase,integrase,terminase,tail,holin,plate,capsid,portal	Lactococcus_phage(38.24%)	56	1502329:1502356	1539433:1539460
WP_071519405.1|1500614_1501613_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1502329:1502356	attL	AAAACTCGCCCACTTTTCGCCCACCAAA	NA	NA	NA	NA
WP_167840102.1|1502724_1503471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840103.1|1503474_1503897_-	hypothetical protein	NA	E9LUK8	Lactobacillus_phage	29.5	5.8e-08
WP_167840104.1|1503902_1504886_-	AAA family ATPase	NA	E9LUK9	Lactobacillus_phage	39.9	2.6e-43
WP_167840105.1|1505324_1505495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840106.1|1505577_1505901_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_167840107.1|1505917_1506088_-	hypothetical protein	NA	A0A182BQ76	Lactococcus_phage	61.1	3.1e-05
WP_167840108.1|1506205_1507471_-	LysM peptidoglycan-binding domain-containing protein	NA	Q8LTP4	Lactococcus_phage	59.3	3.4e-136
WP_167840109.1|1507471_1507681_-|holin	holin	holin	A0A1U9WRD5	Streptococcus_virus	53.8	1.4e-10
WP_167840110.1|1507686_1507929_-|holin	holin	holin	D2J075	Enterococcus_phage	45.9	1.1e-08
WP_167840111.1|1507943_1508732_-	hypothetical protein	NA	H9EH56	Lactococcus_phage	35.6	1.2e-27
WP_167840112.1|1508745_1509789_-	hypothetical protein	NA	Q5K5I4	Oenococcus_phage	34.1	1.1e-44
WP_167840113.1|1509785_1511177_-|plate	phage baseplate protein	plate	B6D7I8	Listeria_phage	24.0	2.7e-22
WP_167840114.1|1511178_1513443_-|tail	phage tail protein	tail	A5GYM8	Lactococcus_phage	68.4	6.4e-77
WP_143188716.1|1513432_1513681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840115.1|1513749_1514271_-	hypothetical protein	NA	D2J068	Enterococcus_phage	27.5	1.2e-07
WP_167840116.1|1514267_1514510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840117.1|1514565_1515186_-	hypothetical protein	NA	A0A1S5S9Y8	Streptococcus_phage	48.7	6.4e-48
WP_031366601.1|1515186_1515564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840118.1|1515563_1515962_-	HK97 gp10 family phage protein	NA	A0A1S5SAB8	Streptococcus_phage	59.4	7.3e-37
WP_031366599.1|1515961_1516279_-	hypothetical protein	NA	A0A1S5S9Y9	Streptococcus_phage	35.6	4.2e-11
WP_167840119.1|1516275_1516806_-	hypothetical protein	NA	D2J063	Enterococcus_phage	48.3	2.7e-39
WP_167840120.1|1516836_1517118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840121.1|1517129_1518044_-|capsid	capsid protein	capsid	Q20DD4	Lactobacillus_phage	53.4	2.2e-81
WP_167840122.1|1518061_1518625_-	scaffolding protein	NA	D2J060	Enterococcus_phage	42.9	7.9e-29
WP_167839886.1|1518810_1518963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840123.1|1518995_1519214_-	hypothetical protein	NA	A0A1P8BLD4	Lactococcus_phage	84.7	3.3e-31
WP_167840124.1|1519217_1520921_-	hypothetical protein	NA	A0A1P8BLD7	Lactococcus_phage	52.2	4.4e-163
WP_167840125.1|1520913_1522368_-|portal	phage portal protein	portal	A0A1S5SAI0	Streptococcus_phage	55.3	4.6e-145
WP_167840126.1|1522382_1523645_-|terminase	PBSX family phage terminase large subunit	terminase	D7RWC5	Brochothrix_phage	82.9	1.4e-206
WP_167840127.1|1523637_1524069_-|terminase	terminase small subunit	terminase	D7RWC4	Brochothrix_phage	66.4	4.3e-43
WP_167840385.1|1524126_1524555_-	universal stress protein	NA	NA	NA	NA	NA
WP_096824046.1|1524734_1525169_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_167840128.1|1525172_1525643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840129.1|1525899_1526055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840130.1|1526141_1526324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840131.1|1526331_1527330_-	hypothetical protein	NA	A0A1P8BKN4	Lactococcus_phage	33.9	1.4e-20
WP_167839878.1|1527331_1527523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167839877.1|1527733_1528534_-	hypothetical protein	NA	A0A1S5S9Y4	Streptococcus_phage	66.9	7.2e-100
WP_167839876.1|1528533_1529571_-	DUF1351 domain-containing protein	NA	A0A2H4J618	uncultured_Caudovirales_phage	29.0	2.6e-17
WP_167839875.1|1529572_1530391_-	recombinase RecT	NA	A0A1L2JXR5	Streptococcus_phage	65.3	3.7e-75
WP_167840132.1|1530542_1530764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840133.1|1530775_1531009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840134.1|1531081_1531267_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	52.5	1.7e-09
WP_096040071.1|1531459_1531732_+	DUF3892 domain-containing protein	NA	A0A059NT53	Lactococcus_phage	43.7	2.1e-11
WP_061774530.1|1531739_1531940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031366573.1|1531954_1532146_-	hypothetical protein	NA	Q9AZF4	Lactococcus_phage	74.6	5.6e-19
WP_167840135.1|1532256_1532823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840136.1|1532963_1533746_-	phage antirepressor Ant	NA	A0A2I7SC24	Paenibacillus_phage	56.3	6.8e-71
WP_167840137.1|1533758_1533965_-	hypothetical protein	NA	A0A182BQC7	Lactococcus_phage	84.6	1.1e-23
WP_167840138.1|1534251_1534584_+	helix-turn-helix domain-containing protein	NA	A0A182BQC8	Lactococcus_phage	52.7	5.9e-24
WP_167840139.1|1534597_1535032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096040068.1|1535086_1535461_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	90.3	1.7e-56
WP_167840140.1|1535570_1537223_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_167840141.1|1537273_1538143_+	DNA adenine methylase	NA	NA	NA	NA	NA
WP_167840142.1|1538280_1539411_+|integrase	site-specific integrase	integrase	A0A1B1IMP1	Lactococcus_phage	33.2	1.1e-42
1539433:1539460	attR	AAAACTCGCCCACTTTTCGCCCACCAAA	NA	NA	NA	NA
>prophage 7
NZ_CP047614	Lactococcus raffinolactis strain Lr_19_7 chromosome, complete genome	2381691	1857956	1864292	2381691		Streptococcus_phage(83.33%)	8	NA	NA
WP_167840223.1|1857956_1858883_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	73.9	4.8e-124
WP_061775217.1|1859016_1859628_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	57.1	4.0e-66
WP_061775224.1|1859823_1860660_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_167372337.1|1860783_1861644_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	67.2	6.1e-97
WP_096040505.1|1861643_1861970_-	DUF972 family protein	NA	M1PFV3	Streptococcus_phage	41.9	4.4e-16
WP_061775215.1|1861981_1862752_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_061775214.1|1862794_1863658_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	47.1	2.8e-65
WP_061775213.1|1863644_1864292_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	60.0	7.6e-68
>prophage 8
NZ_CP047614	Lactococcus raffinolactis strain Lr_19_7 chromosome, complete genome	2381691	2010281	2079800	2381691	transposase,tRNA,holin,protease	Streptococcus_phage(42.86%)	62	NA	NA
WP_167840266.1|2010281_2010992_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_096039564.1|2011076_2011979_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_167840267.1|2012249_2014562_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_096039566.1|2014558_2015281_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_096039567.1|2015499_2015631_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_167839074.1|2015790_2016279_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096039569.1|2016281_2017730_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_167840268.1|2017874_2018357_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_061774662.1|2018343_2019105_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_096039571.1|2019160_2019841_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_096039572.1|2019837_2020911_-	TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_096039573.1|2021139_2022501_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_096039574.1|2022502_2022949_-	dUTP diphosphatase	NA	Q332E8	Clostridium_botulinum_C_phage	49.3	1.0e-31
WP_167840269.1|2023025_2024783_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	7.9e-43
WP_167840270.1|2024775_2026494_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	2.6e-46
WP_167840271.1|2026892_2027891_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_071519144.1|2028024_2028312_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167840272.1|2028647_2029193_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.3	2.6e-29
WP_167840273.1|2029423_2030056_-	FusB/FusC family EF-G-binding protein	NA	NA	NA	NA	NA
WP_167840274.1|2030291_2030978_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	96.4	5.2e-123
WP_167840410.1|2031055_2031418_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_167840275.1|2031674_2032655_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.4	7.7e-96
WP_167840276.1|2033591_2034545_-	ribonucleotide-diphosphate reductase subunit beta	NA	NA	NA	NA	NA
WP_167840277.1|2034554_2036711_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	57.8	5.1e-241
WP_167840278.1|2036745_2037513_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_096040578.1|2037670_2038342_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_167840279.1|2038412_2039093_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.2	6.5e-126
WP_167840280.1|2039403_2040309_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_138492587.1|2040751_2041276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031367160.1|2041414_2042095_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	2.9e-110
WP_167840281.1|2042273_2042837_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_167840282.1|2042896_2044426_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	27.8	5.3e-19
WP_047916692.1|2044761_2045442_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	5.0e-110
WP_003108064.1|2046066_2046489_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	61.0	3.1e-38
WP_031367160.1|2047101_2047782_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	2.9e-110
WP_167840283.1|2047794_2048061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167840284.1|2048026_2048461_-	helix-turn-helix transcriptional regulator	NA	A0A1B0RXB1	Streptococcus_phage	43.6	1.9e-14
WP_167840411.1|2048757_2049444_+	helix-turn-helix transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	56.2	1.2e-66
WP_167840285.1|2049458_2050028_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_167840286.1|2051220_2051769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003139724.1|2051859_2052021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840287.1|2052218_2052548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167840288.1|2052586_2052856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047916783.1|2053048_2053396_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_167840289.1|2053411_2055040_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_167840290.1|2056353_2057619_+	dihydroorotase	NA	NA	NA	NA	NA
WP_047916776.1|2058082_2058847_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_068164079.1|2059531_2060482_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.0	2.5e-35
WP_167840291.1|2060952_2061633_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	4.2e-109
WP_167840292.1|2062127_2062730_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167840293.1|2062737_2063247_-	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_167840294.1|2063583_2064597_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_167840295.1|2064719_2065400_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.9	1.2e-108
WP_167840296.1|2066372_2067197_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_031367147.1|2067409_2069572_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	41.1	4.3e-06
WP_024047037.1|2070783_2071782_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081144397.1|2071948_2072953_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_068164079.1|2073730_2074681_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.0	2.5e-35
WP_003135293.1|2075385_2075535_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003138753.1|2075553_2075721_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_096039593.1|2075819_2077061_-	MFS transporter	NA	NA	NA	NA	NA
WP_167840297.1|2077136_2079800_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	39.5	4.2e-144
