The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050785	Salmonella enterica subsp. enterica serovar Indiana strain SI43 chromosome, complete genome	4993824	647177	683818	4993824	tRNA,tail,integrase,holin,portal,head,terminase,capsid	Cronobacter_phage(70.27%)	45	637046:637067	686127:686148
637046:637067	attL	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
WP_001748617.1|647177_648215_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|648201_649095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|649123_649702_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|649821_650043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|650073_650577_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|650586_650814_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_024139063.1|650803_651229_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|651228_651630_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|651776_651953_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|651943_652540_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|652536_652866_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|652855_653716_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|653712_655734_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748628.1|655853_656060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|656033_656357_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|656353_657415_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|657411_659187_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|659347_660148_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|660209_661232_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|661235_661940_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|661943_662138_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_000447490.1|662198_662687_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000084220.1|662683_663190_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|663186_663894_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|663890_665018_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|665014_665470_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|665479_665773_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|665769_666111_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|666110_666443_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|666589_666847_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_051129153.1|667034_669005_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|669001_669331_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|669327_670512_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|670504_671092_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|671101_673114_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|673116_673647_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|673636_674362_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|674333_674879_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_054175283.1|674881_676582_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001128281.1|677169_677331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|677753_678260_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|678383_680231_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|680380_682126_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|682361_682577_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023200351.1|682804_683818_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
686127:686148	attR	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
NZ_CP050785	Salmonella enterica subsp. enterica serovar Indiana strain SI43 chromosome, complete genome	4993824	782153	833089	4993824	transposase,integrase	Escherichia_phage(52.94%)	53	791570:791629	818798:819617
WP_001067855.1|782153_782858_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072108179.1|782904_783432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001255015.1|783543_783849_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|784004_784709_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839979.1|784774_785293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|785297_785714_-	fosfomycin resistance glutathione transferase FosA3	NA	NA	NA	NA	NA
WP_001067855.1|786099_786804_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|786921_787125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|787252_788092_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|788085_788433_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|788655_789108_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|789192_789825_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|789962_790793_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|790923_791478_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
791570:791629	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|791621_792326_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001255015.1|792481_792787_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|792898_794392_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|794422_794674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|794567_794870_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|794956_795772_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940648.1|795861_796951_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_165488106.1|797148_797520_-	phenol hydroxylase	NA	NA	NA	NA	NA
WP_000602738.1|799444_800197_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	38.7	2.4e-33
WP_000742814.1|800618_801644_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|801872_802649_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_001067855.1|802762_803467_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_167803264.1|803357_804527_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.1	4.6e-71
WP_001083725.1|804671_805169_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_071523897.1|805325_805571_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|805576_806368_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|806531_806879_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|806872_807712_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000050481.1|808116_809658_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012372818.1|810250_811006_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|811175_812036_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_014342213.1|812589_812715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|812856_814227_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342212.1|814225_814375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|814341_815478_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|815528_815756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|815779_815971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|816452_816995_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|817007_817868_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|818100_818805_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001447541.1|820231_821116_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
818798:819617	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCAACGAAACCAGTACCGCCATCGCCGTGGCGTAACAGATCACGGGCCACGCTGTGTCACCGTTTAAAAGTGCCACCGCCAATGTCCCGACAATGCTGACTATCAGGCTTTGAACGCAGAAGTAGAACGCGACCGCTGATCCCGCGATGTCGTCGAACTCTGCCAAAGCGCCGTTCGCGGTAACGGACACCGTGAAGACAATACCGACCGCGACAACCCACATCGGTAGGATGAAGGTGAGGAATGACGGCGAGCCGTAAAGTTCGCCGATCCCCAACAGGACCGCTCCGCAAACAAGCAACGCCATCCCACGCGCCACGCATCCTGCGATGCCCCATCTGGCGACAAAGGACTTCGCGAAACGGGTTGTCACGATCATTACAAGCGCGACAGTGGCGAAGGCAAAGCTGAATCCGATCTCGGAATATTCCGCTTGGCCTATGAGCACACGGGGAGCCGTCGAGAAGAAGACGAAGTAGGTGCCCATACCGGCGCTAAAGCCGACAGTGTAAACCCAAAAAGCCGGACTCGCGAAGATCGGCAAGACAGATCGGCGCGTCTTGACTTGATCCAGAGGGCGGGTTTCGTGCCACCTGAAACCCGCATTTAGGAGTGCGAGCATCGCCAGTATAGCCAAAGTAATGAATATCGCCTGCCATCCCAAGAACTCGCCGATCAATACTCCGGCGATAGGGCCGAGCGCAGGCACGAACGCCAGCATCGAACTGAAAAGGCCGTAGATGACGACACCCTCAGGACGG	NA	NA	NA	NA
WP_001067784.1|822040_822745_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|822829_823231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|825960_826665_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014342101.1|827073_827196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|827175_828051_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|828085_829054_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|830804_831509_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012783960.1|831499_833089_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
>prophage 3
NZ_CP050785	Salmonella enterica subsp. enterica serovar Indiana strain SI43 chromosome, complete genome	4993824	1396790	1478091	4993824	tRNA,tail,integrase,holin,portal,head,terminase,capsid	Cronobacter_phage(51.22%)	82	1404767:1404782	1432457:1432472
WP_000469807.1|1396790_1397558_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1397598_1397946_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1398101_1399322_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_089541747.1|1399314_1399833_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1400272_1401343_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1401352_1402474_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1402531_1403440_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1403400_1404561_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1404660_1404708_-	hypothetical protein	NA	NA	NA	NA	NA
1404767:1404782	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1404871_1405864_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1405930_1406230_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1406338_1406677_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1406702_1407035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1407044_1407614_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1407616_1407835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1407873_1410531_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_000088096.1|1410558_1410882_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_054175273.1|1410881_1411901_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1411897_1413682_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|1413892_1414729_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1414763_1415792_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1415803_1416502_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_031602415.1|1416561_1417053_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080871.1|1417049_1417532_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1417528_1418233_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1418229_1419357_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1419353_1419809_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1419821_1420118_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1420114_1420456_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1420455_1420788_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1420934_1421192_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1421379_1423347_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1423343_1423673_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1423669_1424854_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1424846_1425434_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1425443_1427456_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1427458_1427989_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|1427978_1428704_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|1428675_1429221_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_054175283.1|1429223_1430924_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001748131.1|1431957_1432344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1432501_1432840_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1432457:1432472	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1433111_1433849_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1433980_1434961_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1434957_1435689_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1435818_1438392_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1444340_1444796_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1444899_1446201_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1446197_1446521_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1446565_1447921_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1448035_1450696_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1450749_1451430_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1451502_1451922_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1452125_1453163_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1453278_1453968_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1454286_1454670_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1454731_1455319_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1455421_1456321_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1456338_1457673_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1457802_1458540_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1458524_1460147_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1460410_1460575_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1460571_1461147_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1461178_1461829_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1461828_1462785_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1462781_1463261_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1463512_1465312_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1465328_1466303_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1466576_1467257_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1467253_1468159_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1468170_1468899_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1468910_1469642_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1469641_1470022_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1470133_1470394_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1470431_1471358_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1471473_1472670_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023227281.1|1472691_1473609_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1473646_1474495_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1474610_1475504_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1475514_1476876_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1476879_1477515_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1477539_1478091_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP050785	Salmonella enterica subsp. enterica serovar Indiana strain SI43 chromosome, complete genome	4993824	1689830	1694495	4993824	transposase	Salmonella_virus(50.0%)	6	NA	NA
WP_106417237.1|1689830_1689977_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_109166850.1|1689992_1690136_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
WP_023226601.1|1691125_1693048_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	3.9e-301
WP_000703601.1|1693054_1693321_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
WP_023226602.1|1693289_1693679_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_001067855.1|1693790_1694495_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 5
NZ_CP050785	Salmonella enterica subsp. enterica serovar Indiana strain SI43 chromosome, complete genome	4993824	1928258	1937429	4993824	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1928258_1929206_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1929189_1929921_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1929901_1930009_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1930068_1930800_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1931022_1932708_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1932704_1933424_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1933470_1933938_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1933994_1934525_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1934696_1935155_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1935395_1937429_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 6
NZ_CP050785	Salmonella enterica subsp. enterica serovar Indiana strain SI43 chromosome, complete genome	4993824	2052642	2063149	4993824		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|2052642_2054046_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|2054223_2055117_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|2055493_2056579_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|2056578_2057478_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|2057525_2058404_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|2058404_2058956_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|2058961_2059936_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|2059951_2060725_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|2060729_2061809_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|2061835_2063149_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
NZ_CP050785	Salmonella enterica subsp. enterica serovar Indiana strain SI43 chromosome, complete genome	4993824	2173269	2184559	4993824	integrase	Burkholderia_phage(25.0%)	12	2167526:2167541	2181870:2181885
2167526:2167541	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|2173269_2174451_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|2174451_2175198_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|2175299_2176556_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|2177036_2177198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|2177324_2177744_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|2177746_2179015_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|2179469_2179682_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2179692_2179881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|2180139_2181318_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|2181968_2182280_+	hypothetical protein	NA	NA	NA	NA	NA
2181870:2181885	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|2182359_2183055_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|2183128_2184559_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP050785	Salmonella enterica subsp. enterica serovar Indiana strain SI43 chromosome, complete genome	4993824	2365308	2404464	4993824	protease,transposase,integrase	Shigella_phage(37.5%)	30	2381745:2381761	2396332:2396348
WP_023227614.1|2365308_2365905_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000147031.1|2365901_2366633_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000070982.1|2366651_2368445_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023227615.1|2368441_2369560_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_023227616.1|2370053_2371319_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_089541817.1|2373881_2375109_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000136607.1|2376547_2379058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442952.1|2379061_2381626_+	hypothetical protein	NA	NA	NA	NA	NA
2381745:2381761	attL	TCAAACTGTTTTATTGA	NA	NA	NA	NA
WP_000716184.1|2381932_2382247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232453.1|2382258_2382777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108266.1|2382830_2383358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442951.1|2383370_2383640_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
WP_000093666.1|2383760_2384141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174655.1|2384298_2384841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142750.1|2384863_2385352_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_050516501.1|2385479_2385875_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_019841938.1|2385935_2386295_+	antitoxin	NA	NA	NA	NA	NA
WP_000744655.1|2386404_2387022_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_050516502.1|2387134_2388046_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.0e-10
WP_000870315.1|2388259_2388706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2388970_2389165_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000468111.1|2389166_2390039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165488789.1|2390248_2391477_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	3.2e-176
WP_001218334.1|2391733_2395636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087212.1|2395957_2397643_-	hypothetical protein	NA	NA	NA	NA	NA
2396332:2396348	attR	TCAATAAAACAGTTTGA	NA	NA	NA	NA
WP_000151475.1|2397652_2398318_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000699006.1|2398318_2399716_-	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_080229793.1|2401633_2402413_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.1e-137
WP_069067343.1|2403054_2403393_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001443045.1|2403312_2404464_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
>prophage 9
NZ_CP050785	Salmonella enterica subsp. enterica serovar Indiana strain SI43 chromosome, complete genome	4993824	2498795	2504607	4993824		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2498795_2499602_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2499603_2500596_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2500595_2501486_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2501609_2502011_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_051129228.1|2502310_2503198_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2503504_2503774_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2504128_2504269_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2504307_2504607_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 10
NZ_CP050785	Salmonella enterica subsp. enterica serovar Indiana strain SI43 chromosome, complete genome	4993824	2969329	2976792	4993824	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2969329_2969569_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023226907.1|2970442_2971252_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2971324_2971702_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2971849_2972392_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2972583_2973312_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_167803270.1|2973328_2973742_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	39.1	4.9e-20
WP_023226903.1|2974692_2975817_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2976333_2976792_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 11
NZ_CP050785	Salmonella enterica subsp. enterica serovar Indiana strain SI43 chromosome, complete genome	4993824	3801216	3846120	4993824	lysis,coat,protease,portal,terminase,integrase	Enterobacteria_phage(73.13%)	68	3800883:3800928	3842229:3842274
3800883:3800928	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3801216_3801579_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3801575_3802508_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3802497_3803955_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3804013_3806017_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3806152_3806401_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3806421_3806715_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3806853_3808830_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3808829_3810266_-	phage DNA ejection protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3810276_3810966_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3810968_3811424_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3811423_3812125_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3812128_3813547_-	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3813506_3814007_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3813990_3814551_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3814591_3815884_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_051129359.1|3815883_3816792_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	94.1	4.3e-149
WP_051129358.1|3816805_3818971_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_051129357.1|3818971_3820471_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	9.1e-306
WP_000729923.1|3820448_3820937_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3820940_3821345_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3821344_3821734_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3821737_3821980_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3822202_3822733_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3822945_3823413_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3823409_3823907_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3823884_3824088_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3824518_3825292_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3825288_3825468_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3825448_3825652_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3825648_3825873_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3825869_3826481_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3826473_3826650_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3826642_3826984_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3826986_3827163_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3827129_3827303_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3827299_3827737_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3827810_3828080_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3828076_3829453_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3829449_3830271_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_000166961.1|3830257_3830419_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001103492.1|3830453_3830735_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3830845_3831061_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3831171_3831861_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3832025_3833105_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3833143_3833347_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3833710_3834013_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3834025_3834613_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3834826_3835021_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_072097849.1|3835104_3835719_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	94.4	7.0e-47
WP_000713613.1|3835752_3836040_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3836315_3836630_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3836714_3836873_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_051129356.1|3836853_3837009_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	4.7e-24
WP_000902092.1|3837031_3837175_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3837171_3837879_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3837878_3838163_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3838209_3838503_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3838513_3838684_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3838680_3839190_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3839186_3839420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|3839406_3840051_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3840050_3840335_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3840327_3840612_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3840680_3840821_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3841050_3842214_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893225.1|3842419_3843670_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3842229:3842274	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3843681_3844785_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3845067_3846120_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
