The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050756	Salmonella enterica subsp. enterica serovar Indiana strain SI174 chromosome, complete genome	4929169	647211	712452	4929169	terminase,head,capsid,portal,holin,transposase,integrase,tail	Cronobacter_phage(54.17%)	75	688033:688092	706923:707743
WP_001748617.1|647211_648249_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|648235_649129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|649157_649736_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|649855_650077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|650107_650611_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|650620_650848_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_024139063.1|650837_651263_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|651262_651664_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|651810_651987_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|651977_652574_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|652570_652900_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|652889_653750_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|653746_655768_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748628.1|655887_656094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|656067_656391_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|656387_657449_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|657445_659221_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|659381_660182_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|660243_661266_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|661269_661974_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|661977_662172_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_000447490.1|662232_662721_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000084220.1|662717_663224_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|663220_663928_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|663924_665052_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|665048_665504_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|665513_665807_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|665803_666145_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|666144_666477_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|666623_666881_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_051129153.1|667068_669039_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|669035_669365_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|669361_670546_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|670538_671126_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|671135_673148_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|673150_673681_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|673670_674396_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200791.1|674367_674913_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_054175283.1|674915_676616_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001128281.1|677203_677365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290290.1|677829_679146_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	3.5e-35
WP_000268404.1|679275_679872_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	9.4e-97
WP_000256688.1|679954_681559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265818.1|682338_682566_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001428286.1|683655_684156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000628304.1|684537_685152_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000654812.1|685534_686503_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
WP_096249840.1|686548_686812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001354443.1|687018_688005_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.9	1.4e-166
688033:688092	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|688084_688789_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|688902_689679_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|689907_690933_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|691354_692107_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_165488106.1|694031_694403_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_085940648.1|694599_695690_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|695779_696595_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|696681_696984_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|696877_697129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|698053_698758_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|698842_699244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138064.1|699252_702219_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|702221_702782_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|702907_703258_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|703460_704474_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|704631_705105_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
WP_000503573.1|705235_706024_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001067855.1|706225_706930_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|707047_707251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|707378_708218_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
706923:707743	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCATGTGTACTACGCAGTTTTAGCTGTGGCTTTCACAGGAGCACGCTTACTTACGGCTTAGCGTGCTTTATTTTCCGTTTTCTGAGGCGATCCCTAGGAGCTCGGATCTCAGGACGAAGGTCTCCGCGAATGTCCGGTCGATCCGCGCGACGTCCCAGGCGGGCGTTCCCTTGGCGGACATCCACGCCGCAGCGTCGTGCATCAGCCGCACAACCTCGTCGATATCACCCGAGCAGGCGACCCGAACGTTCGGAGGCTCCTCGCTGTCCATTCGCTCCCCTGGCGCGGTATGAACCGCCGCCTCATAGTGCAGTTTGATCCTGACGAGCCCAGCATGTCTGCGCCCACCTTCGCGGAACCTGACCAGGGTCCGCTAGCGGGCGGCCGGAAGGTGAATGCTAGGCATGATCTAACCCTCGGTCTCTGGCGTCGCGACTGCGAAATTTCGCGAGGGTTTCCGAGAAGGTGATTGCGCTTCGCAGATCTCCAGGCGCGTGGGTGCGGACGTAGTCAGCGCCATTGCCGATCGCGTGAAGTTCCGCCGCAAGGCTCGCTGGACCCAGATCCTTTACAGGAAGGCCAACGGTGGCGCCCAAGAAGGATTTCCGCGACACCGAGACCAATAGCGGAAGCCCCAACGCCGACTTCAGCTTTTGAAGGTTCGACAGCACGTGCAGCGATGTTTCCGGTGCGGGGCTCAAGAAAAATCCCATCCCCGGATCGAGGATGAGCCGGTCGGCAGCGACCCCGCTCCGTCGCAAGG	NA	NA	NA	NA
WP_000679427.1|708211_708559_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|708781_709234_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|709318_709951_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|710088_710919_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|711049_711604_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|711747_712452_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP050756	Salmonella enterica subsp. enterica serovar Indiana strain SI174 chromosome, complete genome	4929169	835760	897977	4929169	integrase,transposase	Salmonella_phage(16.67%)	53	832890:832909	898153:898172
832890:832909	attL	GTGGTGCCCGGACTCGGAAT	NA	NA	NA	NA
WP_000608644.1|835760_837023_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_015387340.1|837275_838151_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_032153712.1|838736_839111_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692345.1|839190_839412_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186715.1|839480_839957_-	RadC family protein	NA	NA	NA	NA	NA
WP_032153711.1|839972_840458_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	9.0e-13
WP_001234693.1|840549_841368_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	1.6e-46
WP_023155727.1|841458_841668_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_023155728.1|841697_842375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024166630.1|842493_843378_-	GTPase	NA	NA	NA	NA	NA
WP_023155730.1|843484_844417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032153709.1|844413_845223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032153707.1|846973_847705_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001067608.1|848889_850494_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_032153705.1|852090_852657_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001421645.1|852776_852926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032153703.1|852940_853513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958154.1|853581_853818_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032153702.1|854086_854635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001349534.1|854653_854902_-	osmoprotectant transport activator ProQ	NA	Q2A0A1	Sodalis_phage	39.1	8.3e-07
WP_001323513.1|854970_855162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131501864.1|856754_856868_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	71.4	3.4e-08
WP_001043260.1|858525_859341_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|859401_860205_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|860204_861041_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|861346_861589_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001493764.1|861620_862271_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032153701.1|862376_863576_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|863842_864148_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023300759.1|864175_865390_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_021598067.1|865606_866491_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_021512463.1|867111_867378_-	P fimbrial regulatory protein KS71A	NA	NA	NA	NA	NA
WP_000930062.1|867812_868127_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_000271619.1|869047_870280_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_000174035.1|871759_872740_+	thymidylate synthase	NA	A0A218MLB7	uncultured_virus	34.2	7.3e-22
WP_000820616.1|872736_873681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000637419.1|873683_874766_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	38.6	5.5e-10
WP_032153698.1|875232_875499_+	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	71.6	1.0e-26
WP_000438165.1|876920_880334_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.2	8.5e-17
WP_000627728.1|880397_882032_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.9	2.6e-32
WP_000742120.1|882028_883171_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_167803802.1|883179_884802_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000499115.1|884801_885698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001398114.1|886328_887066_+	porin family protein	NA	NA	NA	NA	NA
WP_000228490.1|887485_888382_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	27.3	2.1e-31
WP_001207396.1|888430_889510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541817.1|890483_891711_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000766274.1|892460_892727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001238004.1|892866_893064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025492097.1|893116_894790_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_032153697.1|894933_895968_-	tetratricopeptide repeat family protein	NA	NA	NA	NA	NA
WP_023181049.1|896017_896293_+|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.8e-45
WP_001218742.1|896792_897977_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	1.7e-121
898153:898172	attR	GTGGTGCCCGGACTCGGAAT	NA	NA	NA	NA
>prophage 3
NZ_CP050756	Salmonella enterica subsp. enterica serovar Indiana strain SI174 chromosome, complete genome	4929169	1297896	1380534	4929169	tRNA,terminase,head,capsid,portal,holin,transposase,integrase,tail	Cronobacter_phage(48.78%)	82	1305873:1305888	1334899:1334914
WP_000469807.1|1297896_1298664_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1298704_1299052_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1299207_1300428_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1300420_1300939_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1301378_1302449_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1302458_1303580_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1303637_1304546_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1304506_1305667_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1305766_1305814_-	hypothetical protein	NA	NA	NA	NA	NA
1305873:1305888	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1305977_1306970_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1307036_1307336_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1307444_1307783_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_089541817.1|1307947_1309175_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_149442398.1|1309150_1309477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1309486_1310056_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1310058_1310277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1310315_1312973_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_000088096.1|1313000_1313324_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_054175273.1|1313323_1314343_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_023375469.1|1316334_1317171_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1317205_1318234_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1318245_1318944_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_031602415.1|1319003_1319495_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080871.1|1319491_1319974_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1319970_1320675_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1320671_1321799_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1321795_1322251_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1322263_1322560_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1322556_1322898_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1322897_1323230_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1323376_1323634_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1323821_1325789_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1325785_1326115_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1326111_1327296_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1327288_1327876_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1327885_1329898_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1329900_1330431_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|1330420_1331146_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200791.1|1331117_1331663_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_054175283.1|1331665_1333366_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001748131.1|1334399_1334786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1334943_1335282_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1334899:1334914	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1335553_1336291_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1336422_1337403_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1337399_1338131_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1338260_1340834_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1346783_1347239_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1347342_1348644_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1348640_1348964_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1349008_1350364_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1350478_1353139_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1353192_1353873_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1353945_1354365_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1354568_1355606_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1355721_1356411_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1356729_1357113_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1357174_1357762_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1357864_1358764_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1358781_1360116_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1360245_1360983_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1360967_1362590_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1362853_1363018_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1363014_1363590_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1363621_1364272_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1364271_1365228_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1365224_1365704_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1365955_1367755_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1367771_1368746_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1369019_1369700_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1369696_1370602_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1370613_1371342_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1371353_1372085_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1372084_1372465_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1372576_1372837_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1372874_1373801_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1373916_1375113_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023227281.1|1375134_1376052_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1376089_1376938_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1377053_1377947_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1377957_1379319_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1379322_1379958_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1379982_1380534_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP050756	Salmonella enterica subsp. enterica serovar Indiana strain SI174 chromosome, complete genome	4929169	1592273	1599134	4929169	transposase	Salmonella_virus(42.86%)	7	NA	NA
WP_106417237.1|1592273_1592420_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_109166850.1|1592435_1592579_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
WP_023226601.1|1593568_1595491_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	3.9e-301
WP_000703601.1|1595497_1595764_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
WP_023226602.1|1595732_1596122_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_001067855.1|1596233_1596938_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001590337.1|1598192_1599134_-	transporter protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
>prophage 5
NZ_CP050756	Salmonella enterica subsp. enterica serovar Indiana strain SI174 chromosome, complete genome	4929169	1832021	1841192	4929169	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1832021_1832969_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1832952_1833684_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1833664_1833772_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1833831_1834563_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1834785_1836471_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1836467_1837187_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1837233_1837701_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1837757_1838288_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1838459_1838918_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1839158_1841192_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 6
NZ_CP050756	Salmonella enterica subsp. enterica serovar Indiana strain SI174 chromosome, complete genome	4929169	1920208	1930715	4929169		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1920208_1921612_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1921789_1922683_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1923059_1924145_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1924144_1925044_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1925091_1925970_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1925970_1926522_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1926527_1927502_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1927517_1928291_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1928295_1929375_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1929401_1930715_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
NZ_CP050756	Salmonella enterica subsp. enterica serovar Indiana strain SI174 chromosome, complete genome	4929169	2040837	2052127	4929169	integrase	Burkholderia_phage(25.0%)	12	2035091:2035106	2049438:2049453
2035091:2035106	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|2040837_2042019_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|2042019_2042766_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|2042867_2044124_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|2044604_2044766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|2044892_2045312_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|2045314_2046583_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|2047037_2047250_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2047260_2047449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|2047707_2048886_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|2049536_2049848_+	hypothetical protein	NA	NA	NA	NA	NA
2049438:2049453	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|2049927_2050623_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|2050696_2052127_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP050756	Salmonella enterica subsp. enterica serovar Indiana strain SI174 chromosome, complete genome	4929169	2232876	2274185	4929169	integrase,protease,transposase	Shigella_phage(25.0%)	31	2240660:2240673	2275085:2275098
WP_023227614.1|2232876_2233473_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000147031.1|2233469_2234201_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000070982.1|2234219_2236013_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023227615.1|2236009_2237128_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_023227616.1|2237621_2238887_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
2240660:2240673	attL	CTGGCGCTGGCTGA	NA	NA	NA	NA
WP_089541817.1|2241449_2242677_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000136607.1|2244115_2246626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442952.1|2246629_2249194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000716184.1|2249500_2249815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232453.1|2249826_2250345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108266.1|2250398_2250926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442951.1|2250938_2251208_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
WP_000093666.1|2251328_2251709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174655.1|2251866_2252409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142750.1|2252431_2252920_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_050516501.1|2253047_2253443_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_019841938.1|2253503_2253863_+	antitoxin	NA	NA	NA	NA	NA
WP_000744655.1|2253972_2254590_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_050516502.1|2254702_2255614_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.0e-10
WP_000870315.1|2255827_2256274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2256538_2256733_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000468111.1|2256734_2257607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167803806.1|2259298_2260522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167803807.1|2260542_2263200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087212.1|2263521_2265207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000151475.1|2265216_2265882_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000699006.1|2265882_2267280_-	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_080229793.1|2269197_2269977_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.1e-137
WP_069067343.1|2270618_2270957_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001443045.1|2270876_2272028_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
WP_019841501.1|2272985_2274185_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	39.6	4.5e-74
2275085:2275098	attR	TCAGCCAGCGCCAG	NA	NA	NA	NA
>prophage 9
NZ_CP050756	Salmonella enterica subsp. enterica serovar Indiana strain SI174 chromosome, complete genome	4929169	2366360	2372172	4929169		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2366360_2367167_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2367168_2368161_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2368160_2369051_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2369174_2369576_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_051129228.1|2369875_2370763_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2371069_2371339_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2371693_2371834_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2371872_2372172_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 10
NZ_CP050756	Salmonella enterica subsp. enterica serovar Indiana strain SI174 chromosome, complete genome	4929169	2839142	2846605	4929169	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2839142_2839382_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023226907.1|2840255_2841065_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2841137_2841515_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2841662_2842205_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2842396_2843125_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2843141_2843555_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2844505_2845630_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2846146_2846605_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 11
NZ_CP050756	Salmonella enterica subsp. enterica serovar Indiana strain SI174 chromosome, complete genome	4929169	3667691	3721505	4929169	terminase,protease,coat,portal,transposase,integrase,lysis	Enterobacteria_phage(72.06%)	75	3676268:3676313	3717614:3717659
WP_089541817.1|3667691_3668919_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000062033.1|3669672_3670209_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000781485.1|3670270_3671032_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_064441706.1|3671015_3673577_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
WP_000899098.1|3673581_3674907_+	fimbrial usher protein StbD	NA	NA	NA	NA	NA
WP_023227313.1|3674872_3675631_+	fimbrial assembly chaperone	NA	NA	NA	NA	NA
WP_023227314.1|3675678_3675873_-	hypothetical protein	NA	NA	NA	NA	NA
3676268:3676313	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3676601_3676964_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3676960_3677893_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3677882_3679340_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3679398_3681402_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3681537_3681786_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3681806_3682100_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3682238_3684215_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3684214_3685651_-	phage DNA ejection protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3685661_3686351_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3686353_3686809_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3686808_3687510_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3687513_3688932_-	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3688891_3689392_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3689375_3689936_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3689976_3691269_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_051129359.1|3691268_3692177_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	94.1	4.3e-149
WP_051129358.1|3692190_3694356_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_051129357.1|3694356_3695856_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	9.1e-306
WP_000729923.1|3695833_3696322_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3696325_3696730_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3696729_3697119_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3697122_3697365_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3697587_3698118_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3698330_3698798_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3698794_3699292_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3699269_3699473_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3699903_3700677_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3700673_3700853_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3700833_3701037_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3701033_3701258_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3701254_3701866_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3701858_3702035_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3702027_3702369_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3702371_3702548_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3702514_3702688_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3702684_3703122_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3703195_3703465_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3703461_3704838_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3704834_3705656_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_000166961.1|3705642_3705804_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001103492.1|3705838_3706120_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3706230_3706446_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3706556_3707246_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3707410_3708490_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3708528_3708732_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3709095_3709398_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3709410_3709998_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3710211_3710406_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_072097849.1|3710489_3711104_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	94.4	7.0e-47
WP_000713613.1|3711137_3711425_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3711700_3712015_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3712099_3712258_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_051129356.1|3712238_3712394_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	4.7e-24
WP_000902092.1|3712416_3712560_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3712556_3713264_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3713263_3713548_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3713594_3713888_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3713898_3714069_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3714065_3714575_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3714571_3714805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|3714791_3715436_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3715435_3715720_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3715712_3715997_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3716065_3716206_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3716435_3717599_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893225.1|3717804_3719055_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3717614:3717659	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3719066_3720170_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3720452_3721505_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 12
NZ_CP050756	Salmonella enterica subsp. enterica serovar Indiana strain SI174 chromosome, complete genome	4929169	4338455	4401887	4929169	integrase,protease,tRNA,transposase	Vibrio_phage(16.67%)	56	4375066:4375081	4391914:4391929
WP_001232417.1|4338455_4339460_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312505.1|4339462_4340722_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_000460338.1|4340936_4342217_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051875.1|4342288_4342597_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001000734.1|4342679_4343630_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122557.1|4343622_4345479_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	5.8e-60
WP_023226964.1|4345488_4346811_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.2	1.8e-15
WP_000981984.1|4346827_4347289_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_000968675.1|4347260_4348808_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001615111.1|4348806_4349946_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001595273.1|4351030_4351771_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001271546.1|4351832_4352378_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
WP_001595272.1|4352460_4353537_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934949.1|4353628_4354597_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236755.1|4354615_4357942_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000074655.1|4358008_4358323_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000149872.1|4358374_4359877_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004797.1|4360102_4361080_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.7e-26
WP_001192954.1|4361402_4363193_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829509.1|4363185_4363920_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208749.1|4363930_4364326_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609650.1|4364336_4364696_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001221670.1|4364807_4365341_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	1.2e-47
WP_000118469.1|4365357_4365675_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000912959.1|4365930_4366518_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000239598.1|4366548_4366695_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_001595192.1|4366802_4366937_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_000257282.1|4366998_4367565_-	elongation factor P	NA	NA	NA	NA	NA
WP_017441214.1|4367605_4368634_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001229227.1|4368915_4369773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558210.1|4369820_4370174_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729126.1|4370417_4372064_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
WP_000027827.1|4372107_4372401_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
WP_023227722.1|4372676_4373918_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267291.1|4373976_4374453_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069440.1|4374793_4376230_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
4375066:4375081	attL	CCAGTTCCCGGTAGAT	NA	NA	NA	NA
WP_000637595.1|4376344_4377646_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000887832.1|4377766_4378114_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_001748740.1|4378089_4379793_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188504.1|4379829_4380405_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218742.1|4380773_4381958_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	1.7e-121
WP_000053331.1|4382107_4383118_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000253907.1|4383213_4385340_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_001083368.1|4385402_4386680_+	MFS transporter	NA	NA	NA	NA	NA
WP_000813678.1|4386679_4388110_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_001037798.1|4388304_4389699_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_023181049.1|4390638_4390914_-|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.8e-45
WP_100620379.1|4390963_4391773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001282653.1|4391769_4392525_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
4391914:4391929	attR	ATCTACCGGGAACTGG	NA	NA	NA	NA
WP_023181050.1|4392541_4394077_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_024179174.1|4394786_4396460_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001238009.1|4396512_4396710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766273.1|4396849_4397116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001100175.1|4397112_4398684_-	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_001207400.1|4398730_4399810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541817.1|4400658_4401887_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
