The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050757	Salmonella enterica subsp. enterica serovar Indiana strain SI173 chromosome, complete genome	4721555	667312	703953	4721555	tRNA,terminase,integrase,portal,capsid,head,holin,tail	Cronobacter_phage(70.27%)	45	660444:660465	706262:706283
660444:660465	attL	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
WP_001748617.1|667312_668350_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|668336_669230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|669258_669837_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|669956_670178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|670208_670712_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|670721_670949_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_024139063.1|670938_671364_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|671363_671765_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|671911_672088_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|672078_672675_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|672671_673001_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|672990_673851_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|673847_675869_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748628.1|675988_676195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|676168_676492_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|676488_677550_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|677546_679322_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|679482_680283_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|680344_681367_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|681370_682075_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|682078_682273_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_000447490.1|682333_682822_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000084220.1|682818_683325_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|683321_684029_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|684025_685153_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|685149_685605_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|685614_685908_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|685904_686246_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|686245_686578_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_167801667.1|686724_686982_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	1.1e-20
WP_051129153.1|687169_689140_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|689136_689466_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136922.1|689462_690647_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.1	2.0e-178
WP_001001827.1|690639_691227_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	81.5	2.1e-88
WP_167801668.1|691236_693249_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|693251_693782_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|693771_694497_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200791.1|694468_695014_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_054175283.1|695016_696717_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001128281.1|697304_697466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|697888_698395_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|698518_700366_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|700515_702261_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|702496_702712_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023200351.1|702939_703953_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
706262:706283	attR	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
NZ_CP050757	Salmonella enterica subsp. enterica serovar Indiana strain SI173 chromosome, complete genome	4721555	1199826	1281127	4721555	tRNA,terminase,integrase,portal,capsid,head,holin,tail	Cronobacter_phage(51.22%)	82	1207803:1207818	1235493:1235508
WP_000469807.1|1199826_1200594_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1200634_1200982_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1201137_1202358_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1202350_1202869_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1203308_1204379_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1204388_1205510_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1205567_1206476_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1206436_1207597_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1207696_1207744_-	hypothetical protein	NA	NA	NA	NA	NA
1207803:1207818	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1207907_1208900_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1208966_1209266_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1209374_1209713_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1209738_1210071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1210080_1210650_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1210652_1210871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1210909_1213567_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_000088096.1|1213594_1213918_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_054175273.1|1213917_1214937_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1214933_1216718_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|1216928_1217765_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1217799_1218828_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1218839_1219538_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_031602415.1|1219597_1220089_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080871.1|1220085_1220568_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1220564_1221269_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1221265_1222393_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1222389_1222845_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1222857_1223154_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1223150_1223492_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1223491_1223824_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1223970_1224228_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1224415_1226383_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1226379_1226709_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_167801669.1|1226705_1227890_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.1	3.3e-178
WP_001001827.1|1227882_1228470_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	81.5	2.1e-88
WP_167801668.1|1228479_1230492_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1230494_1231025_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|1231014_1231740_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200791.1|1231711_1232257_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_054175283.1|1232259_1233960_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001748131.1|1234993_1235380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1235537_1235876_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1235493:1235508	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1236147_1236885_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1237016_1237997_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1237993_1238725_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1238854_1241428_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1247376_1247832_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1247935_1249237_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1249233_1249557_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1249601_1250957_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1251071_1253732_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1253785_1254466_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1254538_1254958_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1255161_1256199_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1256314_1257004_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1257322_1257706_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1257767_1258355_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1258457_1259357_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1259374_1260709_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1260838_1261576_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1261560_1263183_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1263446_1263611_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1263607_1264183_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1264214_1264865_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1264864_1265821_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1265817_1266297_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1266548_1268348_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1268364_1269339_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1269612_1270293_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1270289_1271195_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1271206_1271935_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1271946_1272678_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1272677_1273058_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1273169_1273430_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1273467_1274394_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1274509_1275706_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023227281.1|1275727_1276645_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1276682_1277531_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1277646_1278540_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1278550_1279912_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1279915_1280551_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1280575_1281127_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP050757	Salmonella enterica subsp. enterica serovar Indiana strain SI173 chromosome, complete genome	4721555	1492866	1499727	4721555	transposase	Salmonella_virus(42.86%)	7	NA	NA
WP_106417237.1|1492866_1493013_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_109166850.1|1493028_1493172_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
WP_023226601.1|1494161_1496084_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	3.9e-301
WP_000703601.1|1496090_1496357_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
WP_023226602.1|1496325_1496715_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_001067855.1|1496826_1497531_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001590337.1|1498785_1499727_-	transporter protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
>prophage 4
NZ_CP050757	Salmonella enterica subsp. enterica serovar Indiana strain SI173 chromosome, complete genome	4721555	1731295	1740466	4721555	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1731295_1732243_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1732226_1732958_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1732938_1733046_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1733105_1733837_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1734059_1735745_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1735741_1736461_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1736507_1736975_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1737031_1737562_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1737733_1738192_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1738432_1740466_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 5
NZ_CP050757	Salmonella enterica subsp. enterica serovar Indiana strain SI173 chromosome, complete genome	4721555	1819498	1830005	4721555		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1819498_1820902_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1821079_1821973_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1822349_1823435_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1823434_1824334_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1824381_1825260_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1825260_1825812_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1825817_1826792_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1826807_1827581_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1827585_1828665_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1828691_1830005_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP050757	Salmonella enterica subsp. enterica serovar Indiana strain SI173 chromosome, complete genome	4721555	1940115	1951405	4721555	integrase	Burkholderia_phage(25.0%)	12	1934369:1934384	1948716:1948731
1934369:1934384	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|1940115_1941297_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|1941297_1942044_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|1942145_1943402_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|1943882_1944044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1944170_1944590_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|1944592_1945861_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|1946315_1946528_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1946538_1946727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|1946985_1948164_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|1948814_1949126_+	hypothetical protein	NA	NA	NA	NA	NA
1948716:1948731	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|1949205_1949901_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|1949974_1951405_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP050757	Salmonella enterica subsp. enterica serovar Indiana strain SI173 chromosome, complete genome	4721555	2132154	2171310	4721555	transposase,protease,integrase	Shigella_phage(37.5%)	30	2148591:2148607	2163178:2163194
WP_023227614.1|2132154_2132751_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000147031.1|2132747_2133479_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000070982.1|2133497_2135291_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023227615.1|2135287_2136406_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_023227616.1|2136899_2138165_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_089541817.1|2140727_2141955_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000136607.1|2143393_2145904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442952.1|2145907_2148472_+	hypothetical protein	NA	NA	NA	NA	NA
2148591:2148607	attL	TCAAACTGTTTTATTGA	NA	NA	NA	NA
WP_000716184.1|2148778_2149093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232453.1|2149104_2149623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108266.1|2149676_2150204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442951.1|2150216_2150486_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
WP_000093666.1|2150606_2150987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174655.1|2151144_2151687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142750.1|2151709_2152198_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_050516501.1|2152325_2152721_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_019841938.1|2152781_2153141_+	antitoxin	NA	NA	NA	NA	NA
WP_000744655.1|2153250_2153868_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_050516502.1|2153980_2154892_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.0e-10
WP_000870315.1|2155105_2155552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2155816_2156011_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000468111.1|2156012_2156885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|2157094_2158323_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001218334.1|2158579_2162482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087212.1|2162803_2164489_-	hypothetical protein	NA	NA	NA	NA	NA
2163178:2163194	attR	TCAATAAAACAGTTTGA	NA	NA	NA	NA
WP_000151475.1|2164498_2165164_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000699006.1|2165164_2166562_-	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_080229793.1|2168479_2169259_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.1e-137
WP_069067343.1|2169900_2170239_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001443045.1|2170158_2171310_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
>prophage 8
NZ_CP050757	Salmonella enterica subsp. enterica serovar Indiana strain SI173 chromosome, complete genome	4721555	2265642	2271454	4721555		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2265642_2266449_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2266450_2267443_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2267442_2268333_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2268456_2268858_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_051129228.1|2269157_2270045_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2270351_2270621_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2270975_2271116_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2271154_2271454_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 9
NZ_CP050757	Salmonella enterica subsp. enterica serovar Indiana strain SI173 chromosome, complete genome	4721555	2737077	2745876	4721555	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2737077_2737317_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_089541817.1|2738863_2740091_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_001277616.1|2740408_2740786_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2740933_2741476_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2741667_2742396_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2742412_2742826_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2743776_2744901_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2745417_2745876_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
