The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050822	Klebsiella pneumoniae strain Bckp091 chromosome, complete genome	5187296	1367488	1434831	5187296	transposase,tRNA,tail,integrase,protease,capsid,head,terminase,holin	Klebsiella_phage(44.23%)	77	1390376:1390401	1433788:1433813
WP_004145598.1|1367488_1368907_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|1368958_1369351_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|1369354_1369708_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004151096.1|1370212_1372384_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|1372432_1373635_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|1373981_1375223_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_002913419.1|1375280_1375640_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002913417.1|1375770_1376763_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_004159719.1|1376943_1378605_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_023280391.1|1378601_1379837_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|1380100_1381066_+	glucokinase	NA	NA	NA	NA	NA
WP_004145587.1|1381119_1381872_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|1381868_1383566_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_004153200.1|1383564_1383678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188912.1|1383674_1383860_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_002913372.1|1383948_1385163_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|1385233_1385305_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_023282888.1|1385643_1386840_-	cyanate transporter	NA	NA	NA	NA	NA
WP_048292141.1|1386836_1387295_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_021440524.1|1387427_1388336_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
WP_032428359.1|1388345_1389227_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|1389594_1390077_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
1390376:1390401	attL	GTTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_040186293.1|1390595_1391780_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.8	4.3e-202
WP_167803376.1|1391845_1392652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040186295.1|1392928_1393489_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	66.5	1.0e-68
WP_167803377.1|1393490_1394063_-	hypothetical protein	NA	A0A0M4RTV1	Salmonella_phage	53.9	1.4e-17
WP_064783780.1|1394059_1394272_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	43.9	1.4e-10
WP_167803378.1|1394271_1394778_-	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	39.3	5.9e-07
WP_167803379.1|1394770_1394995_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	49.2	4.1e-13
WP_094818648.1|1395309_1396170_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.1	1.0e-72
WP_104467618.1|1396251_1397064_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_004104278.1|1397107_1397467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114466249.1|1397937_1398420_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	61.2	8.2e-51
WP_032422885.1|1399022_1399697_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	86.8	3.3e-114
WP_029497185.1|1399787_1399988_+	transcriptional regulator	NA	U5P445	Shigella_phage	76.9	2.8e-21
WP_029497186.1|1400031_1400547_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	63.4	1.5e-58
WP_004104272.1|1401025_1401301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167803380.1|1401293_1402823_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	67.1	5.1e-203
WP_038806620.1|1402819_1403791_+	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	61.6	3.9e-108
WP_114466240.1|1403760_1404405_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
WP_020317301.1|1404401_1405046_+	SAM-binding domain protein	NA	I6PDF5	Cronobacter_phage	68.2	2.0e-84
WP_029497192.1|1405035_1405440_+	antitermination protein	NA	S5M7R9	Escherichia_phage	54.0	5.5e-32
WP_001294159.1|1405649_1406036_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_000243811.1|1406022_1406304_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_048297967.1|1406303_1406933_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.8	2.9e-88
WP_048297966.1|1406935_1407211_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	51.7	8.3e-16
WP_024176412.1|1407718_1407919_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	2.9e-18
WP_048297965.1|1408662_1408884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032412813.1|1408944_1409235_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	95.8	5.8e-52
WP_032412811.1|1409247_1409457_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	84.1	6.3e-24
WP_004143905.1|1409579_1410014_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_004143904.1|1410023_1411556_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_004184534.1|1412153_1412918_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.0	5.3e-36
WP_004184532.1|1412914_1414414_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_004216821.1|1415258_1415939_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_101979983.1|1415950_1417114_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.7	1.0e-211
WP_044067369.1|1417150_1417393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880223.1|1417340_1417667_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_004143899.1|1417727_1417925_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_101979984.1|1417926_1418259_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	97.3	2.5e-54
WP_000763233.1|1418251_1418791_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
WP_000561415.1|1418787_1419153_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000115125.1|1419209_1419701_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_004899623.1|1419744_1420128_+	hypothetical protein	NA	A0A286S1N4	Klebsiella_phage	86.3	1.4e-53
WP_032432338.1|1420130_1420394_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	92.0	3.6e-40
WP_042346245.1|1420457_1420850_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	42.2	3.6e-20
WP_167803381.1|1420919_1423466_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	76.3	0.0e+00
WP_004899614.1|1423465_1423945_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_032412796.1|1423931_1424414_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.9	1.6e-83
WP_017880229.1|1424423_1424804_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_167803382.1|1424800_1427869_+	kinase	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_167803383.1|1427946_1430091_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A286S1P0	Klebsiella_phage	68.4	6.5e-39
WP_167803384.1|1430100_1431510_+	hypothetical protein	NA	A0A1D8KTD3	Synechococcus_phage	25.2	3.5e-17
WP_142674216.1|1431848_1432958_+	acyltransferase family protein	NA	C6ZR20	Salmonella_phage	25.5	4.7e-09
WP_065807526.1|1433046_1433286_-	DinI family protein	NA	K7P6H1	Enterobacteria_phage	85.7	6.1e-31
WP_101979943.1|1433359_1433686_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	5.2e-25
WP_004149224.1|1433901_1434831_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
1433788:1433813	attR	GTTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 2
NZ_CP050822	Klebsiella pneumoniae strain Bckp091 chromosome, complete genome	5187296	1662052	1668958	5187296	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1662052_1662916_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|1662926_1663700_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|1663940_1664837_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1665079_1666441_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1666760_1667483_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_019705218.1|1667479_1668958_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP050822	Klebsiella pneumoniae strain Bckp091 chromosome, complete genome	5187296	2652996	2663883	5187296		Escherichia_phage(85.71%)	8	NA	NA
WP_040182019.1|2652996_2656104_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2656158_2657424_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2657454_2658543_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2658629_2658890_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2659187_2660048_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|2660068_2660830_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2661091_2661994_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210516.1|2663262_2663883_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP050822	Klebsiella pneumoniae strain Bckp091 chromosome, complete genome	5187296	3312882	3322356	5187296	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004224003.1|3312882_3314604_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_023302126.1|3314648_3315350_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3315703_3315922_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3316052_3318332_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3318362_3318680_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3319005_3319227_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_032429904.1|3319303_3321244_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.4	2.9e-38
WP_002896440.1|3321240_3322356_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 5
NZ_CP050822	Klebsiella pneumoniae strain Bckp091 chromosome, complete genome	5187296	4810124	4835718	5187296	transposase,integrase	Salmonella_phage(60.0%)	19	4797675:4797689	4845641:4845655
4797675:4797689	attL	TTTGTCGGCCAGCAC	NA	NA	NA	NA
WP_167803450.1|4810124_4811093_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	2.7e-178
WP_004146626.1|4811262_4811427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023284468.1|4811688_4813269_+	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
WP_167803451.1|4815333_4817934_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_167803452.1|4818016_4819116_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-48
WP_044652526.1|4819240_4819486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046877729.1|4820135_4821500_-	dGTPase	NA	NA	NA	NA	NA
WP_024189874.1|4821924_4822593_+	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	41.9	1.4e-40
WP_044650562.1|4822589_4823435_+	8-oxoguanine DNA glycosylase	NA	NA	NA	NA	NA
WP_001514829.1|4823378_4824062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046877730.1|4824030_4824636_-	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_044650498.1|4824632_4825844_-	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_044650496.1|4825870_4826203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167803453.1|4826857_4829260_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_046877732.1|4829446_4829851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167803454.1|4829843_4831868_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_053065658.1|4831867_4833412_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_167803450.1|4833726_4834695_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	2.7e-178
WP_167803455.1|4834716_4835718_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4845641:4845655	attR	GTGCTGGCCGACAAA	NA	NA	NA	NA
>prophage 1
NZ_CP050823	Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence	157903	20782	80596	157903	transposase	uncultured_Caudovirales_phage(42.11%)	53	NA	NA
WP_016151359.1|20782_21751_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	8.7e-185
WP_004213565.1|22030_23005_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_004206664.1|23360_23711_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.1e-23
WP_004206665.1|23762_24125_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_016151356.1|24142_25894_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_155006902.1|25941_27231_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	1.5e-171
WP_007779002.1|27243_27669_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	1.3e-52
WP_004206671.1|27701_28130_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_164494899.1|28251_30003_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_016151353.1|30027_30390_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_016151352.1|30465_31011_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_016151351.1|31019_31733_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	76.6	1.4e-91
WP_016151350.1|31729_32056_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007871777.1|32387_32885_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_167803472.1|33152_34121_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.2e-180
WP_007896426.1|34274_35600_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_016151347.1|36843_37365_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_004118237.1|37361_38315_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_007898891.1|38401_40726_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118241.1|40770_41673_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|41669_42668_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|42664_43621_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|43621_44389_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|44487_44781_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_007898884.1|45111_45390_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007898882.1|45503_45929_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.9e-51
WP_007898880.1|45941_47231_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	4.4e-168
WP_004206577.1|47275_47596_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	2.9e-20
WP_016151343.1|47681_48380_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	4.5e-90
WP_004206574.1|48508_48814_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206572.1|48824_50030_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_016151359.1|50656_51625_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	8.7e-185
WP_032435706.1|54095_55088_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_047683449.1|56646_59706_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	95.7	0.0e+00
WP_167803473.1|59757_61011_+	lactose permease	NA	NA	NA	NA	NA
WP_032435793.1|62403_62730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118106.1|62810_63707_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016151338.1|63871_64948_-	dihydroorotase	NA	NA	NA	NA	NA
WP_004118110.1|64944_66201_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_004118113.1|66237_67179_-	dihydroorotate dehydrogenase	NA	A0A1V0SH91	Hokovirus	32.6	3.6e-18
WP_016151336.1|67171_68020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118116.1|68384_69641_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118118.1|69853_71119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019441.1|71487_72468_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_167803474.1|72525_72870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118092.1|72966_73227_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_032435791.1|73283_75347_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_015065566.1|75429_75849_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_032435790.1|76233_76512_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004181742.1|76605_76818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032435789.1|77794_78109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088941748.1|78184_79347_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.0	7.3e-53
WP_167803475.1|79600_80596_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	5.1e-172
>prophage 2
NZ_CP050823	Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence	157903	100438	111156	157903	transposase	Salmonella_phage(25.0%)	9	NA	NA
WP_017900946.1|100438_101449_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_023287153.1|102178_103345_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
WP_004117790.1|103344_104316_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_032435629.1|105684_106125_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	59.0	2.9e-18
WP_004189161.1|106121_106472_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_167803477.1|106502_108095_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.0	6.5e-177
WP_159106072.1|108239_108518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167803478.1|108539_109508_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	5.7e-184
WP_004213807.1|110187_111156_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
