The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050764	Salmonella enterica subsp. enterica serovar Indiana strain SI111 chromosome, complete genome	4858857	641135	675182	4858857	terminase,holin,tail,head,portal,capsid	Cronobacter_phage(74.29%)	41	NA	NA
WP_064441647.1|641135_642656_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_001748620.1|644074_644653_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|644772_644994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|645024_645528_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|645537_645765_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_024139063.1|645754_646180_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|646179_646581_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|646727_646904_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|646894_647491_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|647487_647817_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|647806_648667_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|648663_650685_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748628.1|650804_651011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|650984_651308_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|651304_652366_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|652362_654138_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|654298_655099_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|655160_656183_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|656186_656891_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|656894_657089_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_000447490.1|657149_657638_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000084220.1|657634_658141_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|658137_658845_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|658841_659969_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|659965_660421_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|660430_660724_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|660720_661062_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|661061_661394_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|661540_661798_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_167804394.1|661985_663956_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.6	1.8e-269
WP_001002797.1|663952_664282_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|664278_665463_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|665455_666043_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|666052_668065_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|668067_668598_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|668587_669313_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|669284_669830_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_054175283.1|669832_671533_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001128281.1|672120_672282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|672704_673211_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|673334_675182_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 2
NZ_CP050764	Salmonella enterica subsp. enterica serovar Indiana strain SI111 chromosome, complete genome	4858857	1211120	1292422	4858857	terminase,tRNA,integrase,holin,tail,head,portal,capsid	Cronobacter_phage(51.22%)	82	1219097:1219112	1246787:1246802
WP_000469807.1|1211120_1211888_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1211928_1212276_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1212431_1213652_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_089541747.1|1213644_1214163_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1214602_1215673_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1215682_1216804_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1216861_1217770_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1217730_1218891_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1218990_1219038_-	hypothetical protein	NA	NA	NA	NA	NA
1219097:1219112	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1219201_1220194_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1220260_1220560_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1220668_1221007_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1221032_1221365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1221374_1221944_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1221946_1222165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1222203_1224861_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_000088096.1|1224888_1225212_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_054175273.1|1225211_1226231_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1226227_1228012_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|1228222_1229059_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1229093_1230122_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1230133_1230832_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_031602415.1|1230891_1231383_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080871.1|1231379_1231862_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1231858_1232563_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1232559_1233687_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1233683_1234139_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1234151_1234448_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1234444_1234786_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1234785_1235118_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1235264_1235522_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1235709_1237677_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1237673_1238003_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1237999_1239184_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1239176_1239764_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1239773_1241786_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1241788_1242319_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|1242308_1243034_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|1243005_1243551_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_054175283.1|1243553_1245254_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001748131.1|1246287_1246674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1246831_1247170_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1246787:1246802	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1247441_1248179_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1248310_1249291_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1249287_1250019_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1250148_1252722_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1258671_1259127_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1259230_1260532_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1260528_1260852_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1260896_1262252_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1262366_1265027_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1265080_1265761_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1265833_1266253_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1266456_1267494_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1267609_1268299_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1268617_1269001_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1269062_1269650_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1269752_1270652_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1270669_1272004_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1272133_1272871_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1272855_1274478_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1274741_1274906_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1274902_1275478_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1275509_1276160_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1276159_1277116_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1277112_1277592_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1277843_1279643_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1279659_1280634_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1280907_1281588_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1281584_1282490_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1282501_1283230_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1283241_1283973_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1283972_1284353_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1284464_1284725_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1284762_1285689_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1285804_1287001_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023227281.1|1287022_1287940_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1287977_1288826_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1288941_1289835_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1289845_1291207_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1291210_1291846_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1291870_1292422_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP050764	Salmonella enterica subsp. enterica serovar Indiana strain SI111 chromosome, complete genome	4858857	1504160	1511021	4858857	transposase	Salmonella_virus(42.86%)	7	NA	NA
WP_106417237.1|1504160_1504307_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_109166850.1|1504322_1504466_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
WP_023226601.1|1505455_1507378_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	3.9e-301
WP_000703601.1|1507384_1507651_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
WP_023226602.1|1507619_1508009_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_001067855.1|1508120_1508825_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001590337.1|1510079_1511021_-	transporter protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
>prophage 4
NZ_CP050764	Salmonella enterica subsp. enterica serovar Indiana strain SI111 chromosome, complete genome	4858857	1742589	1751760	4858857	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1742589_1743537_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1743520_1744252_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1744232_1744340_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1744399_1745131_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1745353_1747039_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1747035_1747755_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1747801_1748269_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1748325_1748856_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1749027_1749486_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1749726_1751760_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 5
NZ_CP050764	Salmonella enterica subsp. enterica serovar Indiana strain SI111 chromosome, complete genome	4858857	1830792	1841299	4858857		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1830792_1832196_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1832373_1833267_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1833643_1834729_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1834728_1835628_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1835675_1836554_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1836554_1837106_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1837111_1838086_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1838101_1838875_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1838879_1839959_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1839985_1841299_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP050764	Salmonella enterica subsp. enterica serovar Indiana strain SI111 chromosome, complete genome	4858857	1951420	1962708	4858857	integrase	Burkholderia_phage(25.0%)	12	1945674:1945689	1960019:1960034
1945674:1945689	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|1951420_1952602_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|1952602_1953349_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|1953450_1954707_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|1955187_1955349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1955475_1955895_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|1955897_1957166_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|1957620_1957833_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1957843_1958032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|1958290_1959469_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|1960117_1960429_+	hypothetical protein	NA	NA	NA	NA	NA
1960019:1960034	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|1960508_1961204_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|1961277_1962708_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP050764	Salmonella enterica subsp. enterica serovar Indiana strain SI111 chromosome, complete genome	4858857	2143457	2184765	4858857	transposase,protease,integrase	Shigella_phage(25.0%)	30	2151241:2151254	2185665:2185678
WP_023227614.1|2143457_2144054_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000147031.1|2144050_2144782_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000070982.1|2144800_2146594_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023227615.1|2146590_2147709_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_023227616.1|2148202_2149468_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
2151241:2151254	attL	CTGGCGCTGGCTGA	NA	NA	NA	NA
WP_089541817.1|2152030_2153258_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_167804399.1|2154696_2157207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442952.1|2157210_2159775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000716184.1|2160081_2160396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232453.1|2160407_2160926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108266.1|2160979_2161507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442951.1|2161519_2161789_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
WP_000093666.1|2161909_2162290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174655.1|2162447_2162990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142750.1|2163012_2163501_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_050516501.1|2163628_2164024_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_019841938.1|2164084_2164444_+	antitoxin	NA	NA	NA	NA	NA
WP_000744655.1|2164553_2165171_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_050516502.1|2165283_2166195_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.0e-10
WP_000870315.1|2166408_2166855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2167119_2167314_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000468111.1|2167315_2168188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218334.1|2169877_2173780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087212.1|2174101_2175787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000151475.1|2175796_2176462_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000699006.1|2176462_2177860_-	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_080229793.1|2179777_2180557_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.1e-137
WP_069067343.1|2181198_2181537_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001443045.1|2181456_2182608_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
WP_019841501.1|2183565_2184765_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	39.6	4.5e-74
2185665:2185678	attR	TCAGCCAGCGCCAG	NA	NA	NA	NA
>prophage 8
NZ_CP050764	Salmonella enterica subsp. enterica serovar Indiana strain SI111 chromosome, complete genome	4858857	2276987	2282799	4858857		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2276987_2277794_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2277795_2278788_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2278787_2279678_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2279801_2280203_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_051129228.1|2280502_2281390_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2281696_2281966_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2282320_2282461_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2282499_2282799_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 9
NZ_CP050764	Salmonella enterica subsp. enterica serovar Indiana strain SI111 chromosome, complete genome	4858857	2748856	2756319	4858857	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2748856_2749096_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023226907.1|2749969_2750779_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2750851_2751229_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2751376_2751919_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2752110_2752839_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2752855_2753269_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2754219_2755344_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2755860_2756319_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 10
NZ_CP050764	Salmonella enterica subsp. enterica serovar Indiana strain SI111 chromosome, complete genome	4858857	3573916	3627758	4858857	terminase,lysis,coat,integrase,transposase,portal,protease	Enterobacteria_phage(72.06%)	75	3582521:3582566	3623867:3623912
WP_165488789.1|3573916_3575144_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	3.2e-176
WP_000062033.1|3575925_3576462_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000781485.1|3576523_3577285_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_064441706.1|3577268_3579830_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
WP_000899098.1|3579834_3581160_+	fimbrial usher protein StbD	NA	NA	NA	NA	NA
WP_023227313.1|3581125_3581884_+	fimbrial assembly chaperone	NA	NA	NA	NA	NA
WP_023227314.1|3581931_3582126_-	hypothetical protein	NA	NA	NA	NA	NA
3582521:3582566	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3582854_3583217_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3583213_3584146_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3584135_3585593_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3585651_3587655_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3587790_3588039_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3588059_3588353_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3588491_3590468_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3590467_3591904_-	phage DNA ejection protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3591914_3592604_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3592606_3593062_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3593061_3593763_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3593766_3595185_-	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3595144_3595645_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3595628_3596189_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3596229_3597522_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_051129359.1|3597521_3598430_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	94.1	4.3e-149
WP_051129358.1|3598443_3600609_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_051129357.1|3600609_3602109_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	9.1e-306
WP_000729923.1|3602086_3602575_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3602578_3602983_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3602982_3603372_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3603375_3603618_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3603840_3604371_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3604583_3605051_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3605047_3605545_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3605522_3605726_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3606156_3606930_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3606926_3607106_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3607086_3607290_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3607286_3607511_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3607507_3608119_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3608111_3608288_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3608280_3608622_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3608624_3608801_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3608767_3608941_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3608937_3609375_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3609448_3609718_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3609714_3611091_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3611087_3611909_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_000166961.1|3611895_3612057_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001103492.1|3612091_3612373_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3612483_3612699_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3612809_3613499_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3613663_3614743_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3614781_3614985_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3615348_3615651_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3615663_3616251_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3616464_3616659_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_072097849.1|3616742_3617357_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	94.4	7.0e-47
WP_000713613.1|3617390_3617678_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3617953_3618268_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3618352_3618511_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_051129356.1|3618491_3618647_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	4.7e-24
WP_000902092.1|3618669_3618813_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3618809_3619517_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3619516_3619801_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3619847_3620141_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3620151_3620322_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3620318_3620828_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3620824_3621058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|3621044_3621689_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3621688_3621973_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3621965_3622250_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3622318_3622459_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3622688_3623852_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893225.1|3624057_3625308_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3623867:3623912	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3625319_3626423_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3626705_3627758_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 11
NZ_CP050764	Salmonella enterica subsp. enterica serovar Indiana strain SI111 chromosome, complete genome	4858857	3688094	3804881	4858857	transposase,protease,tRNA,plate	Escherichia_phage(28.57%)	116	NA	NA
WP_042634304.1|3688094_3689174_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_167804410.1|3689175_3689949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|3689941_3691084_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|3691093_3692152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|3692475_3693057_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|3693056_3694214_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|3694236_3694692_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|3694714_3695755_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|3695803_3696382_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|3696449_3697025_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|3697453_3698695_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|3699257_3699539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|3699588_3699780_-	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	58.5	1.4e-09
WP_001151575.1|3699871_3700213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|3700585_3700978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|3701581_3701875_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|3701879_3703205_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|3703265_3703472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|3703573_3703984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|3703996_3704812_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_001043843.1|3705065_3705491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572440.1|3706239_3706539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192809.1|3706851_3708891_-	ATP-dependent helicase	NA	Q331U3	Clostridium_botulinum_C_phage	23.2	4.2e-27
WP_001572342.1|3708887_3709874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194555.1|3710904_3711108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287392.1|3711449_3711854_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000175476.1|3712351_3712588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|3712629_3713085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167804411.1|3713144_3713810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|3713867_3714248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|3714890_3715709_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|3715705_3716911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|3717190_3718510_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000220758.1|3718532_3718700_-	hypothetical protein	NA	A0A1P7WFU2	Pectobacterium_phage	54.5	1.9e-07
WP_000833382.1|3718760_3720188_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|3720402_3720918_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|3720920_3721817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|3722038_3722272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|3722933_3723164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|3723500_3723962_+	hypothetical protein	NA	A0A2H4IBJ0	Erwinia_phage	37.9	7.7e-14
WP_000074418.1|3723991_3724399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|3724449_3724767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|3725143_3725494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012783960.1|3725603_3727193_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
WP_001067855.1|3727183_3727888_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|3728005_3728209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|3728336_3729176_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3729169_3729517_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|3729739_3730192_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|3730276_3730909_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|3731046_3731877_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|3732007_3732562_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|3732705_3733410_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014342101.1|3733818_3733941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|3733920_3734796_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|3734830_3735799_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|3737549_3738254_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|3738639_3739056_+	fosfomycin resistance glutathione transferase FosA3	NA	NA	NA	NA	NA
WP_014839979.1|3739060_3739579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|3739644_3740349_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|3740395_3740797_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|3740946_3741807_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001403349.1|3741989_3742415_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.7e-53
WP_001067855.1|3742391_3743096_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|3743851_3744703_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|3745010_3745826_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|3745886_3746690_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3746689_3747526_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|3747586_3748291_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002914189.1|3748610_3749786_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_000347934.1|3749809_3752962_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_000888203.1|3753031_3753511_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|3753602_3754307_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000503573.1|3754508_3755297_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|3755427_3755901_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
WP_001067855.1|3756803_3757508_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000050481.1|3758361_3759903_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032492390.1|3761301_3762075_+	Rmt family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|3762055_3762337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|3762723_3763428_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000132483.1|3763983_3765288_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_023227773.1|3765284_3766628_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_023227772.1|3766631_3767168_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119443.1|3767234_3767720_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000379146.1|3767862_3768246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081544.1|3768230_3768716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312802.1|3769020_3769506_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_077907151.1|3769761_3770094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013884.1|3770393_3771902_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_023227770.1|3771925_3772471_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_023227769.1|3772570_3775210_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.9	5.3e-75
WP_023227768.1|3775577_3776480_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000750543.1|3776466_3777291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108007.1|3777287_3777782_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_023227767.1|3777797_3779681_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145239.1|3779677_3780673_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367614.1|3780683_3781739_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001670675.1|3782270_3783002_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|3783065_3783533_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801238.1|3783529_3784252_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052780.1|3784286_3785042_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|3785113_3786481_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207222.1|3786536_3787307_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230970.1|3787384_3788185_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127535.1|3788316_3789492_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648534.1|3789596_3790511_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227766.1|3790531_3791335_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.0	4.6e-38
WP_001140158.1|3797308_3797875_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594021.1|3798064_3799096_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001287486.1|3799088_3799742_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874215.1|3799780_3800596_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202315.1|3800714_3801119_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000093991.1|3801115_3801823_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260683.1|3801933_3803652_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000252575.1|3803725_3804427_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000560527.1|3804458_3804881_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
