The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050779	Salmonella enterica subsp. enterica serovar Indiana strain SI85 chromosome, complete genome	4744651	647325	683966	4744651	integrase,holin,head,portal,terminase,tail,capsid,tRNA	Cronobacter_phage(70.27%)	45	637194:637215	686275:686296
637194:637215	attL	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
WP_001748617.1|647325_648363_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|648349_649243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|649271_649850_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|649969_650191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|650221_650725_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|650734_650962_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_024139063.1|650951_651377_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|651376_651778_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|651924_652101_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|652091_652688_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|652684_653014_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|653003_653864_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|653860_655882_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748628.1|656001_656208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|656181_656505_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|656501_657563_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|657559_659335_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|659495_660296_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|660357_661380_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|661383_662088_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|662091_662286_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_000447490.1|662346_662835_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000084220.1|662831_663338_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|663334_664042_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|664038_665166_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|665162_665618_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|665627_665921_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|665917_666259_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|666258_666591_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|666737_666995_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_051129153.1|667182_669153_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|669149_669479_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|669475_670660_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|670652_671240_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|671249_673262_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|673264_673795_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|673784_674510_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|674481_675027_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_054175283.1|675029_676730_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001128281.1|677317_677479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|677901_678408_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|678531_680379_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|680528_682274_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|682509_682725_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023200351.1|682952_683966_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
686275:686296	attR	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
NZ_CP050779	Salmonella enterica subsp. enterica serovar Indiana strain SI85 chromosome, complete genome	4744651	1180586	1261887	4744651	integrase,holin,head,portal,terminase,tail,capsid,tRNA	Cronobacter_phage(51.22%)	81	1188563:1188578	1216253:1216268
WP_000469807.1|1180586_1181354_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1181394_1181742_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1181897_1183118_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_089541747.1|1183110_1183629_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1184068_1185139_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1185148_1186270_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1186327_1187236_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1187196_1188357_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1188456_1188504_-	hypothetical protein	NA	NA	NA	NA	NA
1188563:1188578	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1188667_1189660_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1189726_1190026_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1190134_1190473_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1190498_1190831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1190840_1191410_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1191412_1191631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1191669_1194327_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_000088096.1|1194354_1194678_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_054175273.1|1194677_1195697_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1195693_1197478_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|1197688_1198525_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1198559_1199588_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1199599_1200298_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_031602415.1|1200357_1200849_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080871.1|1200845_1201328_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1201324_1202029_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1202025_1203153_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1203149_1203605_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1203617_1203914_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1203910_1204252_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1204251_1204584_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1204730_1204988_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1205175_1207143_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1207139_1207469_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1207465_1208650_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1208642_1209230_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1209239_1211252_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1211254_1211785_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|1211774_1212500_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|1212471_1213017_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_054175283.1|1213019_1214720_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001748131.1|1215753_1216140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1216297_1216636_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1216253:1216268	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1216907_1217645_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1217776_1218757_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1218753_1219485_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1219614_1222188_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1228137_1228593_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1228696_1229998_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1229994_1230318_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1230362_1231718_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1231832_1234493_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1234546_1235227_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1235299_1235719_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1235922_1236960_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1237075_1237765_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1238083_1238467_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1238528_1239116_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1239218_1240118_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1240135_1241470_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1241599_1242337_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1242321_1243944_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1244207_1244372_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1244368_1244944_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1244975_1245626_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1245625_1246582_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1246578_1247058_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1247309_1249109_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1249125_1250100_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1250373_1251054_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1251050_1251956_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1251967_1252696_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1252707_1253439_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1253438_1253819_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1253930_1254191_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1254228_1255155_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_023227281.1|1256487_1257405_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1257442_1258291_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1258406_1259300_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1259310_1260672_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1260675_1261311_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1261335_1261887_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP050779	Salmonella enterica subsp. enterica serovar Indiana strain SI85 chromosome, complete genome	4744651	1473626	1480474	4744651	transposase	Salmonella_virus(42.86%)	7	NA	NA
WP_106417237.1|1473626_1473773_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_109166850.1|1473788_1473932_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
WP_023226601.1|1474921_1476844_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	3.9e-301
WP_000703601.1|1476850_1477117_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
WP_023226602.1|1477085_1477475_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_001067855.1|1477573_1478278_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001590337.1|1479532_1480474_-	transporter protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
>prophage 4
NZ_CP050779	Salmonella enterica subsp. enterica serovar Indiana strain SI85 chromosome, complete genome	4744651	1712057	1721228	4744651	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1712057_1713005_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1712988_1713720_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1713700_1713808_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1713867_1714599_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1714821_1716507_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1716503_1717223_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1717269_1717737_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1717793_1718324_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1718495_1718954_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1719194_1721228_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 5
NZ_CP050779	Salmonella enterica subsp. enterica serovar Indiana strain SI85 chromosome, complete genome	4744651	1800265	1810772	4744651		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1800265_1801669_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1801846_1802740_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1803116_1804202_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1804201_1805101_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1805148_1806027_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1806027_1806579_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1806584_1807559_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1807574_1808348_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1808352_1809432_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1809458_1810772_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP050779	Salmonella enterica subsp. enterica serovar Indiana strain SI85 chromosome, complete genome	4744651	1920894	1932182	4744651	integrase	Burkholderia_phage(25.0%)	12	1915147:1915162	1929493:1929508
1915147:1915162	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|1920894_1922076_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|1922076_1922823_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|1922924_1924181_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|1924661_1924823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1924949_1925369_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|1925371_1926640_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|1927094_1927307_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1927317_1927506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|1927764_1928943_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|1929591_1929903_+	hypothetical protein	NA	NA	NA	NA	NA
1929493:1929508	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|1929982_1930678_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|1930751_1932182_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP050779	Salmonella enterica subsp. enterica serovar Indiana strain SI85 chromosome, complete genome	4744651	2112931	2152087	4744651	transposase,integrase,protease	Shigella_phage(37.5%)	30	2129368:2129384	2143955:2143971
WP_023227614.1|2112931_2113528_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000147031.1|2113524_2114256_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000070982.1|2114274_2116068_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023227615.1|2116064_2117183_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_023227616.1|2117676_2118942_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_089541817.1|2121504_2122732_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000136607.1|2124170_2126681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442952.1|2126684_2129249_+	hypothetical protein	NA	NA	NA	NA	NA
2129368:2129384	attL	TCAAACTGTTTTATTGA	NA	NA	NA	NA
WP_000716184.1|2129555_2129870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232453.1|2129881_2130400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108266.1|2130453_2130981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442951.1|2130993_2131263_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
WP_000093666.1|2131383_2131764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174655.1|2131921_2132464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142750.1|2132486_2132975_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_050516501.1|2133102_2133498_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_019841938.1|2133558_2133918_+	antitoxin	NA	NA	NA	NA	NA
WP_000744655.1|2134027_2134645_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_050516502.1|2134757_2135669_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.0e-10
WP_000870315.1|2135882_2136329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2136593_2136788_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000468111.1|2136789_2137662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165488789.1|2137871_2139100_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	3.2e-176
WP_001218334.1|2139356_2143259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087212.1|2143580_2145266_-	hypothetical protein	NA	NA	NA	NA	NA
2143955:2143971	attR	TCAATAAAACAGTTTGA	NA	NA	NA	NA
WP_000151475.1|2145275_2145941_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000699006.1|2145941_2147339_-	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_080229793.1|2149256_2150036_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.1e-137
WP_069067343.1|2150677_2151016_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001443045.1|2150935_2152087_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
>prophage 8
NZ_CP050779	Salmonella enterica subsp. enterica serovar Indiana strain SI85 chromosome, complete genome	4744651	2246419	2252231	4744651		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2246419_2247226_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2247227_2248220_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2248219_2249110_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2249233_2249635_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_051129228.1|2249934_2250822_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2251128_2251398_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2251752_2251893_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2251931_2252231_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 9
NZ_CP050779	Salmonella enterica subsp. enterica serovar Indiana strain SI85 chromosome, complete genome	4744651	2717729	2725192	4744651	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2717729_2717969_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023226907.1|2718842_2719652_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2719724_2720102_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2720249_2720792_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2720983_2721712_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2721728_2722142_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2723092_2724217_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2724733_2725192_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 10
NZ_CP050779	Salmonella enterica subsp. enterica serovar Indiana strain SI85 chromosome, complete genome	4744651	3552555	3596064	4744651	terminase,plate,integrase,lysis	Escherichia_phage(42.86%)	63	3549089:3549134	3592173:3592218
3549089:3549134	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_089541767.1|3552555_3553974_-|plate	baseplate J-like family protein	plate	A0A0U2RJZ0	Escherichia_phage	34.9	1.3e-59
WP_089541768.1|3553970_3554303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541769.1|3554299_3555016_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	30.9	9.8e-24
WP_089541770.1|3555012_3556032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541771.1|3556031_3556307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541772.1|3556303_3557020_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	37.1	6.5e-28
WP_089541773.1|3557019_3558840_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	39.7	3.4e-20
WP_089541774.1|3558963_3559542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541775.1|3559544_3559982_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	36.8	1.9e-22
WP_129422604.1|3559985_3561380_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.4	9.7e-68
WP_089541777.1|3561384_3562326_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.6	1.7e-52
WP_089541778.1|3562309_3562744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541779.1|3562740_3563169_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	40.6	4.2e-22
WP_089541780.1|3563165_3563648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045407450.1|3563716_3564748_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	46.4	2.3e-74
WP_089541781.1|3564764_3565625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541782.1|3565640_3567257_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_089541783.1|3567275_3568091_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.6	1.5e-52
WP_089541784.1|3568087_3569509_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.5	1.2e-89
WP_089541785.1|3569520_3570852_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.5	1.2e-152
WP_089541786.1|3570853_3571897_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	50.6	7.5e-65
WP_089541787.1|3571962_3572481_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	95.9	1.1e-90
WP_089541789.1|3572687_3573146_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	83.6	7.5e-62
WP_089541790.1|3573142_3573631_-	lysozyme	NA	A0A2H4FND7	Salmonella_phage	87.0	5.5e-79
WP_048224292.1|3573630_3573903_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	95.6	2.2e-40
WP_089541791.1|3574365_3575055_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.7	8.7e-54
WP_089541792.1|3575051_3575192_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	74.2	8.8e-06
WP_089541793.1|3575188_3575800_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	73.9	1.3e-61
WP_089541794.1|3575792_3575963_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	92.5	2.0e-20
WP_089541795.1|3575962_3576418_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	7.0e-60
WP_023306327.1|3576786_3577224_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	41.1	2.8e-13
WP_087934211.1|3577225_3577843_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	86.5	1.1e-68
WP_089541796.1|3577842_3578043_-	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	98.5	3.7e-29
WP_061353781.1|3578035_3578425_-	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	98.8	7.9e-36
WP_016066205.1|3578421_3578619_-	hypothetical protein	NA	K7PKS4	Enterobacteria_phage	100.0	2.6e-27
WP_021571186.1|3578615_3578960_-	helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	95.6	2.3e-55
WP_089541797.1|3578959_3580393_-	AAA family ATPase	NA	Q716D2	Shigella_phage	87.6	7.5e-233
WP_001514167.1|3580382_3581282_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	55.7	1.9e-80
WP_015571544.1|3581274_3581421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514165.1|3581510_3582077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102594.1|3582094_3582328_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
WP_021571182.1|3582369_3583122_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	64.4	5.4e-73
WP_039266666.1|3583477_3583819_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	96.5	3.9e-55
WP_058685516.1|3584245_3584521_+	hypothetical protein	NA	A0A0A0P241	Enterobacteria_phage	41.0	4.7e-11
WP_063858777.1|3584682_3584952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167810803.1|3584948_3585107_+	hypothetical protein	NA	G8C7T3	Escherichia_phage	88.5	2.7e-19
WP_089541799.1|3585103_3585313_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	94.2	7.4e-33
WP_089541800.1|3585383_3586355_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.4	2.5e-38
WP_089541801.1|3586362_3586647_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	90.4	1.6e-46
WP_089541802.1|3586665_3587511_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.7	1.3e-67
WP_089541803.1|3587507_3588188_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.7	2.2e-126
WP_089541804.1|3588184_3588613_+	regulator	NA	M9NYX4	Enterobacteria_phage	94.4	7.5e-72
WP_089541805.1|3588609_3588762_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.6e-05
WP_089541806.1|3588758_3589424_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	82.8	9.5e-106
WP_089541807.1|3589423_3589648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541808.1|3589644_3589866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541809.1|3589869_3590091_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	54.3	1.5e-15
WP_089541810.1|3590258_3590498_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	70.5	3.8e-25
WP_089541811.1|3590526_3590727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541812.1|3590994_3592158_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	68.0	1.3e-153
WP_000893225.1|3592363_3593614_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3592173:3592218	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3593625_3594729_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3595011_3596064_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 1
NZ_CP050780	Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence	239058	86579	134657	239058	transposase	Escherichia_phage(41.67%)	51	NA	NA
WP_001067855.1|86579_87284_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001493764.1|89088_89739_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001493765.1|89844_91044_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|91075_91960_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|92097_92490_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_031613424.1|94354_94705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|95081_95399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|95449_95857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|95886_96348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|96684_96915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|97576_97810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975182.1|98031_98928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572389.1|98930_99446_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833382.1|99660_101088_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000220758.1|101148_101316_+	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000078514.1|101338_102658_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_001572381.1|102937_104143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|104139_104958_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001426317.1|105600_105981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|106038_106704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|106763_107219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175476.1|107260_107497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287392.1|107994_108399_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001194555.1|108740_108944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572342.1|109974_110961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192809.1|110957_112997_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	2.5e-24
WP_001572440.1|113309_113609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043843.1|114357_114783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|115036_115852_-	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_000985911.1|115864_116275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134171.1|116376_116583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088046.1|116643_117969_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_024136327.1|117973_118267_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|118566_119271_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|119388_119592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|119719_120559_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|120552_120900_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|121122_121575_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|121659_122292_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|122429_123260_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|123390_123945_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|124088_124793_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_129422590.1|124906_125683_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|125911_126937_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|127358_128111_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_165488106.1|130035_130407_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_085940648.1|130603_131694_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|131783_132599_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|132685_132988_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|132881_133133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|133163_134657_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP050780	Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence	239058	138341	158669	239058	transposase	Escherichia_phage(55.56%)	17	NA	NA
WP_001067784.1|138341_139046_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|139130_139532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|142261_142966_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014342101.1|143374_143497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|143476_144352_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|144386_145355_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|147105_147810_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000503573.1|148011_148800_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|148930_149404_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|150306_151011_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000050481.1|151864_153406_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032492390.1|154804_155578_+	Rmt family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|155558_155840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155675077.1|156059_156221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|156226_156931_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_024136340.1|157042_157195_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_087522250.1|157299_158669_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
