The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050726	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 chromosome, complete genome	4974417	665509	705181	4974417	portal,head,tRNA,tail,capsid,holin,transposase,integrase,terminase	Cronobacter_phage(69.44%)	46	665531:665546	696132:696147
WP_039026397.1|665509_666331_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
665531:665546	attL	CTGCGCCGGTGTTTTC	NA	NA	NA	NA
WP_039026396.1|666327_666642_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167797742.1|666704_666860_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|667117_668899_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|668888_669926_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568372.1|669929_670496_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_000514631.1|670512_671094_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|671237_671459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|671489_671993_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|672002_672230_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|672219_672645_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|672644_673046_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|673113_673347_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|673337_674198_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|674194_676216_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000353141.1|676335_676542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|676515_676839_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|676835_677897_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|677893_679669_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|679829_680633_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|680694_681717_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|681720_682422_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000447487.1|682482_682971_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_000084218.1|682967_683474_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|683470_684178_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|684174_685302_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|685298_685754_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|685763_686057_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|686053_686395_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|686394_686727_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_000411339.1|686873_687131_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|687318_689289_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|689285_689615_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|689611_690796_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|690788_691376_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|691385_693620_+|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|693632_694187_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|694176_694902_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|694873_695419_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_001680744.1|695421_697122_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
696132:696147	attR	GAAAACACCGGCGCAG	NA	NA	NA	NA
WP_000340945.1|698490_698793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|699116_699623_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|699746_701594_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|701743_703489_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|703724_703940_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264394.1|704167_705181_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
>prophage 2
NZ_CP050726	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 chromosome, complete genome	4974417	1240086	1315436	4974417	tRNA,head,portal,tail,capsid,holin,integrase,transposase,lysis,terminase,protease	Salmonella_phage(42.11%)	86	1232167:1232183	1321283:1321299
1232167:1232183	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1240086_1241124_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1241239_1241929_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1242247_1242631_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1242692_1243280_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1243382_1244282_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1244299_1245634_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1245764_1246502_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1246486_1248109_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1248372_1248537_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1248533_1249109_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1249140_1249791_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1249790_1250747_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1250743_1251223_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1251720_1252950_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1252927_1253212_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1253252_1253492_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1253534_1254692_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1254654_1257582_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1257708_1258059_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1258080_1258239_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|1258637_1259042_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1259171_1259408_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1259373_1259748_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1259832_1260816_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1260818_1261568_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1261578_1261926_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1261922_1262447_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1262446_1262920_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_001217666.1|1263784_1264024_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_000929803.1|1264358_1264961_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1265169_1265781_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1265777_1265918_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1265914_1266592_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1266864_1267428_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1267934_1268123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1268337_1269024_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1269299_1269629_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|1269612_1270065_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|1270082_1270535_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1270770_1271172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1271458_1272004_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1271975_1273907_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1273890_1274094_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1274090_1275671_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1275660_1277157_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1277169_1277517_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1277571_1278600_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1278657_1279017_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1279027_1279411_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1279438_1280017_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1280065_1281196_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1281304_1281706_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_077248250.1|1281713_1282460_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|1282510_1282906_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1282902_1283241_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1283212_1286308_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1286310_1286640_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1286649_1287348_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1287354_1288092_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1287989_1288637_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1288698_1292061_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1292099_1292342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1292395_1294768_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1294764_1295589_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1295578_1296157_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1296253_1296481_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1296587_1296800_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1297552_1297672_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1298384_1298522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1298958_1300452_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1300856_1302656_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1302672_1303647_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1303920_1304601_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1304597_1305503_+	GTPase Era	NA	NA	NA	NA	NA
WP_033567169.1|1305514_1306243_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1306254_1306986_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1306985_1307366_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1307477_1307738_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1307775_1308702_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1308817_1310014_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684027.1|1310035_1310953_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1310991_1311840_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1311955_1312849_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1312859_1314221_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1314224_1314860_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1314884_1315436_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1321283:1321299	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP050726	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 chromosome, complete genome	4974417	1669210	1698802	4974417	holin,tail,protease	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1669210_1669705_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1670118_1670610_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1670599_1670863_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1670859_1673346_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1673352_1674048_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1674034_1674904_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1675019_1675469_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1675478_1676081_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1676101_1676719_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1676715_1677375_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1677426_1678164_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1678160_1678373_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1678369_1678849_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1678845_1680777_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1680773_1681331_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_033572444.1|1681327_1682371_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1682414_1683062_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1683791_1684355_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1684546_1684750_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1685052_1685844_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1686139_1686343_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1686511_1688878_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1689206_1690196_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1690210_1690579_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1690607_1691939_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1692235_1692565_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1693157_1694399_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1694401_1694929_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1695306_1695750_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1695803_1697633_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1697980_1698271_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1698298_1698802_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP050726	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 chromosome, complete genome	4974417	1770854	1780025	4974417	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1770854_1771802_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1771785_1772517_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1772497_1772605_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1772664_1773396_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1773618_1775304_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1775300_1776020_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1776066_1776534_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1776590_1777121_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1777292_1777751_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_167797745.1|1777991_1780025_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 5
NZ_CP050726	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 chromosome, complete genome	4974417	1848333	1858839	4974417		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1848333_1849737_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1849914_1850808_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1851184_1852270_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1852269_1853169_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1853216_1854095_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1854095_1854647_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1854652_1855645_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1855641_1856415_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1856419_1857499_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1857525_1858839_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP050726	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 chromosome, complete genome	4974417	1944833	1995520	4974417	portal,head,tail,plate,capsid,holin,integrase,terminase,protease	Salmonella_phage(81.54%)	70	1939411:1939425	1955541:1955555
1939411:1939425	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1944833_1945307_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_000598920.1|1946616_1947414_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1947705_1948695_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|1948696_1948924_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061334.1|1948963_1949533_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|1949536_1950118_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|1950128_1950386_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|1950387_1950921_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|1950991_1951531_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|1951667_1952495_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|1952552_1952924_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|1953463_1953688_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|1953650_1953989_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|1954194_1954890_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1954987_1955212_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1955240_1955795_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1955541:1955555	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087404.1|1955791_1956934_+	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|1956930_1957155_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_033567233.1|1957151_1958126_+	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000054228.1|1958122_1958596_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567232.1|1958592_1959468_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000779148.1|1959476_1959866_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061452.1|1959882_1960743_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_070793644.1|1960750_1961740_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_020899401.1|1961753_1962506_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|1962656_1962914_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|1963059_1963446_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|1963432_1963714_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|1963713_1964328_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|1964324_1964717_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001005132.1|1964957_1965512_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	4.5e-101
WP_001135098.1|1965562_1965913_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|1966038_1966533_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_033567282.1|1966529_1968263_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000605609.1|1968274_1968457_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466255.1|1968456_1969698_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_033567207.1|1969675_1970326_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_033572441.1|1970340_1971546_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033572442.1|1971595_1971796_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_000927721.1|1971798_1972122_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033567256.1|1972118_1972523_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_033567257.1|1972494_1973007_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_000779213.1|1973003_1973561_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_065305283.1|1973582_1973747_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_033567258.1|1973736_1975233_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515953.1|1975232_1975589_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|1975585_1975912_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|1975996_1977922_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|1977938_1978388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033567259.1|1978447_1979788_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001066632.1|1979784_1980843_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|1980842_1981376_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|1981380_1981794_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|1981786_1982866_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|1982868_1983456_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|1983442_1985005_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_022742744.1|1984974_1985580_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|1985693_1985927_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|1986001_1986115_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|1986162_1986576_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|1986572_1986785_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|1987978_1988140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1988266_1988686_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1988688_1989957_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1990411_1990624_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1990634_1990823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1991083_1992280_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1992929_1993229_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1993320_1994016_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1994089_1995520_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP050726	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 chromosome, complete genome	4974417	2099564	2106373	4974417	integrase,tail	Salmonella_phage(33.33%)	11	2101774:2101796	2111489:2111511
WP_000856224.1|2099564_2099795_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2099932_2100307_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2100307_2101183_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2101199_2101553_+	YebY family protein	NA	NA	NA	NA	NA
2101774:2101796	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2101926_2102781_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2102840_2103335_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2103524_2103755_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2103808_2104342_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2104598_2104766_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2104830_2105019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2105491_2106373_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2111489:2111511	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP050726	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 chromosome, complete genome	4974417	2893272	2984189	4974417	tRNA,tail,holin,integrase,lysis,terminase,protease	Salmonella_phage(58.7%)	91	2917366:2917385	2981262:2981281
WP_000938191.1|2893272_2893953_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2894573_2895233_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2895319_2895649_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2895645_2895927_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2895975_2896755_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2896780_2897329_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2897543_2898755_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2898812_2899130_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2899174_2899588_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2899761_2900424_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2900518_2900977_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2901012_2903067_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2903190_2903637_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2903655_2905809_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2905795_2906401_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2906617_2907127_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2907483_2908536_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2908607_2909060_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2909245_2911006_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2911074_2911593_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2911692_2911860_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_033567177.1|2912115_2912679_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2912675_2914316_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2914320_2915574_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2915588_2917496_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2917366:2917385	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2917508_2919617_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2919715_2920825_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2920821_2921364_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2921529_2922540_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2922747_2925360_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2925786_2925978_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2926248_2926935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|2926919_2927219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2927287_2927914_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2928561_2929530_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|2930005_2930587_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|2930586_2933025_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|2933078_2933321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541993.1|2933359_2934235_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001576012.1|2936781_2937486_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|2937383_2938121_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2938130_2938826_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2938915_2939449_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2939565_2940063_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|2940162_2940495_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|2941615_2942161_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|2942629_2943076_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000984584.1|2943093_2943546_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|2943529_2943859_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_001141973.1|2944134_2944821_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2945181_2945631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2945766_2945892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097242.1|2946086_2946776_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_000801757.1|2946772_2946913_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|2946909_2947521_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|2947729_2948332_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|2948416_2948638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|2948747_2948981_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|2949572_2950169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|2950180_2951158_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|2951212_2951470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|2951469_2952114_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|2952117_2952426_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|2952429_2952888_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_020899441.1|2952884_2953232_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000800012.1|2953242_2953992_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062943.1|2953994_2954978_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|2955062_2955383_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|2955417_2955645_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|2955750_2956185_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|2956481_2956613_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|2956661_2957012_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_136614733.1|2957138_2960339_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	78.6	0.0e+00
WP_014344386.1|2960301_2961459_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2961501_2961741_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2961781_2962030_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|2962074_2963367_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000191399.1|2963561_2964764_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2964841_2966278_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2966522_2967737_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2968053_2968515_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2968715_2970116_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|2970722_2971814_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|2971998_2973189_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|2973250_2973898_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2973925_2974474_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|2974733_2976575_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|2976919_2981386_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
2981262:2981281	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|2981385_2982090_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|2982070_2983393_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|2983385_2984189_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP050726	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 chromosome, complete genome	4974417	3034252	3041869	4974417	transposase,protease	Enterobacteria_phage(16.67%)	6	NA	NA
WP_085983316.1|3034252_3035507_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3035970_3036429_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3036620_3038897_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3038927_3039248_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3039571_3039793_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3039922_3041869_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
>prophage 10
NZ_CP050726	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 chromosome, complete genome	4974417	3662774	3674776	4974417	integrase	Enterobacteria_phage(33.33%)	14	3667455:3667468	3674156:3674169
WP_001529722.1|3662774_3665126_-	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	48.5	6.8e-74
WP_001529721.1|3665138_3665741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|3665733_3665955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|3665951_3666215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3666211_3666406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032150717.1|3666398_3667427_-	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
WP_000476150.1|3667420_3667603_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
3667455:3667468	attL	AAACGCGCCAGCGG	NA	NA	NA	NA
WP_033567214.1|3667595_3668429_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	9.0e-21
WP_001529719.1|3668441_3668873_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_000035054.1|3668872_3669076_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_001529718.1|3669504_3670719_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000893231.1|3671075_3672326_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3672337_3673441_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3673723_3674776_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3674156:3674169	attR	AAACGCGCCAGCGG	NA	NA	NA	NA
>prophage 11
NZ_CP050726	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 chromosome, complete genome	4974417	4509769	4553633	4974417	tRNA,head,portal,tail,plate,capsid,holin,integrase,terminase,protease	Shigella_phage(44.07%)	63	4511903:4511917	4515309:4515323
WP_000918353.1|4509769_4511185_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235551.1|4511249_4512233_+	quinone oxidoreductase	NA	NA	NA	NA	NA
4511903:4511917	attL	GAAAGATACCTGGGA	NA	NA	NA	NA
WP_000891414.1|4512407_4512650_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_022630972.1|4512817_4513855_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332264.1|4513943_4515041_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_033567204.1|4515102_4515351_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	2.0e-37
4515309:4515323	attR	GAAAGATACCTGGGA	NA	NA	NA	NA
WP_000639149.1|4515494_4516058_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_006678262.1|4516383_4517112_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	100.0	2.8e-143
WP_001747940.1|4517113_4517521_+|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_006678265.1|4517524_4518142_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_023200332.1|4518111_4519644_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	97.9	1.6e-241
WP_000383548.1|4519647_4520232_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_022630974.1|4520222_4521281_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000424732.1|4521267_4521693_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630975.1|4521692_4522241_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000999499.1|4522240_4523320_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_000219913.1|4523316_4524645_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_001219112.1|4524735_4525230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023200330.1|4525329_4527162_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	4.7e-304
WP_000661047.1|4527303_4527573_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|4527572_4527929_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_022630977.1|4527928_4529425_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000497751.1|4529408_4529579_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|4529587_4530148_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_022630978.1|4530144_4530651_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000702388.1|4530625_4531036_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927719.1|4531032_4531356_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_021577001.1|4531330_4531558_-	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_021567480.1|4531607_4532813_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	3.5e-223
WP_021578635.1|4532827_4533478_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	3.6e-118
WP_001514795.1|4533455_4534697_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_000605606.1|4534696_4534879_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000088161.1|4534890_4536624_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_048306293.1|4536637_4537123_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	6.1e-86
WP_001135098.1|4537248_4537599_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001005132.1|4537649_4538204_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	4.5e-101
WP_001530346.1|4538444_4538837_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|4538833_4539448_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|4539447_4539729_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|4539715_4540102_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|4540247_4540505_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_048306282.1|4540655_4541408_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	99.6	9.0e-145
WP_033567167.1|4541421_4542411_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_001061444.1|4542418_4543228_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001398927.1|4543247_4543637_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_000210170.1|4543633_4543960_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001433188.1|4543956_4544610_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_086936917.1|4544609_4545104_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	4.7e-86
WP_000104942.1|4545100_4546042_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|4546031_4546211_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_167797749.1|4546386_4546944_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	5.7e-96
WP_000649477.1|4546987_4547188_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|4547278_4547953_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001369946.1|4548124_4548328_+	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_001514782.1|4548336_4548612_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_001323604.1|4549194_4549575_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	1.3e-62
WP_033567165.1|4549640_4550465_+	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	1.1e-148
WP_000008210.1|4550592_4551129_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001565177.1|4551119_4551482_+	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_000206745.1|4551481_4552291_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.8	3.3e-76
WP_001061343.1|4552290_4552863_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.8	3.7e-106
WP_001093909.1|4552899_4553172_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_000549966.1|4553198_4553633_-	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
>prophage 12
NZ_CP050726	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 chromosome, complete genome	4974417	4580082	4600502	4974417	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000615248.1|4580082_4580430_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4581005_4581293_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4581295_4581901_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4581913_4582228_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4582387_4582843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4582839_4583037_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4583026_4584454_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4584453_4584978_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4585029_4585347_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4585306_4585435_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4585531_4587886_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4587885_4588839_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4588838_4589048_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4589035_4590079_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4590088_4590811_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4591138_4591501_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4591497_4592427_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4592426_4593974_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4594137_4594497_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4594487_4595603_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4595595_4596228_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4596230_4597976_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4597980_4598586_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4598582_4599038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4599286_4599577_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4599773_4600502_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP050727	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 plasmid pST-1, complete sequence	147578	18006	46747	147578	transposase,integrase	Escherichia_phage(54.55%)	26	27342:27357	32272:32287
WP_001067855.1|18006_18711_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|19261_19966_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001326396.1|21343_22384_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001297096.1|23798_24578_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255946.1|24577_25600_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_000101568.1|26251_27292_-	DNA-binding protein	NA	NA	NA	NA	NA
27342:27357	attL	GTAATTATCATAATTA	NA	NA	NA	NA
WP_001097010.1|27444_28320_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000139717.1|28656_29148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997323.1|29144_30014_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000543934.1|30018_31029_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|31031_31568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|31866_32148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|32417_33020_+	hypothetical protein	NA	NA	NA	NA	NA
32272:32287	attR	GTAATTATCATAATTA	NA	NA	NA	NA
WP_001326394.1|33658_34099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257735.1|34070_38324_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_032410269.1|38278_38482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988731.1|38456_39182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868820.1|39295_39670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338626.1|39790_39907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|40564_41269_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_080073232.1|41293_41800_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	6.4e-78
WP_000027057.1|41982_42843_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001277456.1|43518_43881_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|43877_44114_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|44149_44818_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|46042_46747_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP050727	Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 plasmid pST-1, complete sequence	147578	52294	116338	147578	transposase	Escherichia_phage(47.06%)	64	NA	NA
WP_001067858.1|52294_52999_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001333231.1|53159_53369_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_065800292.1|53414_53936_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.4	8.1e-20
WP_000392235.1|54985_55663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139341.1|56292_56853_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_015059122.1|56907_57654_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.6	1.7e-07
WP_015059123.1|57673_62944_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_022630316.1|62943_65160_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000850424.1|65412_66144_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_031943494.1|66157_66667_-	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_001007045.1|66663_69489_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_029400169.1|69485_70862_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010379880.1|70858_71221_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000059821.1|71150_71696_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_000624109.1|71682_71967_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_001287891.1|72085_72433_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_001430248.1|72448_73192_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_000864352.1|73184_73442_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_000821821.1|73468_75277_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000777692.1|75273_75912_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_000830839.1|75920_76913_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_001203720.1|76909_77542_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000214092.1|77538_77925_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_000069764.1|77921_80552_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_000836675.1|80677_81040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059129.1|81361_81838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278695.1|81830_82052_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	4.4e-07
WP_015059130.1|82186_82702_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001038342.1|82698_82950_-	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_071594066.1|82942_83296_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_000002787.1|83249_83840_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_000146685.1|83829_85257_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_001230813.1|85256_85985_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399792.1|85971_86538_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012106.1|86559_86871_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000340272.1|86885_87245_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001254386.1|87278_87506_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000332484.1|87599_88286_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|88476_88860_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_031943493.1|89136_89784_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001234469.1|90080_90902_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000107544.1|91019_91307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|92228_92387_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_013362833.1|92666_93386_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845953.1|93382_93817_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_161501683.1|93871_95101_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_039026397.1|95101_95923_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	28.7	3.5e-09
WP_039026396.1|95919_96234_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_039026395.1|96428_96809_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_039026394.1|96926_98552_-	phosphoethanolamine--lipid A transferase MCR-3.1	NA	NA	NA	NA	NA
WP_001067858.1|99545_100250_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000557454.1|100508_101369_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|101381_101924_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067858.1|102639_103344_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_161501753.1|103406_103586_-	DUF4158 domain-containing protein	NA	Q1MVP5	Enterobacteria_phage	98.3	2.3e-27
WP_001067858.1|103857_104562_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001516695.1|108688_109345_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_063091249.1|109663_110053_-	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	44.6	1.1e-13
WP_001067858.1|110043_110748_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_015387340.1|110995_111871_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001067858.1|112468_113173_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001011939.1|113268_113910_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_127762863.1|114053_114758_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.4e-138
WP_012783960.1|114748_116338_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
