The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050811	Yokenella regensburgei strain W13 chromosome, complete genome	4962579	434541	485351	4962579	plate,protease,terminase,holin,tail,integrase	Escherichia_phage(64.29%)	64	435994:436009	447766:447781
WP_006819381.1|434541_435201_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	8.9e-48
WP_006819382.1|435472_437095_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
435994:436009	attL	GCAGCCGAACGCGGCG	NA	NA	NA	NA
WP_167808579.1|437557_438127_+	SocA family protein	NA	NA	NA	NA	NA
WP_167808580.1|438490_439537_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.2e-86
WP_167808581.1|439520_439757_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_167808582.1|439853_440270_-	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	71.9	4.6e-50
WP_167808583.1|440256_440658_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	61.5	8.1e-28
WP_167808584.1|440657_440843_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	69.0	2.8e-15
WP_167808585.1|441440_442253_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	51.3	1.9e-71
WP_167808586.1|442242_442683_-	ASCH domain-containing protein	NA	A0A291AUQ6	Sinorhizobium_phage	44.5	7.6e-27
WP_167808587.1|442679_443291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167808588.1|443283_443619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167808589.1|443615_444083_-	hypothetical protein	NA	A0A2I7RET2	Vibrio_phage	54.1	6.0e-06
WP_167808590.1|444204_444651_-	DUF2591 family protein	NA	NA	NA	NA	NA
WP_167808591.1|444647_444980_-	DUF977 family protein	NA	NA	NA	NA	NA
WP_167808592.1|445019_446090_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	55.4	9.0e-98
WP_167808593.1|446101_449086_-	exodeoxyribonuclease	NA	A0A0U2I1R6	Escherichia_phage	42.6	2.4e-209
447766:447781	attR	CGCCGCGTTCGGCTGC	NA	NA	NA	NA
WP_167808594.1|449220_449565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167808455.1|449754_450054_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	49.0	5.9e-07
WP_167808595.1|450037_450319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167808596.1|450533_450962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167808597.1|451044_451251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167808598.1|451324_451969_-	antitermination protein	NA	NA	NA	NA	NA
WP_167808599.1|451970_453680_-	DUF4942 domain-containing protein	NA	A0A059VA49	Pseudomonas_phage	47.0	7.0e-145
WP_167808600.1|453683_454544_-	hypothetical protein	NA	A0A0K1LLN8	Bacillus_phage	31.6	7.2e-05
WP_167808601.1|454779_455268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167808602.1|455264_455525_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167808603.1|455687_456092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167808604.1|456356_456686_+|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	54.6	1.9e-22
WP_167808605.1|456682_457171_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	64.8	2.5e-55
WP_167808606.1|457172_457691_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_167808607.1|457730_458024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167808608.1|458086_458632_+	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	48.9	4.3e-40
WP_167808609.1|458624_459533_+	hypothetical protein	NA	H2BDB6	Pseudomonas_virus	39.6	1.1e-43
WP_167808610.1|459529_460147_+	class I SAM-dependent methyltransferase	NA	B5WZS8	Pseudomonas_phage	47.4	8.4e-48
WP_167808611.1|460170_460608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167810081.1|460634_460955_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_167808612.1|461080_462358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167808613.1|462347_463052_+	ParB N-terminal domain-containing protein	NA	A0A1J0ME72	Mycobacterium_phage	32.3	3.8e-20
WP_057064400.1|463071_463281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167808614.1|463284_464409_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	48.7	1.6e-65
WP_167808615.1|464408_465731_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	71.1	2.2e-186
WP_167808616.1|465746_467180_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	73.8	6.2e-211
WP_167808617.1|467127_467958_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	78.9	1.0e-125
WP_167808618.1|467938_469246_+	NUDIX hydrolase	NA	A0A0U2QW61	Escherichia_phage	69.9	7.8e-128
WP_167808619.1|469238_469850_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	62.4	8.5e-69
WP_167808620.1|469860_470889_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	74.8	3.7e-149
WP_167808621.1|470956_471427_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	57.1	1.8e-42
WP_167808622.1|471426_471882_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	62.9	2.2e-45
WP_167808623.1|471878_472307_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	61.0	9.6e-43
WP_167808624.1|472293_473238_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	74.5	8.1e-127
WP_167808625.1|473237_474566_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	70.8	2.0e-179
WP_167810082.1|474589_475018_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	81.0	1.1e-62
WP_167808626.1|475017_475635_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	65.0	2.0e-70
WP_167808627.1|477589_478258_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	69.7	2.4e-77
WP_135494175.1|478266_478533_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	61.4	3.9e-26
WP_167808628.1|478532_479537_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	46.7	5.5e-81
WP_167808629.1|479533_480253_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	62.0	8.2e-79
WP_167808630.1|480264_480612_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	84.3	1.3e-50
WP_167808631.1|480614_481094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167808632.1|481115_482342_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	69.3	5.2e-158
WP_167808633.1|482325_482949_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	65.2	1.5e-76
WP_167810084.1|484314_484728_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	43.8	3.6e-23
WP_167810086.1|484769_485351_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	35.1	6.1e-24
>prophage 2
NZ_CP050811	Yokenella regensburgei strain W13 chromosome, complete genome	4962579	603241	649931	4962579	tail,transposase,tRNA,holin	Bodo_saltans_virus(16.67%)	37	NA	NA
WP_167808660.1|603241_603730_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_120816509.1|603829_604951_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_161615874.1|605028_606498_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_006819528.1|606497_607169_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_167808661.1|607290_608661_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	1.8e-106
WP_006819530.1|608664_609306_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_006819531.1|609338_610448_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_006819532.1|610488_610962_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006819533.1|610975_611623_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_038258153.1|611781_613032_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	7.2e-22
WP_167808662.1|614183_615182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167808663.1|615230_615386_-	hypothetical protein	NA	H6X424	Enterobacteria_phage	56.8	1.3e-05
WP_167808664.1|616243_617008_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_167810091.1|617263_617473_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167808665.1|619739_620273_+|tail	tail fiber protein	tail	I3PUX0	Vibrio_phage	47.1	6.2e-07
WP_167808666.1|620557_620992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167808667.1|621254_626090_+	type IV secretion protein Rhs	NA	B6SD27	Bacteriophage	40.0	4.4e-309
WP_167808668.1|627128_627785_-	DedA family protein	NA	NA	NA	NA	NA
WP_167810092.1|628083_628680_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_167808669.1|630156_630828_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.6	1.1e-48
WP_167808670.1|630860_632474_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_167808671.1|632635_633301_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167808672.1|633683_634286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167808673.1|634458_634911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167810094.1|635377_635638_+	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
WP_167808674.1|635837_636215_-	RidA family protein	NA	NA	NA	NA	NA
WP_167808675.1|637581_638169_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_167808676.1|638371_640873_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_167808677.1|640913_641630_+	molecular chaperone	NA	NA	NA	NA	NA
WP_167808678.1|641626_642928_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_167808679.1|642987_643785_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_167808680.1|644905_645487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167808681.1|646201_646591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167808682.1|646625_647210_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_167808683.1|648796_648907_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167808684.1|649009_649192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167808685.1|649625_649931_+|holin	holin	holin	NA	NA	NA	NA
>prophage 3
NZ_CP050811	Yokenella regensburgei strain W13 chromosome, complete genome	4962579	1651535	1746035	4962579	capsid,tRNA,terminase,holin,tail,head,integrase	Salmonella_phage(26.19%)	85	1705000:1705055	1746163:1746218
WP_167809041.1|1651535_1653308_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.7	9.6e-12
WP_006820420.1|1653553_1654120_+	hydrolase	NA	NA	NA	NA	NA
WP_161617006.1|1654116_1654935_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	78.7	2.0e-57
WP_038256855.1|1654979_1655375_+	membrane protein	NA	NA	NA	NA	NA
WP_006820423.1|1655414_1656158_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.4	1.7e-23
WP_167809042.1|1656154_1657126_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_167809043.1|1657211_1657955_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_038256846.1|1658046_1658613_-	VOC family protein	NA	NA	NA	NA	NA
WP_167809044.1|1658856_1660590_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	34.6	1.0e-87
WP_038256840.1|1660659_1662309_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_167809045.1|1662591_1663731_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_120816121.1|1663735_1665319_-	MFS transporter	NA	NA	NA	NA	NA
WP_006820433.1|1665578_1665971_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_006820434.1|1665970_1668049_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_006820435.1|1668041_1669190_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_006820436.1|1669222_1669369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167809046.1|1669532_1670108_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_167809047.1|1670235_1670904_+	molecular chaperone	NA	NA	NA	NA	NA
WP_167809048.1|1670903_1673450_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_167809049.1|1673439_1674585_+	fimbrial protein	NA	NA	NA	NA	NA
WP_006820441.1|1674616_1675261_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_006820443.1|1675663_1676713_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	2.3e-05
WP_167809050.1|1688580_1688904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120816113.1|1693191_1693695_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_006820460.1|1693865_1695209_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_038256798.1|1695253_1695505_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_006820462.1|1695615_1696254_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_167810145.1|1696490_1698632_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_167809051.1|1698738_1699074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006820466.1|1699281_1699779_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_167809052.1|1699819_1700059_-	YecH family protein	NA	NA	NA	NA	NA
WP_006820470.1|1701493_1702159_-	YecA family protein	NA	NA	NA	NA	NA
WP_006820471.1|1702237_1702813_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_167809053.1|1702968_1703622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809054.1|1703618_1704164_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_006820474.1|1704219_1704777_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
1705000:1705055	attL	ATGGTACCCGGAGTGGGACTTGAACCCACACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
WP_167809055.1|1705283_1706603_-|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	71.3	1.1e-60
WP_167809056.1|1706685_1707621_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	36.8	1.3e-47
WP_167809057.1|1707633_1710846_-	host specificity protein J	NA	O64335	Escherichia_phage	80.3	0.0e+00
WP_167810147.1|1710898_1711474_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.7	1.4e-73
WP_167809058.1|1711538_1711964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809059.1|1711996_1712707_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	90.7	8.5e-137
WP_167809060.1|1712708_1713464_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	86.1	8.5e-127
WP_167809061.1|1713460_1713799_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	78.6	3.2e-49
WP_167809062.1|1713798_1716759_-|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	27.1	1.2e-38
WP_167808458.1|1716755_1716971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809063.1|1716988_1717336_-|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	38.4	6.8e-15
WP_167809064.1|1717393_1717849_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	75.4	5.6e-57
WP_167809065.1|1717862_1718273_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	67.9	2.0e-42
WP_167809066.1|1718269_1718659_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	57.0	2.6e-39
WP_167810148.1|1718651_1718984_-|head,tail	head-tail adaptor protein	head,tail	Q7Y406	Yersinia_phage	55.6	2.0e-24
WP_167809067.1|1718997_1719324_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	58.3	1.6e-26
WP_167809068.1|1721770_1723717_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	85.0	9.6e-308
WP_167810150.1|1723775_1725437_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	89.7	5.9e-298
WP_167809069.1|1725436_1725937_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	76.2	2.9e-59
WP_167809070.1|1726094_1726457_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	79.3	4.9e-48
WP_167810152.1|1726449_1727049_-	hypothetical protein	NA	S4TR53	Salmonella_phage	69.2	2.1e-75
WP_167809071.1|1727030_1728488_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	70.9	1.8e-210
WP_167809072.1|1728547_1728802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809073.1|1728902_1729415_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	53.0	6.3e-09
WP_167809074.1|1729724_1730141_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	55.7	1.5e-40
WP_167810154.1|1730127_1730469_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	69.2	4.3e-38
WP_167809075.1|1731505_1732105_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.0	2.4e-76
WP_167809076.1|1732101_1732458_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	59.3	1.0e-37
WP_167810156.1|1732450_1733797_-	DNA cytosine methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	49.4	1.6e-128
WP_167809077.1|1733801_1734098_-	hypothetical protein	NA	A0A1I9KFA7	Aeromonas_phage	53.8	2.9e-22
WP_167809078.1|1734243_1734462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809079.1|1735099_1735540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809080.1|1735536_1736022_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.4	2.1e-70
WP_167810158.1|1736018_1736240_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	45.5	9.1e-13
WP_167809081.1|1736370_1736706_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	55.5	4.6e-24
WP_167809082.1|1736683_1736917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809083.1|1737025_1737694_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	35.0	1.5e-26
WP_167809084.1|1737707_1738259_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	50.6	2.6e-40
WP_167809085.1|1738146_1739178_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	46.5	1.1e-36
WP_167809086.1|1739167_1739419_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_167810159.1|1739438_1739894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809087.1|1739893_1740139_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167808459.1|1740233_1740629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167809088.1|1741288_1741765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161617440.1|1742303_1742480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167809089.1|1742561_1744439_+	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	43.1	4.1e-29
WP_167809090.1|1744435_1744726_+	hypothetical protein	NA	A0A248XD88	Klebsiella_phage	44.7	1.0e-11
WP_161617443.1|1744795_1745017_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	42.0	1.1e-07
WP_167809091.1|1745018_1746035_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	67.2	1.2e-136
1746163:1746218	attR	ATGGTACCCGGAGTGGGACTTGAACCCACACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 4
NZ_CP050811	Yokenella regensburgei strain W13 chromosome, complete genome	4962579	1775395	1827647	4962579	transposase,coat,terminase,lysis,head,integrase	Salmonella_phage(25.0%)	75	1767810:1767825	1832887:1832902
1767810:1767825	attL	CGCTGCAGGCGCTGGA	NA	NA	NA	NA
WP_167809101.1|1775395_1777564_-	SGNH/GDSL hydrolase family protein	NA	E5AGC7	Erwinia_phage	30.5	8.1e-05
WP_167809102.1|1778176_1778362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167809103.1|1778698_1779013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809104.1|1779738_1781277_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.4	2.3e-272
WP_167809105.1|1781326_1781674_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	1.3e-61
WP_167809106.1|1781670_1782060_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	87.6	5.1e-59
WP_167809107.1|1782260_1782698_-	hypothetical protein	NA	G8C7Q9	Escherichia_phage	57.2	7.0e-41
WP_167809108.1|1782706_1783279_-	hypothetical protein	NA	G8C7Q8	Escherichia_phage	48.9	2.6e-43
WP_167809109.1|1783512_1784289_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	63.0	3.2e-73
WP_167809110.1|1784356_1785070_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	55.7	1.7e-44
WP_167809111.1|1785059_1785230_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	90.6	4.2e-18
WP_167809112.1|1785329_1785692_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	80.0	5.8e-17
WP_167809113.1|1785918_1788318_-	hypothetical protein	NA	A0A1B1W279	Salmonella_phage	48.8	1.8e-45
WP_167809114.1|1788375_1790862_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	57.6	1.8e-274
WP_167809115.1|1790863_1791379_-	HNH endonuclease	NA	Q7Y5F9	Xanthomonas_virus	41.2	3.0e-27
WP_167809116.1|1791467_1791869_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	63.5	6.0e-47
WP_167809117.1|1791861_1792332_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	56.4	6.0e-46
WP_167810161.1|1792331_1792832_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	63.1	2.3e-56
WP_167809118.1|1792828_1795063_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	42.6	2.8e-133
WP_167809119.1|1795109_1795793_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	55.5	1.1e-59
WP_167809120.1|1795843_1796599_-	Ig domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	44.5	3.5e-40
WP_167809121.1|1796658_1797042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809122.1|1797038_1797446_-	HK97 gp10 family phage protein	NA	A0A1W6DXX3	Salmonella_phage	52.6	5.2e-30
WP_167809123.1|1797448_1797811_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	50.0	5.8e-25
WP_167809124.1|1797810_1797984_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_167809125.1|1797983_1798364_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	8.2e-30
WP_167809126.1|1798366_1798630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809127.1|1798662_1799718_-|coat	phage coat protein	coat	B1GS73	Salmonella_phage	52.5	2.9e-101
WP_167809128.1|1799714_1800176_-	hypothetical protein	NA	A0A173GBX5	Salmonella_phage	51.7	5.3e-31
WP_167809129.1|1800175_1801537_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	53.3	7.3e-129
WP_165616300.1|1801583_1801721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167809130.1|1801766_1802783_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.8	2.0e-115
WP_167809131.1|1802700_1804152_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	51.7	6.0e-121
WP_167809132.1|1804163_1805732_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	91.6	2.9e-302
WP_167809133.1|1805728_1806379_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	90.7	3.0e-104
WP_167809134.1|1806382_1806601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809135.1|1806712_1807174_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	71.9	7.1e-52
WP_167810163.1|1807170_1807686_-	lysozyme	NA	I6PBN2	Cronobacter_phage	62.0	4.8e-49
WP_032141950.1|1807678_1807999_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	79.0	3.7e-39
WP_167809136.1|1808382_1809063_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.8	1.7e-57
WP_167809137.1|1809059_1809200_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	68.3	5.2e-06
WP_167809138.1|1809196_1809802_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	52.2	3.2e-44
WP_167809139.1|1809794_1809965_-	NinE family protein	NA	NA	NA	NA	NA
WP_167809140.1|1809964_1810420_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	65.6	1.8e-60
WP_167809141.1|1810644_1810827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809142.1|1810823_1811021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167808460.1|1811013_1811883_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	34.1	4.1e-32
WP_167808461.1|1812302_1812764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809143.1|1812760_1812964_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	78.5	1.0e-23
WP_167809144.1|1813451_1814027_-	ArsR family transcriptional regulator	NA	K7PHG5	Enterobacteria_phage	33.0	2.1e-05
WP_167809145.1|1814032_1814827_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	66.3	1.9e-97
WP_167809146.1|1814808_1815537_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	79.6	2.1e-37
WP_167809147.1|1815670_1816216_-	hypothetical protein	NA	G8C7U3	Escherichia_phage	74.6	3.1e-70
WP_025913385.1|1816244_1816472_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	70.4	2.0e-23
WP_167810165.1|1816583_1817288_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	76.5	3.3e-101
WP_167809148.1|1817326_1817812_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_167810166.1|1818480_1818741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167809149.1|1818880_1819087_+	hypothetical protein	NA	A0A1L2C975	Pseudomonas_phage	44.6	3.8e-05
WP_167809150.1|1819083_1819245_+	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	69.2	7.8e-14
WP_167809151.1|1819241_1819454_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	87.1	8.6e-29
WP_006820557.1|1820500_1820680_+	hypothetical protein	NA	G9L668	Escherichia_phage	56.1	8.4e-09
WP_167809152.1|1820688_1821414_+	recombinase	NA	K7PKU3	Enterobacteria_phage	63.6	1.6e-82
WP_167809153.1|1821414_1821954_+	single-stranded DNA-binding protein SSB1	NA	C6ZR36	Salmonella_phage	61.5	7.8e-58
WP_167809154.1|1821966_1822260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167809155.1|1822259_1822424_+	hypothetical protein	NA	G8C7S7	Escherichia_phage	88.0	6.3e-19
WP_167809156.1|1822420_1823080_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	93.2	4.6e-121
WP_167809157.1|1823076_1824042_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	69.7	2.7e-146
WP_167809158.1|1824038_1824257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167809159.1|1824253_1824595_+	DUF551 domain-containing protein	NA	U5P092	Shigella_phage	53.2	2.9e-18
WP_167809160.1|1824686_1824902_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	65.7	3.1e-18
WP_167809161.1|1824901_1825414_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.4	6.4e-70
WP_167809162.1|1825376_1825616_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	50.0	3.7e-12
WP_167809163.1|1825625_1825952_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	87.4	4.1e-46
WP_120816037.1|1826057_1826303_+	excisionase family protein	NA	S4TND0	Salmonella_phage	62.5	1.2e-26
WP_167809164.1|1826348_1827647_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	70.8	3.2e-182
1832887:1832902	attR	CGCTGCAGGCGCTGGA	NA	NA	NA	NA
>prophage 5
NZ_CP050811	Yokenella regensburgei strain W13 chromosome, complete genome	4962579	1840700	1851030	4962579		Burkholderia_phage(28.57%)	10	NA	NA
WP_038256740.1|1840700_1842377_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	34.6	1.2e-16
WP_006820590.1|1842473_1842653_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_120816035.1|1842730_1843648_-	DUF808 family protein	NA	NA	NA	NA	NA
WP_006820592.1|1843819_1844731_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_120816034.1|1844705_1845203_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	3.6e-33
WP_051860973.1|1845183_1846605_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.9	3.1e-98
WP_167809169.1|1846829_1847540_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.3	1.6e-10
WP_167809170.1|1848081_1849197_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	1.8e-117
WP_167809171.1|1849269_1850079_-	chitin-binding protein	NA	R4ZFR5	Choristoneura_rosaceana_entomopoxvirus	32.9	5.7e-28
WP_161617458.1|1850253_1851030_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.0	2.6e-14
>prophage 6
NZ_CP050811	Yokenella regensburgei strain W13 chromosome, complete genome	4962579	2519159	2583754	4962579	plate,capsid,tRNA,terminase,holin,tail,lysis,portal,head,integrase	Salmonella_phage(34.04%)	69	2523381:2523397	2580195:2580211
WP_006821222.1|2519159_2519897_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_006821223.1|2520027_2521359_+	ATP-dependent RNA helicase SrmB	NA	A0A0G2Y8P7	Acanthamoeba_polyphaga_mimivirus	26.6	5.3e-23
WP_006821224.1|2521406_2521790_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	73.0	3.6e-33
WP_006821225.1|2522105_2522795_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	50.0	2.1e-52
WP_167809367.1|2522827_2523901_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2523381:2523397	attL	AGCTCGGCATCATCAAC	NA	NA	NA	NA
WP_006821228.1|2524108_2524534_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	41.5	3.2e-14
WP_040903879.1|2524604_2525303_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_167809368.1|2525336_2528000_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_006821232.1|2528110_2529466_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_006821233.1|2529508_2530807_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.7	4.1e-44
WP_038255024.1|2536372_2538946_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	4.0e-128
WP_006817506.1|2539074_2539806_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_006817505.1|2539802_2540783_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_006817504.1|2540916_2541654_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_006817502.1|2541926_2542259_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_112471513.1|2542364_2542412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006817501.1|2542512_2543673_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_006817500.1|2543735_2544857_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_038255026.1|2544867_2545938_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0B6VT43	Edwardsiella_phage	51.2	1.6e-91
WP_038255028.1|2546154_2546529_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_038255103.1|2546698_2547217_+	YfiR family protein	NA	NA	NA	NA	NA
WP_006817496.1|2547209_2548430_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	35.9	1.9e-06
WP_006817495.1|2548447_2548930_+	OmpA family protein	NA	NA	NA	NA	NA
WP_167809369.1|2548933_2550292_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_006817493.1|2550326_2550731_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_167809370.1|2550941_2551991_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.5	3.1e-188
WP_167809371.1|2552013_2552352_-	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	90.2	3.3e-54
WP_167809372.1|2552360_2553203_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	74.8	1.7e-115
WP_167809373.1|2553316_2553688_+	Cro/Cl family transcriptional regulator	NA	A0A0M4R4X7	Salmonella_phage	95.9	1.3e-59
WP_167809374.1|2553720_2554230_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	92.9	6.0e-84
WP_167809375.1|2554237_2554438_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	90.9	2.8e-29
WP_167809376.1|2554401_2554740_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	90.2	4.4e-51
WP_167809377.1|2554807_2555035_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	93.3	9.3e-29
WP_167809378.1|2555034_2555256_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	94.5	6.0e-33
WP_167809379.1|2555256_2555538_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	81.7	2.6e-36
WP_167809380.1|2555524_2557897_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	93.7	0.0e+00
WP_167809381.1|2558140_2558323_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	83.3	3.3e-21
WP_167809382.1|2558672_2559347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809383.1|2559333_2560416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809384.1|2560415_2561417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167809385.1|2561810_2562836_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	95.9	4.6e-192
WP_167809386.1|2562832_2563579_-	hypothetical protein	NA	O80303	Escherichia_phage	88.7	8.9e-129
WP_167809387.1|2563578_2565348_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	97.6	0.0e+00
WP_167809388.1|2565513_2566368_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	92.3	4.4e-148
WP_167809389.1|2566443_2567532_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	94.0	3.7e-184
WP_167809390.1|2567536_2568286_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	89.2	5.1e-116
WP_167809391.1|2568378_2568885_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	93.5	5.9e-84
WP_167809392.1|2568884_2569088_+|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	88.1	1.6e-27
WP_167809393.1|2569093_2569390_+|holin	holin	holin	O80308	Escherichia_phage	91.8	5.1e-43
WP_167809394.1|2569376_2569874_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	91.5	4.3e-87
WP_167809395.1|2569870_2570296_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0M4R2N5	Salmonella_phage	78.1	1.9e-30
WP_167809396.1|2570255_2570429_+|lysis	phage lysis protein	lysis	O80311	Escherichia_phage	94.7	6.8e-24
WP_167809397.1|2570391_2570859_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	94.2	8.2e-80
WP_167809398.1|2570851_2571301_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	94.0	6.2e-69
WP_167809399.1|2571369_2572011_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	91.5	5.9e-105
WP_167809400.1|2572007_2572355_+|plate	baseplate assembly protein	plate	O80315	Escherichia_phage	89.6	1.3e-50
WP_167809401.1|2572361_2573270_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	91.4	6.1e-148
WP_167809402.1|2573262_2573871_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	92.6	9.3e-108
WP_167809403.1|2575273_2575684_+|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	53.9	1.3e-36
WP_167809404.1|2575814_2576993_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	94.6	4.9e-214
WP_167809405.1|2577008_2577527_+|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	98.8	2.5e-93
WP_167809406.1|2577589_2577910_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	97.8	2.4e-38
WP_071687585.1|2577906_2578062_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	96.1	9.7e-22
WP_167809407.1|2578054_2580496_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	85.6	2.1e-307
2580195:2580211	attR	AGCTCGGCATCATCAAC	NA	NA	NA	NA
WP_167810184.1|2580508_2580994_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	90.6	1.0e-77
WP_167809408.1|2580990_2582160_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	94.6	3.2e-205
WP_167809409.1|2582235_2582454_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	95.8	2.3e-37
WP_004104634.1|2582598_2582946_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_038255070.1|2582986_2583754_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP050811	Yokenella regensburgei strain W13 chromosome, complete genome	4962579	2756582	2765502	4962579		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_006818535.1|2756582_2759144_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.3	1.7e-30
WP_167809471.1|2759158_2760064_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.2	1.4e-06
WP_006818533.1|2760172_2761378_+	MFS transporter	NA	NA	NA	NA	NA
WP_038255304.1|2761374_2761755_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_006818531.1|2761804_2762797_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_040903258.1|2762857_2764003_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	36.3	5.1e-06
WP_006818528.1|2764120_2764747_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	2.2e-35
WP_006818527.1|2764740_2765502_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	1.3e-58
>prophage 8
NZ_CP050811	Yokenella regensburgei strain W13 chromosome, complete genome	4962579	4904528	4947503	4962579	terminase,holin,tail,head,integrase	Salmonella_phage(21.28%)	60	4904469:4904515	4947691:4947737
4904469:4904515	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_167810013.1|4904528_4905692_-|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	92.8	2.4e-213
WP_167810014.1|4905929_4906175_-	hypothetical protein	NA	I6XH08	Aeromonas_phage	52.9	4.8e-15
WP_167810015.1|4906211_4906787_-	hypothetical protein	NA	A0A1R3Y5P7	Salmonella_virus	43.3	3.6e-37
WP_167810016.1|4906797_4906998_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	54.4	2.2e-10
WP_167810017.1|4907128_4907605_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	40.4	1.6e-09
WP_167810018.1|4907601_4907916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167810019.1|4908531_4908777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167810020.1|4908773_4908953_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	54.4	2.6e-10
WP_167810021.1|4909259_4909829_-	hypothetical protein	NA	A0A0M4RD07	Salmonella_phage	84.9	2.3e-84
WP_167810022.1|4909828_4910650_-	exonuclease VIII	NA	A0A0M5M5Y6	Salmonella_phage	84.2	5.0e-133
WP_167810221.1|4910646_4910955_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	55.9	6.9e-27
WP_167810023.1|4911039_4911192_-	host cell division inhibitory peptide Kil	NA	G5DA87	Enterobacteria_phage	79.6	7.8e-16
WP_167810024.1|4911176_4911308_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	67.4	1.8e-08
WP_167810222.1|4911672_4911858_-	hypothetical protein	NA	Q76H36	Enterobacteria_phage	64.3	1.5e-05
WP_167810025.1|4912279_4912507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167810026.1|4913179_4913392_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	86.6	2.9e-24
WP_167810027.1|4913431_4914178_-	helix-turn-helix domain-containing protein	NA	K7PK07	Enterobacteria_phage	70.9	4.4e-59
WP_167810028.1|4914285_4914480_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	77.4	1.1e-19
WP_167810029.1|4914578_4914854_+	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	62.0	6.6e-21
WP_167810030.1|4914896_4915055_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	84.3	9.6e-17
WP_167810031.1|4915041_4915938_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	58.5	4.6e-95
WP_167810032.1|4915927_4917331_+	AAA family ATPase	NA	F1C5C4	Cronobacter_phage	69.6	1.4e-183
WP_167810033.1|4917330_4917570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134436773.1|4917652_4917838_+	hypothetical protein	NA	A0A1B1W2E1	Salmonella_phage	73.8	4.9e-20
WP_167810034.1|4918134_4918584_+	DUF1367 family protein	NA	A0A096XEN2	Escherichia_phage	67.1	4.6e-56
WP_167810035.1|4918801_4919206_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	72.2	2.6e-50
WP_167810223.1|4919192_4919366_+	protein ninF	NA	A0A192Y808	Salmonella_phage	59.6	4.9e-14
WP_167810224.1|4919358_4919652_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	67.0	3.2e-29
WP_167810036.1|4919651_4920257_+	recombination protein NinG	NA	Q5G8S0	Enterobacteria_phage	92.5	1.7e-93
WP_167810037.1|4920253_4921000_+	DNA cytosine methyltransferase	NA	A0A2I7QZY6	Vibrio_phage	51.6	8.0e-61
WP_167810038.1|4921009_4921198_+	protein ninH	NA	A0A1V0E5I5	Salmonella_phage	65.0	8.8e-17
WP_167810039.1|4921194_4921374_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	78.0	7.6e-18
WP_167810040.1|4921370_4921859_+	DUF1133 family protein	NA	A0A1R3Y5U9	Salmonella_virus	78.4	4.0e-69
WP_167810041.1|4922061_4922433_+	hypothetical protein	NA	Q716B1	Shigella_phage	68.3	1.9e-39
WP_167810042.1|4922735_4923041_+|holin	holin	holin	NA	NA	NA	NA
WP_167810043.1|4923030_4923345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167810044.1|4923356_4923827_+	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	45.8	1.5e-28
WP_167810045.1|4923823_4924054_+	hypothetical protein	NA	M4Q0Z5	Dunaliella_viridis_virus	42.2	8.8e-11
WP_167810046.1|4924050_4924338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167810047.1|4924727_4925408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167810048.1|4925464_4925911_+	helix-turn-helix domain-containing protein	NA	Q716H4	Shigella_phage	46.4	1.0e-23
WP_167810049.1|4925891_4927361_+|terminase	terminase	terminase	W6MW26	Pseudomonas_phage	77.3	7.2e-223
WP_167810050.1|4927364_4927595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167810051.1|4927596_4929249_+|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	40.1	1.4e-102
WP_167810052.1|4929258_4929582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167810053.1|4929574_4930261_+	hypothetical protein	NA	M1I7K2	Pelagibacter_phage	32.7	7.2e-08
WP_167810054.1|4930282_4931284_+	hypothetical protein	NA	K4PA76	Pseudomonas_phage	74.0	5.7e-139
WP_167810055.1|4931293_4931743_+	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	55.0	5.5e-33
WP_167810056.1|4931781_4932387_+	hypothetical protein	NA	Q6J1R6	Burkholderia_virus	40.9	5.2e-34
WP_167810057.1|4932387_4934697_+	hypothetical protein	NA	Q6J1R5	Burkholderia_virus	35.5	1.0e-122
WP_167810058.1|4934693_4935110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167810059.1|4935112_4935547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167810060.1|4935549_4938168_+	hypothetical protein	NA	W6MYA2	Pseudomonas_phage	25.6	2.2e-25
WP_167810061.1|4938171_4939794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167810062.1|4939793_4942334_+	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	47.4	3.6e-222
WP_167810063.1|4942795_4945441_+	hypothetical protein	NA	G9L6E4	Escherichia_phage	39.6	2.9e-49
WP_167810064.1|4945460_4945787_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	51.5	7.6e-16
WP_167810066.1|4945901_4946075_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	91.1	4.6e-20
WP_167810068.1|4946145_4946712_+	antirepressor protein ant	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	65.1	3.3e-35
WP_167810069.1|4946798_4947503_+	Rha family transcriptional regulator	NA	A0A0P0ZDC0	Stx2-converting_phage	44.3	7.6e-45
4947691:4947737	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 1
NZ_CP050812	Yokenella regensburgei strain W13 plasmid pYRW13-125, complete sequence	125281	11524	64857	125281	integrase,transposase	Escherichia_phage(17.65%)	53	8274:8287	60009:60022
8274:8287	attL	ACCTTCAAGCTCAT	NA	NA	NA	NA
WP_085940648.1|11524_12615_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|12704_13520_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|13606_13909_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|13802_14054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001255015.1|15677_15983_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|16010_17225_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|17441_18326_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000743213.1|20050_20275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|20271_21009_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|21494_21635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|21640_22345_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201280.1|22591_23065_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001209508.1|23139_23931_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000846390.1|23947_24748_-	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_012300772.1|25012_26272_-	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_000237816.1|26592_27045_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_024166810.1|27217_28330_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.1e-71
WP_000844627.1|30460_30703_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039045916.1|30734_31370_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|31475_32675_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|32706_33591_-	EamA family transporter	NA	NA	NA	NA	NA
WP_052247502.1|33728_34121_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_040212993.1|35877_36981_+	peptidoglycan synthetase FtsI	NA	NA	NA	NA	NA
WP_012477595.1|37045_37903_+	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
WP_001516695.1|39499_40156_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|40935_42327_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|42363_42936_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|43072_43663_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_022650047.1|43962_44580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032623594.1|44530_45193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650045.1|45203_46007_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_012477573.1|45981_46311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012477572.1|46467_47139_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	57.7	1.8e-72
WP_022650044.1|47105_47603_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.0	3.3e-18
WP_012477570.1|47768_49790_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.3	3.0e-38
WP_032635083.1|49955_50609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012477568.1|50605_51826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650043.1|51815_52100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012477567.1|52415_55535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650042.1|56094_56409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650041.1|56455_56785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650040.1|56815_57481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032623564.1|57506_57839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650038.1|57835_58615_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	3.5e-51
WP_022650037.1|58713_58992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650036.1|58991_59630_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	44.9	5.8e-44
WP_022650035.1|59866_60838_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	2.2e-66
60009:60022	attR	ATGAGCTTGAAGGT	NA	NA	NA	NA
WP_022650034.1|60842_61232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650033.1|61235_62507_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	2.9e-156
WP_022650032.1|62506_62935_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.3e-28
WP_080332517.1|63065_63323_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_022650031.1|63300_63768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650030.1|64164_64857_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	36.7	5.7e-29
