The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050753	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 chromosome, complete genome	4995493	662269	700212	4995493	head,terminase,holin,tail,integrase,portal,capsid	Cronobacter_phage(72.22%)	44	662420:662435	695270:695285
WP_000478472.1|662269_663835_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
662420:662435	attL	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000983441.1|663831_664479_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213760.1|664710_665478_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|665735_667517_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|667506_668544_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568372.1|668547_669114_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_000514631.1|669130_669712_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|669855_670077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|670107_670611_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|670620_670848_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|670837_671263_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|671262_671664_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|671731_671965_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|671955_672816_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|672812_674834_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000353141.1|674953_675160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|675133_675457_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|675453_676515_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|676511_678287_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|678447_679251_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|679312_680335_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|680338_681040_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000447487.1|681100_681589_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_000084218.1|681585_682092_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|682088_682796_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|682792_683920_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|683916_684372_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|684381_684675_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|684671_685013_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|685012_685345_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_001670161.1|685316_685505_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000411339.1|685491_685749_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|685936_687907_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|687903_688233_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|688229_689414_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|689406_689994_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|690003_692238_+|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|692250_692805_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|692794_693520_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|693491_694037_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_001680744.1|694039_695740_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
695270:695285	attR	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000340945.1|697108_697411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|697734_698241_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|698364_700212_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 2
NZ_CP050753	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 chromosome, complete genome	4995493	1159852	1187941	4995493	transposase	Escherichia_phage(36.36%)	30	NA	NA
WP_001067855.1|1159852_1160557_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000173534.1|1161533_1162049_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	7.1e-08
WP_005046389.1|1162054_1162978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250919.1|1163033_1163813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000429174.1|1164160_1164460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|1165450_1166659_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|1167024_1168230_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|1168673_1168994_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|1168986_1169373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447544.1|1169380_1170067_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|1170044_1170668_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|1170749_1171955_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000429836.1|1173238_1173673_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|1173744_1174095_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732293.1|1174108_1174384_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|1174419_1174842_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|1174893_1176588_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|1176605_1176968_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|1176964_1177201_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|1177236_1177905_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|1179294_1179999_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|1180754_1181606_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|1181913_1182729_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|1182789_1183593_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1183592_1184429_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|1184489_1185194_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|1185240_1185642_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|1185791_1186652_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001403349.1|1186834_1187260_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.7e-53
WP_001067855.1|1187236_1187941_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_CP050753	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 chromosome, complete genome	4995493	1279662	1355054	4995493	head,transposase,terminase,holin,tRNA,lysis,tail,protease,integrase,portal,capsid	Salmonella_phage(43.1%)	87	1271743:1271759	1360901:1360917
1271743:1271759	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1279662_1280700_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1280815_1281505_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1281823_1282207_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1282268_1282856_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1282958_1283858_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1283875_1285210_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1285340_1286078_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1286062_1287685_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1287948_1288113_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1288109_1288685_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1288716_1289367_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1289366_1290323_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1290319_1290799_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1291296_1292526_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1292503_1292788_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1292828_1293068_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1293110_1294268_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1294230_1297158_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1297284_1297635_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1297656_1297815_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|1298213_1298618_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1298747_1298984_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1298949_1299324_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1299408_1300392_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1300394_1301144_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1301154_1301502_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1301498_1302023_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1302022_1302496_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_001217666.1|1303360_1303600_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_001804676.1|1303655_1303895_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	5.9e-42
WP_000929803.1|1303934_1304537_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1304745_1305357_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1305353_1305494_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1305490_1306168_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1306440_1307004_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1307510_1307699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1307913_1308600_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1308875_1309205_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|1309188_1309641_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|1309658_1310111_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1310346_1310748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1311034_1311580_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1311551_1313483_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1313466_1313670_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1313666_1315247_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1315236_1316733_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1316745_1317093_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1317147_1318176_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1318233_1318593_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1318603_1318987_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1319014_1319593_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1319641_1320772_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1320880_1321282_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_077248250.1|1321289_1322036_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|1322086_1322482_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1322478_1322817_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1322788_1325884_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1325886_1326216_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1326225_1326924_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1326930_1327668_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1327565_1328213_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1328274_1331637_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1331675_1331918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1331971_1334344_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1334340_1335165_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1335154_1335733_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1335829_1336057_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1336163_1336376_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1337128_1337248_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1337960_1338098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1338576_1340070_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1340474_1342274_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1342290_1343265_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1343538_1344219_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1344215_1345121_+	GTPase Era	NA	NA	NA	NA	NA
WP_033567169.1|1345132_1345861_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1345872_1346604_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1346603_1346984_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1347095_1347356_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1347393_1348320_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1348435_1349632_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684027.1|1349653_1350571_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1350609_1351458_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1351573_1352467_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1352477_1353839_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1353842_1354478_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1354502_1355054_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1360901:1360917	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 4
NZ_CP050753	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 chromosome, complete genome	4995493	1709014	1738607	4995493	holin,tail,protease	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1709014_1709509_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1709922_1710414_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1710403_1710667_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1710663_1713150_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1713156_1713852_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1713838_1714708_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1714823_1715273_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1715282_1715885_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1715905_1716523_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1716519_1717179_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1717230_1717968_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1717964_1718177_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1718173_1718653_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1718649_1720581_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1720577_1721135_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_033572444.1|1721131_1722175_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1722218_1722866_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1723595_1724159_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1724350_1724554_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1724856_1725648_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1725944_1726148_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1726316_1728683_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1729011_1730001_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1730015_1730384_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1730412_1731744_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1732040_1732370_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1732962_1734204_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1734206_1734734_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1735111_1735555_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1735608_1737438_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1737785_1738076_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1738103_1738607_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 5
NZ_CP050753	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 chromosome, complete genome	4995493	1810659	1819830	4995493	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1810659_1811607_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1811590_1812322_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1812302_1812410_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1812469_1813201_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1813423_1815109_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1815105_1815825_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1815871_1816339_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1816395_1816926_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1817097_1817556_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1817796_1819830_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP050753	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 chromosome, complete genome	4995493	1888138	1898644	4995493		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1888138_1889542_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1889719_1890613_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1890989_1892075_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1892074_1892974_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1893021_1893900_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1893900_1894452_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1894457_1895450_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1895446_1896220_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1896224_1897304_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1897330_1898644_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
NZ_CP050753	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 chromosome, complete genome	4995493	1984638	2035325	4995493	head,terminase,holin,tail,protease,plate,integrase,portal,capsid	Salmonella_phage(81.54%)	70	1979216:1979230	1995346:1995360
1979216:1979230	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1984638_1985112_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_000598920.1|1986421_1987219_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1987510_1988500_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|1988501_1988729_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061334.1|1988768_1989338_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|1989341_1989923_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|1989933_1990191_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|1990192_1990726_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|1990796_1991336_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|1991472_1992300_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_167803842.1|1992357_1992729_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	99.2	7.2e-63
WP_023891434.1|1993268_1993493_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|1993455_1993794_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|1993999_1994695_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1994792_1995017_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1995045_1995600_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1995346:1995360	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087404.1|1995596_1996739_+	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|1996735_1996960_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_033567233.1|1996956_1997931_+	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000054228.1|1997927_1998401_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567232.1|1998397_1999273_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000779148.1|1999281_1999671_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061452.1|1999687_2000548_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_070793644.1|2000555_2001545_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_020899401.1|2001558_2002311_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|2002461_2002719_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|2002864_2003251_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|2003237_2003519_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|2003518_2004133_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|2004129_2004522_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001005132.1|2004762_2005317_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	4.5e-101
WP_001135098.1|2005367_2005718_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|2005843_2006338_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_033567282.1|2006334_2008068_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000605609.1|2008079_2008262_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466255.1|2008261_2009503_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_033567207.1|2009480_2010131_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_033572441.1|2010145_2011351_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033572442.1|2011400_2011601_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_000927721.1|2011603_2011927_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033567256.1|2011923_2012328_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_033567257.1|2012299_2012812_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_000779213.1|2012808_2013366_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_065305283.1|2013387_2013552_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_033567258.1|2013541_2015038_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515953.1|2015037_2015394_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|2015390_2015717_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|2015801_2017727_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|2017743_2018193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033567259.1|2018252_2019593_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001066632.1|2019589_2020648_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|2020647_2021181_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|2021185_2021599_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|2021591_2022671_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|2022673_2023261_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|2023247_2024810_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_022742744.1|2024779_2025385_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|2025498_2025732_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|2025806_2025920_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|2025967_2026381_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|2026377_2026590_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|2027783_2027945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|2028071_2028491_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2028493_2029762_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2030216_2030429_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2030439_2030628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2030888_2032085_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2032734_2033034_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2033125_2033821_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2033894_2035325_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP050753	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 chromosome, complete genome	4995493	2139369	2146178	4995493	tail,integrase	Salmonella_phage(33.33%)	11	2141579:2141601	2151294:2151316
WP_000856224.1|2139369_2139600_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2139737_2140112_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2140112_2140988_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2141004_2141358_+	YebY family protein	NA	NA	NA	NA	NA
2141579:2141601	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2141731_2142586_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2142645_2143140_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2143329_2143560_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2143613_2144147_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2144403_2144571_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2144635_2144824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2145296_2146178_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2151294:2151316	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 9
NZ_CP050753	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 chromosome, complete genome	4995493	2933077	3023994	4995493	terminase,holin,tRNA,lysis,tail,protease,integrase	Salmonella_phage(58.7%)	91	2957171:2957190	3021067:3021086
WP_000938191.1|2933077_2933758_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2934378_2935038_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2935124_2935454_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2935450_2935732_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2935780_2936560_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2936585_2937134_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2937348_2938560_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2938617_2938935_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2938979_2939393_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2939566_2940229_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2940323_2940782_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2940817_2942872_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2942995_2943442_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2943460_2945614_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2945600_2946206_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2946422_2946932_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2947288_2948341_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2948412_2948865_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2949050_2950811_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2950879_2951398_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2951497_2951665_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_033567177.1|2951920_2952484_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2952480_2954121_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2954125_2955379_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2955393_2957301_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2957171:2957190	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2957313_2959422_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_167803837.1|2959520_2960630_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2960626_2961169_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2961334_2962345_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2962552_2965165_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2965591_2965783_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2966053_2966740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|2966724_2967024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2967092_2967719_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2968366_2969335_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|2969810_2970392_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|2970391_2972830_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|2972883_2973126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541993.1|2973164_2974040_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001576012.1|2976586_2977291_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|2977188_2977926_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2977935_2978631_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2978720_2979254_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2979370_2979868_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|2979967_2980300_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|2981420_2981966_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|2982434_2982881_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000984584.1|2982898_2983351_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|2983334_2983664_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_001141973.1|2983939_2984626_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2984986_2985436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2985571_2985697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097242.1|2985891_2986581_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_000801757.1|2986577_2986718_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|2986714_2987326_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|2987534_2988137_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|2988221_2988443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|2988552_2988786_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|2989377_2989974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|2989985_2990963_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|2991017_2991275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|2991274_2991919_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|2991922_2992231_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|2992234_2992693_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_020899441.1|2992689_2993037_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000800012.1|2993047_2993797_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062943.1|2993799_2994783_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|2994867_2995188_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|2995222_2995450_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|2995555_2995990_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|2996286_2996418_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|2996466_2996817_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_136614733.1|2996943_3000144_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	78.6	0.0e+00
WP_014344386.1|3000106_3001264_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|3001306_3001546_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3001586_3001835_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|3001879_3003172_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000191399.1|3003366_3004569_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|3004646_3006083_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|3006327_3007542_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3007858_3008320_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3008520_3009921_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|3010527_3011619_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|3011803_3012994_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|3013055_3013703_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|3013730_3014279_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|3014538_3016380_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|3016724_3021191_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
3021067:3021086	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|3021190_3021895_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3021875_3023198_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|3023190_3023994_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP050753	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 chromosome, complete genome	4995493	3074018	3082750	4995493	protease,transposase	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3074018_3075273_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3075736_3076195_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3076386_3078663_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3078693_3079014_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3079337_3079559_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3079688_3081635_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3081631_3082750_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 11
NZ_CP050753	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 chromosome, complete genome	4995493	3692135	3737710	4995493	coat,terminase,lysis,protease,integrase,portal	Salmonella_phage(56.92%)	66	3683541:3683557	3746924:3746940
3683541:3683557	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_000915528.1|3692135_3692498_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3692494_3693427_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3693416_3694874_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129928.1|3694932_3696936_-	endorhamnosidase	NA	E7C9U9	Salmonella_phage	100.0	0.0e+00
WP_000532175.1|3697071_3697323_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
WP_001085430.1|3697422_3697602_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000757527.1|3697615_3697981_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_000889769.1|3698011_3698341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262317.1|3698358_3700272_-	hypothetical protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
WP_033572424.1|3700271_3701555_-	phage DNA ejection protein	NA	E7C9U5	Salmonella_phage	94.7	4.5e-221
WP_000964900.1|3701565_3702255_-	hypothetical protein	NA	E7C9U4	Salmonella_phage	100.0	4.3e-109
WP_000627695.1|3702257_3702713_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
WP_022631116.1|3702712_3703414_-	hypothetical protein	NA	B8K1I3	Salmonella_phage	98.7	1.8e-70
WP_033572423.1|3703417_3704836_-	Packaged DNA stabilization protein gp10	NA	A0A220NQZ5	Salmonella_phage	99.6	5.4e-276
WP_001166093.1|3704795_3705296_-	packaged DNA stabilization protein p27	NA	E7C9U0	Salmonella_phage	100.0	2.5e-90
WP_000538674.1|3705279_3705840_-	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_022630931.1|3705880_3707173_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.5	1.2e-242
WP_006831698.1|3707172_3708084_-	scaffolding protein	NA	Q5C834	Enterobacteria_phage	100.0	1.7e-161
WP_000774652.1|3708097_3710275_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000417860.1|3710274_3711774_-|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000729923.1|3711751_3712240_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3712243_3712648_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3712647_3713037_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3713040_3713283_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_015995148.1|3713505_3714036_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	100.0	1.3e-94
WP_001687043.1|3714248_3714716_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3714712_3715210_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3715187_3715391_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_033572422.1|3715927_3716701_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	96.5	1.2e-128
WP_023217800.1|3716858_3717101_-	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	92.5	1.3e-36
WP_033572421.1|3717097_3717280_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	95.0	3.6e-23
WP_023250727.1|3717267_3717738_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	99.4	8.8e-90
WP_023250726.1|3717718_3717955_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	97.4	3.9e-38
WP_033572420.1|3717947_3718124_-	protein ninF	NA	A0A192Y808	Salmonella_phage	91.4	6.9e-24
WP_033572419.1|3718116_3718518_-	hypothetical protein	NA	G9L690	Escherichia_phage	85.7	2.7e-63
WP_000113767.1|3718520_3718697_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	98.3	7.9e-28
WP_000679699.1|3718663_3718837_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
WP_001573980.1|3718833_3719706_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
WP_000736920.1|3719702_3720143_-	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	2.9e-79
WP_001248409.1|3720216_3721593_-	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
WP_000067076.1|3721589_3722423_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	99.6	2.4e-151
WP_001125981.1|3722415_3722562_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3722596_3722878_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000067726.1|3722988_3723204_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_023135942.1|3723322_3723985_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	100.0	1.7e-126
WP_033572418.1|3724336_3724639_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	97.0	6.3e-49
WP_033572417.1|3724651_3725239_-	superinfection exclusion protein B	NA	A0A0M4R594	Salmonella_phage	99.0	6.2e-85
WP_033572416.1|3725431_3725932_+	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.5	1.2e-31
WP_033572415.1|3725965_3726253_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	97.9	1.1e-47
WP_000141641.1|3726587_3726746_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|3726726_3726915_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902090.1|3726904_3727048_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	97.9	9.3e-19
WP_033572414.1|3727044_3727752_+	recombinase	NA	A0A1R3Y600	Salmonella_virus	98.7	2.9e-137
WP_001253476.1|3727751_3728036_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111312.1|3728082_3728376_+	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_001214769.1|3728386_3728557_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	94.6	5.7e-23
WP_050517928.1|3728553_3729078_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	96.9	4.2e-48
WP_033572413.1|3729074_3729980_+	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	95.4	5.3e-51
WP_033572412.1|3729981_3730200_+	DUF4014 family protein	NA	C6ZR28	Salmonella_phage	98.6	3.7e-35
WP_033572411.1|3730203_3730875_+	DUF550 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	64.6	5.6e-90
WP_001277764.1|3731501_3731681_+	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	100.0	1.9e-29
WP_033572425.1|3731781_3732411_+	DUF5420 family protein	NA	A0A220NQT7	Salmonella_phage	96.7	7.3e-116
WP_033572410.1|3732640_3733804_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	99.5	5.3e-229
WP_000893231.1|3734009_3735260_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3735271_3736375_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3736657_3737710_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3746924:3746940	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 12
NZ_CP050753	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 chromosome, complete genome	4995493	4575751	4622795	4995493	tail,tRNA,plate	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4575751_4576750_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4576837_4578148_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4578394_4578910_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4579008_4579218_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4579239_4579353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4579349_4580675_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4580853_4581462_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4581570_4581939_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4582109_4584530_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4584628_4585501_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4585514_4586012_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4586192_4587110_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4587273_4588632_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4588720_4589830_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4590191_4591382_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4591513_4593058_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4593072_4593963_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4594128_4594539_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4594681_4596778_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4596777_4597515_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_125572646.1|4597511_4598180_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4598213_4598456_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4598899_4600549_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4600893_4602243_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4602375_4602723_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4603298_4603586_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4603588_4604194_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4604206_4604521_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4604680_4605136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4605132_4605330_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4605319_4606747_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4606746_4607271_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4607322_4607640_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4607599_4607728_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4607824_4610179_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4610178_4611132_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4611131_4611341_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4611328_4612372_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4612381_4613104_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4613431_4613794_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4613790_4614720_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4614719_4616267_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4616430_4616790_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4616780_4617896_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4617888_4618521_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4618523_4620269_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4620273_4620879_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4620875_4621331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4621579_4621870_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4622066_4622795_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP050754	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 plasmid pST45-1, complete sequence	260432	70596	120644	260432	protease,transposase	Escherichia_phage(26.32%)	56	NA	NA
WP_042634304.1|70596_71676_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|71677_72451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|72443_73586_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|73595_74654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|74977_75559_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|75558_76716_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|76738_77194_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|77216_78257_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|78305_78884_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|78951_79527_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|79955_81197_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|81759_82041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|82090_82282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151575.1|82373_82715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|83087_83480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|84083_84377_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|84381_85707_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|85767_85974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|86075_86486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|86498_87314_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_001043843.1|87567_87993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572440.1|88737_89037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192809.1|89349_91389_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	2.5e-24
WP_001572342.1|91385_92372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194555.1|93402_93606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287392.1|93947_94352_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000175476.1|94849_95086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|95127_95583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|95642_96308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|96365_96746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|97388_98207_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|98203_99409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|99688_101008_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000220758.1|101030_101198_-	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000833382.1|101258_102686_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|102900_103416_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_015059496.1|104536_104770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|105431_105662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|105998_106460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|106489_106897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|106947_107265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|107641_107992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012783960.1|108101_109691_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
WP_001067855.1|109681_110386_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|110503_110707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|110834_111674_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|111667_112015_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|112237_112690_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|112774_113407_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|113544_114375_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|114505_115060_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|115203_115908_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_167803844.1|115966_116491_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	3.8e-49
WP_015344976.1|116493_119445_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|119453_119855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|119939_120644_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
>prophage 2
NZ_CP050754	Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 plasmid pST45-1, complete sequence	260432	127290	163385	260432	transposase,integrase	Escherichia_phage(50.0%)	34	134128:134187	148544:149364
WP_085940648.1|127290_128380_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_165488106.1|128577_128949_-	phenol hydroxylase	NA	NA	NA	NA	NA
WP_000602738.1|130873_131626_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|132047_133073_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|133301_134078_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
134128:134187	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|134191_134896_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000454193.1|135122_135473_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_167803845.1|135675_136689_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.8	2.1e-72
WP_001456218.1|136855_137698_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000050382.1|137793_138402_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|138459_139251_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|139512_140772_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|140864_141656_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|141825_142158_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_109023896.1|143059_143335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|143337_144129_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|144597_144843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|144880_145744_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_088238917.1|145974_146679_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018329.1|146829_147645_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|147834_148539_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001083725.1|148943_149441_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
148544:149364	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTTGACATAAGCCTGTTCGGTTCGTAAACTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGCCATATGAACTCGGAATCAGTACGCATTTATCTCGTTGCTGCGATGGGAGCCAATCGGGTTATTGGCAATGGTCCTAATATCCCCTGGAAAATTCCGGGTGAGCAGAAGATTTTTCGCAGACTCACTGAGGGAAAAGTCGTTGTCATGGGGCGAAAGACCTTTGAGTCTATCGGCAAGCCTCTACCGAACCGTCACACATTGGTAATCTCACGCCAAGCTAACTACCGCGCCACTGGCTGCGTAGTTGTTTCAACGCTGTCGCACGCTATCGCTTTGGCATCCGAACTCGGCAATGAACTCTACGTCGCGGGCGGAGCTGAGATATACACTCTGGCACTACCTCACGCCCACGGCGTGTTTCTATCTGAGGTACATCAAACCTTCGAGGGTGACGCCTTCTTCCCAATGCTCAACGAAACAGAAT	NA	NA	NA	NA
WP_071523897.1|149597_149843_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|150489_151194_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|151418_151622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|151749_152589_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_072644484.1|152769_152934_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_063102497.1|155221_155608_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_057109146.1|155927_156320_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_001067858.1|156654_157359_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_002914189.1|157678_158854_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_000347934.1|158877_162030_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_000888203.1|162099_162579_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|162680_163385_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
