The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050762	Salmonella enterica subsp. enterica serovar Indiana strain SI115 chromosome, complete genome	4783488	647276	683917	4783488	portal,head,integrase,tRNA,tail,terminase,holin,capsid	Cronobacter_phage(70.27%)	45	637145:637166	686226:686247
637145:637166	attL	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
WP_001748617.1|647276_648314_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|648300_649194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|649222_649801_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|649920_650142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|650172_650676_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|650685_650913_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_024139063.1|650902_651328_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|651327_651729_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|651875_652052_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|652042_652639_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|652635_652965_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|652954_653815_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|653811_655833_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748628.1|655952_656159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|656132_656456_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|656452_657514_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|657510_659286_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|659446_660247_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|660308_661331_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|661334_662039_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|662042_662237_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_000447490.1|662297_662786_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000084220.1|662782_663289_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|663285_663993_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|663989_665117_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|665113_665569_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|665578_665872_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|665868_666210_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|666209_666542_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|666688_666946_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_051129153.1|667133_669104_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|669100_669430_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|669426_670611_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|670603_671191_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|671200_673213_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|673215_673746_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|673735_674461_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200791.1|674432_674978_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_054175283.1|674980_676681_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001128281.1|677268_677430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|677852_678359_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|678482_680330_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|680479_682225_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|682460_682676_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023200351.1|682903_683917_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
686226:686247	attR	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
NZ_CP050762	Salmonella enterica subsp. enterica serovar Indiana strain SI115 chromosome, complete genome	4783488	1179767	1261068	4783488	portal,tRNA,integrase,head,tail,terminase,holin,capsid	Cronobacter_phage(51.22%)	82	1187744:1187759	1215434:1215449
WP_000469807.1|1179767_1180535_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1180575_1180923_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1181078_1182299_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1182291_1182810_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1183249_1184320_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1184329_1185451_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1185508_1186417_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1186377_1187538_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1187637_1187685_-	hypothetical protein	NA	NA	NA	NA	NA
1187744:1187759	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1187848_1188841_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1188907_1189207_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1189315_1189654_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1189679_1190012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1190021_1190591_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1190593_1190812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1190850_1193508_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_000088096.1|1193535_1193859_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_054175273.1|1193858_1194878_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1194874_1196659_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|1196869_1197706_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1197740_1198769_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1198780_1199479_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_031602415.1|1199538_1200030_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080871.1|1200026_1200509_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1200505_1201210_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1201206_1202334_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1202330_1202786_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1202798_1203095_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1203091_1203433_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1203432_1203765_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1203911_1204169_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1204356_1206324_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1206320_1206650_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1206646_1207831_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1207823_1208411_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1208420_1210433_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1210435_1210966_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|1210955_1211681_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200791.1|1211652_1212198_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_054175283.1|1212200_1213901_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001748131.1|1214934_1215321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1215478_1215817_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1215434:1215449	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1216088_1216826_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1216957_1217938_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1217934_1218666_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1218795_1221369_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1227317_1227773_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1227876_1229178_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1229174_1229498_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1229542_1230898_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1231012_1233673_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1233726_1234407_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1234479_1234899_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1235102_1236140_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1236255_1236945_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1237263_1237647_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1237708_1238296_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1238398_1239298_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1239315_1240650_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1240779_1241517_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1241501_1243124_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1243387_1243552_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1243548_1244124_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1244155_1244806_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1244805_1245762_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1245758_1246238_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1246489_1248289_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1248305_1249280_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1249553_1250234_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1250230_1251136_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1251147_1251876_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1251887_1252619_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1252618_1252999_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1253110_1253371_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1253408_1254335_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1254450_1255647_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023227281.1|1255668_1256586_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1256623_1257472_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1257587_1258481_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1258491_1259853_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1259856_1260492_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1260516_1261068_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP050762	Salmonella enterica subsp. enterica serovar Indiana strain SI115 chromosome, complete genome	4783488	1711225	1720396	4783488	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1711225_1712173_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1712156_1712888_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1712868_1712976_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1713035_1713767_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1713989_1715675_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1715671_1716391_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1716437_1716905_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1716961_1717492_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1717663_1718122_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1718362_1720396_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 4
NZ_CP050762	Salmonella enterica subsp. enterica serovar Indiana strain SI115 chromosome, complete genome	4783488	1799428	1809935	4783488		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1799428_1800832_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1801009_1801903_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1802279_1803365_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1803364_1804264_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1804311_1805190_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1805190_1805742_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1805747_1806722_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1806737_1807511_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1807515_1808595_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1808621_1809935_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP050762	Salmonella enterica subsp. enterica serovar Indiana strain SI115 chromosome, complete genome	4783488	1920056	1931346	4783488	integrase	Burkholderia_phage(25.0%)	12	1914310:1914325	1928657:1928672
1914310:1914325	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|1920056_1921238_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|1921238_1921985_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|1922086_1923343_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|1923823_1923985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1924111_1924531_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|1924533_1925802_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|1926256_1926469_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1926479_1926668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|1926926_1928105_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|1928755_1929067_+	hypothetical protein	NA	NA	NA	NA	NA
1928657:1928672	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|1929146_1929842_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|1929915_1931346_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP050762	Salmonella enterica subsp. enterica serovar Indiana strain SI115 chromosome, complete genome	4783488	2112095	2151251	4783488	protease,integrase,transposase	Shigella_phage(37.5%)	30	2128532:2128548	2143119:2143135
WP_023227614.1|2112095_2112692_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000147031.1|2112688_2113420_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000070982.1|2113438_2115232_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023227615.1|2115228_2116347_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_023227616.1|2116840_2118106_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_089541817.1|2120668_2121896_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000136607.1|2123334_2125845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442952.1|2125848_2128413_+	hypothetical protein	NA	NA	NA	NA	NA
2128532:2128548	attL	TCAAACTGTTTTATTGA	NA	NA	NA	NA
WP_000716184.1|2128719_2129034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232453.1|2129045_2129564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108266.1|2129617_2130145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442951.1|2130157_2130427_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
WP_000093666.1|2130547_2130928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174655.1|2131085_2131628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142750.1|2131650_2132139_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_050516501.1|2132266_2132662_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_019841938.1|2132722_2133082_+	antitoxin	NA	NA	NA	NA	NA
WP_000744655.1|2133191_2133809_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_050516502.1|2133921_2134833_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.0e-10
WP_000870315.1|2135046_2135493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2135757_2135952_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000468111.1|2135953_2136826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165488789.1|2137035_2138264_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	3.2e-176
WP_001218334.1|2138520_2142423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087212.1|2142744_2144430_-	hypothetical protein	NA	NA	NA	NA	NA
2143119:2143135	attR	TCAATAAAACAGTTTGA	NA	NA	NA	NA
WP_000151475.1|2144439_2145105_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000699006.1|2145105_2146503_-	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_080229793.1|2148420_2149200_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.1e-137
WP_069067343.1|2149841_2150180_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001443045.1|2150099_2151251_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
>prophage 7
NZ_CP050762	Salmonella enterica subsp. enterica serovar Indiana strain SI115 chromosome, complete genome	4783488	2245583	2251395	4783488		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2245583_2246390_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2246391_2247384_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2247383_2248274_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2248397_2248799_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_051129228.1|2249098_2249986_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2250292_2250562_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2250916_2251057_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2251095_2251395_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 8
NZ_CP050762	Salmonella enterica subsp. enterica serovar Indiana strain SI115 chromosome, complete genome	4783488	2714492	2721955	4783488	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2714492_2714732_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023226907.1|2715605_2716415_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2716487_2716865_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2717012_2717555_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2717746_2718475_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2718491_2718905_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2719855_2720980_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2721496_2721955_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 9
NZ_CP050762	Salmonella enterica subsp. enterica serovar Indiana strain SI115 chromosome, complete genome	4783488	3546379	3636319	4783488	holin,integrase,plate,protease,tail,lysis,terminase,coat,portal	Enterobacteria_phage(46.34%)	131	3546046:3546091	3632428:3632473
3546046:3546091	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3546379_3546742_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3546738_3547671_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3547660_3549118_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3549176_3551180_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3551315_3551564_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3551584_3551878_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3552016_3553993_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3553992_3555429_-	phage DNA ejection protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3555439_3556129_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3556131_3556587_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3556586_3557288_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3557291_3558710_-	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3558669_3559170_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3559153_3559714_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3559754_3561047_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_051129359.1|3561046_3561955_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	94.1	4.3e-149
WP_051129358.1|3561968_3564134_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_051129357.1|3564134_3565634_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	9.1e-306
WP_000729923.1|3565611_3566100_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3566103_3566508_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3566507_3566897_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3566900_3567143_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3567365_3567896_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3568108_3568576_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3568572_3569070_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3569047_3569251_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3569681_3570455_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3570451_3570631_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3570611_3570815_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3570811_3571036_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3571032_3571644_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3571636_3571813_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3571805_3572147_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3572149_3572326_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3572292_3572466_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3572462_3572900_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3572973_3573243_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3573239_3574616_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3574612_3575434_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_000166961.1|3575420_3575582_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001103492.1|3575616_3575898_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3576008_3576224_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3576334_3577024_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3577188_3578268_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3578306_3578510_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3578873_3579176_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3579188_3579776_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3579989_3580184_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_072097849.1|3580267_3580882_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	94.4	7.0e-47
WP_000713613.1|3580915_3581203_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3581478_3581793_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3581877_3582036_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_051129356.1|3582016_3582172_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	4.7e-24
WP_000902092.1|3582194_3582338_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3582334_3583042_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3583041_3583326_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3583372_3583666_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3583676_3583847_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3583843_3584353_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3584349_3584583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|3584569_3585214_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3585213_3585498_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3585490_3585775_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3585843_3585984_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3586213_3587377_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_129406984.1|3587935_3589138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064441708.1|3589197_3590436_-	hypothetical protein	NA	S4TRC1	Salmonella_phage	44.6	1.0e-92
WP_031604121.1|3590437_3590869_-|tail	tail assembly chaperone	tail	K7P7H0	Enterobacteria_phage	37.1	1.1e-11
WP_064441710.1|3590881_3591649_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	58.0	1.4e-44
WP_064441712.1|3591648_3592329_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.9	1.8e-104
WP_064441714.1|3592325_3593516_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J5T1	uncultured_Caudovirales_phage	75.6	2.5e-165
WP_064441716.1|3593516_3593870_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	75.2	5.3e-47
WP_064441718.1|3593869_3594625_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	72.4	8.0e-85
WP_064441720.1|3594818_3595166_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	57.1	1.9e-25
WP_064441722.1|3595152_3596244_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	59.4	1.9e-119
WP_064441723.1|3596246_3596549_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	55.0	1.3e-25
WP_129406985.1|3596545_3597136_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	63.1	4.2e-57
WP_064441727.1|3597135_3599112_-	hypothetical protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	45.1	1.3e-134
WP_064441729.1|3599108_3599255_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	74.5	3.2e-14
WP_064441731.1|3599290_3599734_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	52.8	7.9e-32
WP_064441733.1|3599737_3600178_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	8.3e-58
WP_064441837.1|3600187_3601339_-	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.5	2.2e-174
WP_064441735.1|3601344_3601896_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	45.7	8.8e-41
WP_064441736.1|3601888_3602293_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	71.8	9.7e-45
WP_064441738.1|3602292_3602802_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	42.4	2.2e-22
WP_064441740.1|3602801_3603218_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	63.0	2.7e-42
WP_064441742.1|3603204_3603552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441744.1|3603592_3604534_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.7	9.2e-139
WP_064441746.1|3604545_3605040_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	9.3e-50
WP_064441748.1|3605043_3606246_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.5	1.4e-107
WP_064441838.1|3606297_3606846_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	54.6	1.1e-43
WP_064441750.1|3606901_3608353_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	69.0	1.4e-191
WP_064441752.1|3608357_3609971_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	84.4	3.0e-278
WP_064441754.1|3609973_3610447_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	69.5	9.6e-52
WP_064441756.1|3610477_3611110_-	hypothetical protein	NA	I6S676	Salmonella_phage	75.9	7.9e-94
WP_064441758.1|3611198_3611402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441840.1|3611477_3611912_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	59.7	6.1e-37
WP_064441760.1|3611944_3612385_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	84.6	1.0e-63
WP_064441762.1|3612368_3612692_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	73.3	1.6e-37
WP_064441763.1|3613335_3614025_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	4.9e-57
WP_064441765.1|3614134_3614728_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	58.1	2.1e-56
WP_077951536.1|3614720_3614891_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	61.8	2.9e-11
WP_064441767.1|3614883_3615333_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	51.4	1.8e-36
WP_063161920.1|3616259_3616682_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	85.2	6.1e-66
WP_064441771.1|3616683_3617217_-	ead/Ea22-like family protein	NA	A0A193GYX5	Enterobacter_phage	38.5	6.0e-10
WP_064441773.1|3617213_3617459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441777.1|3617943_3618243_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	48.4	3.1e-16
WP_064441779.1|3618242_3619676_-	AAA family ATPase	NA	Q716D2	Shigella_phage	86.5	2.0e-230
WP_064441781.1|3619665_3620565_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	55.0	2.4e-80
WP_015571544.1|3620557_3620704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441783.1|3620793_3621360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514164.1|3621389_3621641_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	54.7	9.0e-17
WP_064441784.1|3621768_3622461_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.4	6.9e-59
WP_063407876.1|3622496_3622973_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	64.7	1.4e-50
WP_064441842.1|3623595_3624201_+	hypothetical protein	NA	A0A2C9D0J8	Yersinia_phage	36.6	2.5e-28
WP_167802264.1|3624591_3624750_+	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	88.5	3.5e-19
WP_064441788.1|3624746_3624950_+	hypothetical protein	NA	K7PM31	Enterobacteria_phage	80.9	9.5e-25
WP_064441790.1|3625020_3625959_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	73.7	1.6e-37
WP_064441792.1|3625966_3626251_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	61.7	3.1e-29
WP_064441794.1|3626265_3627111_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.0	3.7e-70
WP_064441796.1|3627107_3627788_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	91.2	4.8e-121
WP_064441798.1|3627784_3628216_+	hypothetical protein	NA	G8C7S8	Escherichia_phage	65.0	3.5e-45
WP_064441800.1|3628373_3628856_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.4	5.5e-71
WP_064441802.1|3628852_3629518_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	83.3	1.6e-105
WP_064441804.1|3629517_3629742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064441806.1|3629738_3630344_+	hypothetical protein	NA	R9VWB9	Serratia_phage	46.8	1.8e-47
WP_064441808.1|3630343_3630565_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	48.4	2.7e-09
WP_064441812.1|3631249_3632413_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	68.3	2.5e-154
WP_000893225.1|3632618_3633869_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3632428:3632473	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3633880_3634984_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3635266_3636319_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 1
NZ_CP050763	Salmonella enterica subsp. enterica serovar Indiana strain SI115 plasmid pSI115-1, complete sequence	190597	90106	148790	190597	protease,transposase,integrase	Escherichia_phage(29.41%)	59	84753:84766	93591:93604
84753:84766	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_000795947.1|90106_91282_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|91452_91665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|92025_93108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|93274_94774_-	kinase	NA	NA	NA	NA	NA
93591:93604	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_000081622.1|94799_96437_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|96436_97477_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|97562_98201_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|98200_98842_-	TerD family protein	NA	NA	NA	NA	NA
WP_001388628.1|98864_99503_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|99965_100433_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|100450_101659_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|101669_102626_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_042634304.1|102625_103705_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|103706_104480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|104472_105615_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|105624_106683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|107006_107588_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|107587_108745_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|108767_109223_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_062914744.1|109245_110286_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|110334_110913_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|110980_111556_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|111984_113226_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|113788_114070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|114119_114311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151575.1|114402_114744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|115116_115509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|116112_116406_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|116410_117736_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_062914745.1|117796_118003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|118104_118515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053276223.1|118527_119343_+	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
WP_001043843.1|119596_120022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224687.1|120570_120879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|120894_121752_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_063120614.1|123725_124859_-	permease	NA	NA	NA	NA	NA
WP_001175593.1|124964_125288_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000059893.1|126527_126932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282381.1|126994_127444_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001235773.1|127455_129780_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.2	6.0e-38
WP_001243650.1|129799_130045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000689410.1|130459_130930_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	2.8e-19
WP_000480968.1|131057_131894_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|131893_132697_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|132757_133573_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_167802279.1|133760_134531_-	replication protein C	NA	NA	NA	NA	NA
WP_001067858.1|134507_135212_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032193599.1|135241_135946_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_000105383.1|136613_138050_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001067855.1|138316_139021_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|139142_140048_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|140044_141283_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|141282_141867_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|142359_143124_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|143350_143656_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|143666_144872_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_001791010.1|146057_146174_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691727.1|146189_148109_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	100.0	0.0e+00
WP_104976713.1|148184_148790_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	7.0e-116
