The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042977	Klebsiella pneumoniae strain KPN55602 chromosome, complete genome	5127934	1312502	1327224	5127934	integrase,tail	Morganella_phage(50.0%)	18	1312255:1312275	1332318:1332338
1312255:1312275	attL	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
WP_004213157.1|1312502_1313756_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	3.2e-147
WP_004213158.1|1313851_1314859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213159.1|1314989_1315208_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004213160.1|1315207_1315642_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
WP_004213161.1|1315655_1316258_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
WP_004213162.1|1316257_1316437_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023302683.1|1316433_1317399_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	44.3	3.9e-07
WP_004213165.1|1317395_1317899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213166.1|1317895_1318105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213167.1|1318101_1318728_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.6e-25
WP_004213168.1|1318737_1319088_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	3.4e-38
WP_004213169.1|1319080_1321843_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	2.8e-292
WP_032424539.1|1322182_1322629_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_004213171.1|1322609_1322993_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213172.1|1322997_1323471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213173.1|1323654_1323825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213174.1|1323824_1324151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213175.1|1324158_1327224_+|tail	phage tail length tape-measure protein 1	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
1332318:1332338	attR	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
>prophage 2
NZ_CP042977	Klebsiella pneumoniae strain KPN55602 chromosome, complete genome	5127934	1669238	1676143	5127934	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1669238_1670102_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004214747.1|1670112_1670886_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_004151134.1|1671126_1672023_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1672265_1673627_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004201558.1|1673945_1674668_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004214740.1|1674664_1676143_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 3
NZ_CP042977	Klebsiella pneumoniae strain KPN55602 chromosome, complete genome	5127934	2635963	2646850	5127934		Escherichia_phage(87.5%)	9	NA	NA
WP_004209809.1|2635963_2639071_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_004176258.1|2639125_2640391_+	MFS transporter	NA	NA	NA	NA	NA
WP_004209813.1|2640421_2641510_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
WP_004176262.1|2641596_2641857_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2642154_2643015_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004209817.1|2643035_2643797_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	5.5e-134
WP_002903955.1|2644057_2644960_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004183946.1|2644971_2646237_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|2646229_2646850_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP042977	Klebsiella pneumoniae strain KPN55602 chromosome, complete genome	5127934	3315468	3324932	5127934	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004209699.1|3315468_3317190_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3317234_3317936_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3318289_3318508_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3318628_3320908_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3320938_3321256_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3321581_3321803_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004209695.1|3321879_3323820_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3323816_3324932_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP042975	Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence	270776	6613	68968	270776	transposase,protease,integrase	Macacine_betaherpesvirus(17.65%)	51	8995:9013	40415:40433
WP_004213560.1|6613_7393_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_004213558.1|7537_8467_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_077250517.1|8778_8937_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
8995:9013	attL	TCGGCTTTGTTGAATAAAT	NA	NA	NA	NA
WP_004225014.1|9051_10020_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
WP_011251296.1|12691_13558_+	ParA family protein	NA	NA	NA	NA	NA
WP_004902347.1|13557_14589_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
WP_004902343.1|14588_15026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004214667.1|17372_18155_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
WP_004211835.1|20905_21442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004211839.1|23761_24772_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_004211841.1|25501_26668_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
WP_004117790.1|26667_27639_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004215130.1|29266_29707_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004189161.1|29703_30054_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004902302.1|30084_31677_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004213807.1|32004_32973_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004213821.1|34235_34679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186937.1|34688_35096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011154511.1|35138_36098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|36849_37173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213829.1|37324_37642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213833.1|37707_38844_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004213836.1|39021_39276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029884537.1|40418_41495_+	hypothetical protein	NA	NA	NA	NA	NA
40415:40433	attR	ATTTATTCAACAAAGCCGA	NA	NA	NA	NA
WP_159181011.1|41644_41998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004210308.1|42349_43234_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.8	4.4e-50
WP_004026565.1|44479_44932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186895.1|45174_45489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004210305.1|46097_47498_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004210304.1|47864_48347_+	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_004902273.1|48360_49362_+	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_004210300.1|49321_50431_+	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_004210298.1|50441_51005_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004210297.1|51001_51964_+	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_011154627.1|51975_52266_+	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_004210292.1|52283_53549_+	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004210290.1|53529_55200_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	28.4	4.7e-37
WP_004210286.1|56237_56450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004210285.1|56543_56822_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004210282.1|56880_57285_+	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_032424570.1|57560_58043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011154625.1|58421_59921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004210271.1|59948_61682_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004210269.1|61681_62722_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004210266.1|62814_63453_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004210263.1|63453_64095_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.6	8.2e-06
WP_004210261.1|64119_64758_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026591.1|65237_65696_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_004210256.1|65698_66922_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_004210253.1|66932_67889_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_004210251.1|67888_68968_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	1.1e-39
