The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050826	Klebsiella pneumoniae strain Bckp212 chromosome, complete genome	5204371	1631223	1638128	5204371	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1631223_1632087_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_064178404.1|1632097_1632871_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_167812933.1|1633111_1634008_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	8.0e-15
WP_004144192.1|1634250_1635612_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_143934515.1|1635930_1636653_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_004149058.1|1636649_1638128_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 2
NZ_CP050826	Klebsiella pneumoniae strain Bckp212 chromosome, complete genome	5204371	1677874	1686248	5204371		Enterobacteria_phage(28.57%)	8	NA	NA
WP_065518761.1|1677874_1679281_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	7.3e-39
WP_004189145.1|1679504_1680569_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_065518762.1|1680595_1681465_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	5.7e-111
WP_065518763.1|1681496_1682387_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	1.6e-28
WP_065518764.1|1682401_1682956_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.1	4.3e-51
WP_004175261.1|1683135_1684302_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_032409012.1|1684721_1684844_-	small membrane protein	NA	NA	NA	NA	NA
WP_000670922.1|1685243_1686248_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	2.3e-31
>prophage 3
NZ_CP050826	Klebsiella pneumoniae strain Bckp212 chromosome, complete genome	5204371	1889508	1942032	5204371	transposase,plate,protease	Microcystis_phage(27.27%)	53	NA	NA
WP_004175481.1|1889508_1890255_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_014343226.1|1890734_1891592_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_014343225.1|1891747_1892734_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_014343224.1|1892726_1893527_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004145488.1|1893564_1893687_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_014343223.1|1893984_1894128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|1894304_1895246_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|1895339_1896329_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004200322.1|1896354_1897686_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_004175486.1|1897713_1898922_+	propionate kinase	NA	NA	NA	NA	NA
WP_021466440.1|1898950_1901245_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	3.9e-159
WP_014343220.1|1901295_1901442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189329.1|1901731_1902790_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|1902899_1903814_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004148804.1|1903823_1905110_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004148803.1|1905106_1905982_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_014343216.1|1905978_1906698_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_004145473.1|1906703_1907597_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004148802.1|1907880_1909524_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|1909573_1910050_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|1910148_1911075_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|1911378_1912674_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004145468.1|1912685_1913495_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|1913469_1914369_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|1914478_1914961_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_014907357.1|1915151_1915850_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|1915875_1916415_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|1916529_1916859_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004148795.1|1917029_1917191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343212.1|1917428_1918769_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014343211.1|1919422_1921120_+	OmpA family protein	NA	NA	NA	NA	NA
WP_014343210.1|1921578_1924065_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_032430450.1|1924088_1925444_+	S-type Pyocin	NA	NA	NA	NA	NA
WP_167812975.1|1925444_1925954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019441.1|1926251_1927232_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_014343204.1|1927646_1927958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343203.1|1927979_1928873_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	28.8	8.8e-14
WP_014343202.1|1928918_1929035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343201.1|1929056_1929950_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|1929975_1930104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184615.1|1930125_1931019_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.2e-12
WP_004164123.1|1931194_1931548_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_014343198.1|1931511_1932084_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	33.3	3.9e-07
WP_014343197.1|1932217_1932445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343196.1|1932428_1932563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343194.1|1932764_1933007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004175522.1|1933304_1933571_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014343193.1|1933574_1934732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343192.1|1934715_1938126_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_014343191.1|1938259_1940023_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_014343190.1|1940052_1941069_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004189400.1|1941043_1941586_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152261.1|1941588_1942032_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP050826	Klebsiella pneumoniae strain Bckp212 chromosome, complete genome	5204371	2603538	2614424	5204371		Escherichia_phage(87.5%)	9	NA	NA
WP_064114895.1|2603538_2606646_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_004176258.1|2606700_2607966_+	MFS transporter	NA	NA	NA	NA	NA
WP_040216274.1|2607996_2609085_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
WP_004176262.1|2609171_2609432_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2609728_2610589_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|2610609_2611371_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2611631_2612534_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004190239.1|2612545_2613811_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002210516.1|2613803_2614424_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP050826	Klebsiella pneumoniae strain Bckp212 chromosome, complete genome	5204371	2661315	2749175	5204371	transposase,holin,integrase,tail,terminase	Salmonella_phage(21.82%)	95	2662271:2662294	2723361:2723384
WP_001118639.1|2661315_2662239_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	91.8	1.6e-164
2662271:2662294	attL	AAATCTGATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_032419483.1|2662690_2663869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958364.1|2663871_2664267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190310.1|2664427_2666083_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_032105167.1|2666346_2667267_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004176301.1|2667430_2667787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002903623.1|2667942_2669559_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004176303.1|2669555_2670275_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_046654267.1|2670255_2671206_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_029884317.1|2671273_2674051_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
WP_002903581.1|2674766_2676203_+	anion permease	NA	NA	NA	NA	NA
WP_040215835.1|2676257_2677910_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_048337665.1|2678072_2679689_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004143067.1|2681320_2681710_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_004151556.1|2681702_2682467_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_048337664.1|2682456_2683809_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_004179693.1|2683818_2685021_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_040215832.1|2685031_2685688_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_002903522.1|2685698_2686385_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_032419018.1|2686554_2687361_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143055.1|2687357_2687921_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_004148273.1|2688022_2688931_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040215831.1|2689097_2690408_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_032419021.1|2690407_2691853_+	amidohydrolase	NA	NA	NA	NA	NA
WP_017879817.1|2691976_2693095_+	transporter	NA	NA	NA	NA	NA
WP_004146386.1|2693223_2694324_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	2.9e-115
WP_075253235.1|2694534_2694816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072061016.1|2695362_2695785_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	48.1	1.6e-26
WP_101979092.1|2695862_2696411_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	97.8	7.6e-93
WP_101979510.1|2697100_2700556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101979018.1|2700626_2701394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101979000.1|2703423_2706486_-	kinase	NA	A0A286S259	Klebsiella_phage	93.7	0.0e+00
WP_004190616.1|2706482_2706863_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	77.0	1.5e-55
WP_064081073.1|2706872_2707355_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	95.0	5.3e-82
WP_004190622.1|2707535_2708000_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.0e-58
WP_101979509.1|2707999_2711578_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	29.4	6.5e-76
WP_057775156.1|2711788_2712073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|2712122_2712479_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_008807842.1|2712555_2712762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004146194.1|2712899_2713382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020948195.1|2713437_2714610_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	3.2e-24
WP_044245111.1|2714633_2715032_-	electron transfer flavoprotein subunit beta	NA	A0A059VK45	Pseudomonas_phage	33.6	1.3e-12
WP_086624782.1|2715028_2715580_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	41.5	1.7e-28
WP_004217344.1|2715581_2715965_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|2715951_2716185_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004190649.1|2716194_2716449_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_008807837.1|2716450_2716846_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_151391665.1|2716886_2717159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101978822.1|2717167_2718121_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	3.2e-131
WP_016946679.1|2718131_2718917_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004227000.1|2719030_2719207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946680.1|2719447_2720560_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.6	2.3e-112
WP_016946681.1|2720543_2721944_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.7	6.4e-128
WP_167812988.1|2721945_2722380_-|terminase	terminase	terminase	A0A0N7IRE3	Acinetobacter_phage	64.3	1.2e-37
WP_016151349.1|2722359_2723328_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	5.0e-180
WP_167812990.1|2723353_2724325_-|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	78.7	1.6e-141
2723361:2723384	attR	AAATCTGATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_032434131.1|2724308_2725304_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.1e-38
WP_023341467.1|2726166_2726412_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	95.1	7.9e-34
WP_016946321.1|2726815_2727010_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	2.0e-19
WP_016946320.1|2727082_2727304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023341465.1|2727758_2728052_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.1	7.5e-31
WP_023341464.1|2728193_2728469_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	48.3	7.8e-14
WP_016946315.1|2728465_2728810_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	79.8	5.7e-38
WP_004184488.1|2728806_2729346_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_024940884.1|2729342_2729642_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_032413621.1|2730793_2731294_-	antiterminator	NA	G8C7V7	Escherichia_phage	92.1	2.5e-87
WP_049266875.1|2731290_2731431_-	YlcG family protein	NA	NA	NA	NA	NA
WP_086624781.1|2731427_2731652_-	protein ninY	NA	Q76H69	Enterobacteria_phage	63.5	1.5e-23
WP_086624780.1|2731648_2732230_-	protein NinG	NA	E7C9S3	Salmonella_phage	44.3	2.7e-40
WP_016946309.1|2732438_2733035_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
WP_004184503.1|2733413_2733647_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_032413665.1|2734398_2734698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032417030.1|2734793_2735222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804600.1|2735225_2735447_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.3e-11
WP_020804604.1|2735443_2735698_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_020804603.1|2735690_2735894_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
WP_032438549.1|2735890_2736676_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.7	7.3e-65
WP_032417027.1|2736668_2737004_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	1.3e-10
WP_032417026.1|2737011_2737761_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
WP_023286278.1|2737763_2738672_-	hypothetical protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
WP_072032615.1|2738686_2738875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023287506.1|2738962_2739499_-	bacteriophage regulatory protein CII	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
WP_029503646.1|2739501_2739735_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
WP_004190707.1|2739839_2740235_+	helix-turn-helix transcriptional regulator	NA	K7PM35	Enterobacteria_phage	74.0	3.1e-48
WP_136085610.1|2740252_2740351_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_032438694.1|2740682_2741546_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	62.5	1.3e-94
WP_020805737.1|2741578_2741782_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	76.1	6.3e-21
WP_153932150.1|2742146_2742377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004179600.1|2742670_2742862_+	YebW family protein	NA	NA	NA	NA	NA
WP_016946289.1|2742870_2743026_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
WP_086624777.1|2743163_2746262_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.0	3.7e-293
WP_029602854.1|2746274_2747363_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.0	1.4e-106
WP_057774649.1|2747397_2747742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167812994.1|2747734_2748781_+	DUF550 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	63.9	2.0e-33
WP_016946280.1|2748914_2749175_+	pyocin activator PrtN family protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
>prophage 6
NZ_CP050826	Klebsiella pneumoniae strain Bckp212 chromosome, complete genome	5204371	3356151	3365615	5204371	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004179158.1|3356151_3357873_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3357917_3358619_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3358972_3359191_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3359311_3361591_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3361621_3361939_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3362264_3362486_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3362562_3364503_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3364499_3365615_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 7
NZ_CP050826	Klebsiella pneumoniae strain Bckp212 chromosome, complete genome	5204371	3804183	3874874	5204371	transposase,holin,head,portal,tail,protease,terminase,tRNA,capsid	Klebsiella_phage(42.86%)	90	NA	NA
WP_085955203.1|3804183_3805547_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_032445669.1|3806402_3807434_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_032445667.1|3807443_3808616_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_094833289.1|3808612_3809533_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_004893732.1|3810104_3810530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892491.1|3810606_3812124_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_004151795.1|3812455_3813931_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
WP_002892486.1|3813990_3816138_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_002892484.1|3816220_3817555_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_032432743.1|3817920_3819510_-	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_002892402.1|3819803_3820076_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002892400.1|3820176_3821097_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
WP_004211259.1|3821607_3822474_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048337559.1|3822496_3823522_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_032439753.1|3823523_3825959_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004893746.1|3825969_3826665_-	molecular chaperone	NA	NA	NA	NA	NA
WP_009485574.1|3826723_3827284_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_167813014.1|3827754_3828417_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191501.1|3828394_3828700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147414.1|3828752_3830057_-	citrate synthase	NA	NA	NA	NA	NA
WP_004142684.1|3830102_3830243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892370.1|3830567_3830738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032419287.1|3830816_3831218_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_016946533.1|3831599_3832139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032419288.1|3832607_3832892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167813015.1|3833566_3833884_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	8.1e-23
WP_167813017.1|3833883_3834123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167813019.1|3834228_3835584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167813020.1|3835576_3836338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102054523.1|3836348_3837653_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	52.9	9.8e-06
WP_102054587.1|3837730_3840799_-	kinase	NA	A0A286S259	Klebsiella_phage	67.4	0.0e+00
WP_102054588.1|3840795_3841176_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	54.8	9.1e-37
WP_023284984.1|3841183_3841666_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	68.4	2.9e-56
WP_001018848.1|3841652_3842132_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	78.6	1.9e-76
WP_167813022.1|3842131_3844567_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	97.3	0.0e+00
WP_052433481.1|3844630_3845062_-	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	99.2	9.6e-67
WP_001333686.1|3845058_3845322_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.9	6.9e-44
WP_001177591.1|3845354_3845708_-|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_000115125.1|3845751_3846243_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_000561415.1|3846299_3846665_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000763233.1|3846661_3847201_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
WP_167813024.1|3847193_3847526_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	99.1	6.9e-57
WP_004143899.1|3847527_3847725_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_017880223.1|3847785_3848112_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_044067369.1|3848059_3848302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042346268.1|3848338_3849502_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.0	1.5e-210
WP_004216821.1|3849513_3850194_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_038434523.1|3850199_3851477_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	99.8	5.3e-246
WP_102054543.1|3851479_3853012_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	99.6	5.6e-295
WP_004143905.1|3853021_3853456_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_086551336.1|3853577_3853787_-	serine acetyltransferase	NA	A0A286N2R4	Klebsiella_phage	82.6	2.0e-22
WP_049109190.1|3853799_3854090_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
WP_086551337.1|3854158_3854644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048271635.1|3854762_3855008_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	63.0	2.7e-18
WP_065520060.1|3855396_3855585_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.8	2.2e-23
WP_167813026.1|3855535_3855811_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	59.6	5.6e-20
WP_167813028.1|3855818_3856448_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	1.2e-105
WP_008806056.1|3856447_3856729_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.1	1.3e-32
WP_025983157.1|3856715_3857111_-	membrane protein	NA	G8C7V8	Escherichia_phage	73.1	1.5e-45
WP_117088616.1|3857809_3858499_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.2	7.6e-58
WP_074399076.1|3858495_3858636_-	YlcG family protein	NA	NA	NA	NA	NA
WP_104447027.1|3858632_3859271_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.9	9.2e-74
WP_032413853.1|3859263_3859434_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_167813030.1|3859439_3860036_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	4.7e-56
WP_043906731.1|3860131_3860389_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	76.6	6.4e-26
WP_032428632.1|3860388_3860676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167813032.1|3861305_3861569_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	74.4	6.3e-29
WP_080850849.1|3861565_3862039_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	32.7	4.2e-07
WP_064172641.1|3862035_3862329_-	hypothetical protein	NA	O48423	Enterobacteria_phage	66.7	1.1e-26
WP_080850846.1|3862325_3863195_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.7	4.4e-95
WP_080850843.1|3863179_3864034_-	replication protein	NA	K7PGT1	Enterobacteria_phage	54.0	1.8e-61
WP_001548453.1|3864119_3864341_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3864380_3864608_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_167813034.1|3864719_3865418_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	83.6	6.2e-108
WP_094339392.1|3865644_3866574_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	53.4	2.6e-93
WP_060613586.1|3866611_3866815_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	2.7e-19
WP_161477215.1|3867100_3867259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|3867251_3867458_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_072060568.1|3867521_3868052_+	HNH endonuclease	NA	A0A173GC65	Salmonella_phage	46.0	1.0e-33
WP_004135670.1|3868142_3868340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167813036.1|3868336_3868495_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	57.8	7.6e-06
WP_065888852.1|3868491_3869145_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	62.7	4.0e-64
WP_065888851.1|3869128_3869419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024622733.1|3869415_3869721_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167813037.1|3869717_3870245_+	phage N-6-adenine-methyltransferase	NA	G8EYI1	Enterobacteria_phage	61.6	3.2e-56
WP_102054211.1|3870303_3870543_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	7.8e-10
WP_071549006.1|3870555_3870891_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143017.1|3872362_3873229_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|3873230_3873443_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|3873488_3874874_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 8
NZ_CP050826	Klebsiella pneumoniae strain Bckp212 chromosome, complete genome	5204371	4500195	4574280	5204371	transposase,tRNA,integrase	Leptospira_phage(25.0%)	54	4554362:4554376	4574507:4574521
WP_040215935.1|4500195_4501203_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_040215933.1|4501509_4502577_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_046654710.1|4502573_4505318_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.7e-21
WP_040215928.1|4505317_4506442_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_002887322.1|4506482_4506800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004214138.1|4512959_4514081_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_048337996.1|4514128_4514662_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002887278.1|4514672_4514939_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048291165.1|4515041_4516475_-	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	2.7e-12
WP_002887273.1|4516464_4517148_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
WP_047694163.1|4517319_4518705_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_094833307.1|4518722_4519067_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_065782628.1|4519111_4520374_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_094833306.1|4520385_4523535_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.8	5.8e-60
WP_004177568.1|4523607_4523955_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002887259.1|4523964_4524498_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
WP_002887258.1|4524614_4525343_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
WP_002887256.1|4525574_4526009_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004152218.1|4526005_4526725_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_094833305.1|4526721_4527981_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004177578.1|4527982_4528705_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_040216918.1|4528701_4529922_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048991493.1|4529918_4530404_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_004214859.1|4530400_4530925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094833304.1|4530921_4531473_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_023343042.1|4531469_4532429_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_095153255.1|4532719_4534102_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_032409642.1|4534232_4534346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021464733.1|4534373_4535693_-	xylose isomerase	NA	NA	NA	NA	NA
WP_167813082.1|4536119_4537559_+	MFS transporter	NA	NA	NA	NA	NA
WP_048337989.1|4537617_4539297_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_002887060.1|4539379_4540018_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000183578.1|4541068_4541878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178423.1|4541975_4544198_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_032418123.1|4546092_4547220_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_040217119.1|4547209_4547473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071579742.1|4547634_4548891_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_032418126.1|4548853_4549120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167813049.1|4550061_4551507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143722351.1|4551575_4552695_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	5.1e-51
WP_094833144.1|4553059_4554171_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	30.4	3.4e-07
4554362:4554376	attL	CGAAGGCCGGACTCA	NA	NA	NA	NA
WP_048337987.1|4554481_4555570_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_048337986.1|4555569_4556190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048337985.1|4556887_4557148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048337984.1|4557257_4557560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167813051.1|4558321_4559290_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	7.4e-184
WP_167813053.1|4561559_4563362_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_143722351.1|4563421_4564542_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	5.1e-51
WP_167813055.1|4564575_4565694_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_064114729.1|4565836_4569379_-	DUF3883 domain-containing protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	27.3	1.2e-53
WP_048337980.1|4569632_4569917_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048337979.1|4570967_4571429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048337978.1|4571403_4572300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048337977.1|4573008_4574280_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	35.7	4.1e-73
4574507:4574521	attR	CGAAGGCCGGACTCA	NA	NA	NA	NA
>prophage 1
NZ_CP050827	Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence	186278	0	80224	186278	transposase	Stx2-converting_phage(20.83%)	55	NA	NA
WP_101979470.1|0_1539_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	2.3e-280
WP_023287225.1|1590_2529_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023287224.1|2561_3476_-	alpha/beta hydrolase	NA	A0A1D8EVD1	Mycobacterium_phage	28.0	9.0e-06
WP_023287223.1|3486_4356_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_023287222.1|4372_4996_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_167813114.1|4982_6419_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_023288221.1|6548_7781_-	MFS transporter	NA	NA	NA	NA	NA
WP_100112216.1|8290_9259_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.5	9.1e-182
WP_017146595.1|10536_10890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024193481.1|10882_11083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167813116.1|13131_14100_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.9e-185
WP_167813119.1|14305_14608_-	hypothetical protein	NA	A0A222YY57	Escherichia_phage	62.5	3.4e-10
WP_011251286.1|14677_15097_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011251285.1|15093_15405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023288266.1|16160_16499_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	81.0	2.3e-47
WP_032430752.1|16495_16843_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	7.7e-59
WP_032430751.1|16891_18430_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	92.6	4.5e-276
WP_048293850.1|19194_20175_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	3.4e-184
WP_101979500.1|20373_21741_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_017900871.1|21843_22605_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_017900872.1|22601_23159_+	HutD family protein	NA	NA	NA	NA	NA
WP_032430756.1|23192_24725_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	35.2	9.0e-67
WP_017900874.1|24735_25611_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014228066.1|25641_26322_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032430757.1|26324_26969_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_167813121.1|26965_28063_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	37.9	7.7e-12
WP_160421093.1|29347_30256_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_101979007.1|30309_31704_+	cytosine permease	NA	NA	NA	NA	NA
WP_101979008.1|31715_32924_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017900880.1|32916_33726_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_101979009.1|34466_34874_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	39.4	1.2e-13
WP_101979139.1|35968_36757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048291880.1|36756_37221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100112216.1|37908_38877_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.5	9.1e-182
WP_071444207.1|39830_40355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101979506.1|41274_42078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101978909.1|42201_43485_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_048298736.1|44244_45681_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	23.3	7.2e-10
WP_023288270.1|45779_46568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167813112.1|46960_47467_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023279773.1|49655_50624_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
WP_080876680.1|50719_53836_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.1	4.1e-26
WP_080876679.1|53952_55194_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_080876678.1|55190_56747_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.6	7.1e-104
WP_080876690.1|56950_58816_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_077252861.1|61652_61766_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	81.1	3.6e-10
WP_101979531.1|61857_63456_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.9	7.3e-19
WP_025999313.1|66762_67245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118061.1|67520_67925_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_127472195.1|69073_70165_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	97.5	7.3e-188
WP_167813123.1|70272_73332_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	95.6	0.0e+00
WP_143832796.1|73383_74637_+	lactose permease	NA	NA	NA	NA	NA
WP_001138082.1|75405_78291_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_000904906.1|78416_79031_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_167813125.1|79095_80224_+|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	2.7e-52
>prophage 2
NZ_CP050827	Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence	186278	92908	161488	186278	integrase,transposase	Salmonella_phage(31.58%)	50	101773:101802	161516:161545
WP_004186933.1|92908_94045_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004026552.1|94110_94428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167813127.1|94579_94903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181760.1|94899_95658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386528.1|95654_96614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186937.1|96656_97064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|97073_97538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181763.1|97585_97828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045372268.1|99381_100458_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
101773:101802	attL	ACCCGAAATCTGATTTATTCAACAAAGCCG	NA	NA	NA	NA
WP_004118235.1|102260_102782_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_017146590.1|102778_103732_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_023287171.1|103818_106143_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_023287170.1|106187_107090_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_023287169.1|107086_108085_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|108081_109038_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|109038_109806_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_023287168.1|109904_110198_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	8.0e-49
WP_023287167.1|110528_110807_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024241646.1|111099_112182_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.3	2.2e-189
WP_023287164.1|112289_115364_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.5	0.0e+00
WP_023287163.1|115415_116669_+	lactose permease	NA	NA	NA	NA	NA
WP_077263568.1|116784_117753_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	3.8e-180
WP_113707494.1|117732_118086_+	hypothetical protein	NA	A0A2H4IBK3	Erwinia_phage	51.0	1.7e-24
WP_023287162.1|118196_118733_+	hypothetical protein	NA	G8C7Q8	Escherichia_phage	42.5	1.9e-27
WP_032414405.1|118741_119200_+	hypothetical protein	NA	G8C7Q9	Escherichia_phage	55.0	5.1e-42
WP_100112172.1|119286_120255_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.9e-179
WP_032414401.1|122329_122866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900946.1|125172_126183_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_023287153.1|126912_128079_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
WP_023287152.1|128078_129050_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	1.0e-148
WP_023287178.1|136546_136969_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.6	1.4e-30
WP_101977301.1|137154_138141_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_048292268.1|139124_140348_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012541817.1|140440_140959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012541818.1|140971_141826_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_023287181.1|141962_143144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023287182.1|143140_145369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023287184.1|146664_147108_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_004144067.1|147104_147575_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_000654811.1|147661_148630_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_085956500.1|149270_150639_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	7.2e-108
WP_167813129.1|150908_151877_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	2.8e-175
WP_017901247.1|152215_153427_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_020481021.1|153513_154467_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.0	1.7e-10
WP_101984551.1|154623_155472_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017901245.1|155495_156167_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_017901244.1|156163_156826_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_017901243.1|156830_157649_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	8.8e-29
WP_017901242.1|157645_158611_+	DMT family transporter	NA	NA	NA	NA	NA
WP_167813130.1|160519_161488_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	4.2e-179
161516:161545	attR	ACCCGAAATCTGATTTATTCAACAAAGCCG	NA	NA	NA	NA
