The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050723	Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 chromosome, complete genome	4679573	1414568	1420621	4679573		Salmonella_virus(50.0%)	6	NA	NA
WP_105789229.1|1414568_1414736_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
WP_105789228.1|1414751_1414895_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_000400616.1|1415884_1417807_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_000703599.1|1417824_1418079_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|1418047_1418437_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000377779.1|1419679_1420621_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 2
NZ_CP050723	Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 chromosome, complete genome	4679573	1657054	1666225	4679573	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1657054_1658002_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1657985_1658717_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1658697_1658805_-	protein YohO	NA	NA	NA	NA	NA
WP_001240420.1|1658864_1659596_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
WP_000272845.1|1659818_1661504_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1661500_1662220_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1662266_1662734_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1662790_1663321_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1663492_1663951_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1664191_1666225_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP050723	Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 chromosome, complete genome	4679573	1733423	1743930	4679573		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1733423_1734827_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1735004_1735898_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1736274_1737360_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1737359_1738259_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1738306_1739185_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1739185_1739737_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1739742_1740717_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1740732_1741506_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1741510_1742590_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1742616_1743930_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP050723	Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 chromosome, complete genome	4679573	1856853	1904349	4679573	capsid,portal,tail,integrase,terminase,head,plate,protease,transposase,holin	Salmonella_phage(79.25%)	60	1859754:1859768	1907944:1907958
WP_001680077.1|1856853_1858128_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
WP_000598920.1|1859453_1860251_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1859754:1859768	attL	AGGGATGCCGCTGGC	NA	NA	NA	NA
WP_000532847.1|1860542_1861532_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|1861533_1861761_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061370.1|1861800_1862370_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_000208076.1|1862366_1863230_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_000267991.1|1863226_1863520_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000065085.1|1863791_1864151_-	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000071068.1|1864147_1864663_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000764235.1|1864659_1864890_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1864960_1865500_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000551790.1|1865594_1866512_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_000078504.1|1867081_1867333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067433.1|1867408_1867594_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_001020644.1|1867799_1868495_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_001191666.1|1868592_1868817_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509728.1|1868845_1869400_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
WP_001087406.1|1869396_1870554_+	peptidase	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_000620702.1|1870550_1870775_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000096529.1|1870771_1871746_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000054227.1|1871742_1872216_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_000200166.1|1872212_1873094_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000779149.1|1873102_1873492_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_001061459.1|1873508_1874369_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
WP_012543375.1|1874376_1875366_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_001047141.1|1875379_1876132_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
WP_000357930.1|1876181_1877255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765639.1|1877267_1877840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294874.1|1877928_1878318_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000226304.1|1878304_1878586_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001075993.1|1878585_1879203_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000127618.1|1879199_1879739_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001135228.1|1879762_1880113_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000501481.1|1880259_1880697_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_167813217.1|1880696_1882427_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.7	4.7e-197
WP_000838395.1|1882423_1882582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077905357.1|1882698_1883793_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000003793.1|1883785_1884388_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_000766103.1|1884397_1885627_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000927251.1|1885706_1886030_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000776844.1|1886026_1886431_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_001135695.1|1886402_1886915_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000779215.1|1886911_1887472_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_000497739.1|1887475_1887640_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007993.1|1887629_1889126_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000515952.1|1889125_1889482_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1889478_1889805_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785387.1|1889889_1891818_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000863817.1|1891851_1893192_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_001066630.1|1893188_1894247_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273650.1|1894246_1894780_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_000605050.1|1894784_1895198_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001699732.1|1895190_1896270_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	5.5e-204
WP_001207832.1|1896272_1896860_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554738.1|1896846_1898409_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	9.8e-287
WP_015701331.1|1898378_1898978_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000492926.1|1899262_1900270_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1900482_1900704_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_001176778.1|1902046_1902865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028172.1|1903326_1904349_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
1907944:1907958	attR	AGGGATGCCGCTGGC	NA	NA	NA	NA
>prophage 5
NZ_CP050723	Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 chromosome, complete genome	4679573	2436536	2452480	4679573	tRNA,holin	Escherichia_phage(64.71%)	23	NA	NA
WP_001082296.1|2436536_2436971_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2437020_2437359_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000729249.1|2437998_2438172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000802786.1|2438204_2438750_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2438746_2439028_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2439017_2439206_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2439127_2439523_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2441693_2442230_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2442226_2442517_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2442516_2443116_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000734094.1|2443178_2443349_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000882662.1|2443639_2443852_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556390.1|2444221_2445154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2445150_2445705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2445866_2446196_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2446468_2446936_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2447320_2447476_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2447583_2448105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|2448542_2448764_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2448848_2449166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2449193_2449811_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2450127_2451063_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2451106_2452480_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP050723	Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 chromosome, complete genome	4679573	2643770	2693020	4679573	lysis,tail,integrase,protease,holin	Salmonella_phage(27.27%)	48	2673535:2673564	2693156:2693185
WP_000984498.1|2643770_2644652_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|2644845_2646894_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2646913_2647600_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|2647697_2648195_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2648323_2649607_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001529852.1|2649575_2652209_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001531515.1|2652286_2653726_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2653843_2654080_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|2654190_2654382_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986173.1|2654400_2655051_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_001134856.1|2655274_2655439_-	membrane protein	NA	NA	NA	NA	NA
WP_000182071.1|2655723_2656446_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|2657129_2657525_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|2657854_2658331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025515.1|2658703_2659123_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001576019.1|2659495_2659765_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001576018.1|2659930_2660071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2663209_2664124_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2664256_2664415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|2664424_2665039_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000951652.1|2665526_2665673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|2666173_2666299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012543349.1|2666868_2667069_+	phage encoded PagK	NA	NA	NA	NA	NA
WP_001687735.1|2667165_2667666_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_000348541.1|2669770_2670262_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_001576014.1|2670316_2670505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2670569_2670737_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|2670993_2671527_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_001013467.1|2671580_2671811_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_077681935.1|2672000_2672495_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
WP_000622159.1|2673138_2673408_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	47.8	2.7e-11
2673535:2673564	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_001536069.1|2674352_2675153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|2675632_2676355_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001152416.1|2680409_2681105_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2681194_2681728_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2682622_2683102_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2683119_2683572_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2683555_2683885_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2684160_2684847_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2685207_2685657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2686030_2686555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2686651_2687341_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2687470_2687698_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2687694_2688294_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|2688357_2688663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2689294_2691274_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2691687_2691966_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2691940_2693020_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2693156:2693185	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP050723	Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 chromosome, complete genome	4679573	2865412	2906110	4679573	protease,tail	Salmonella_phage(28.57%)	40	NA	NA
WP_000938186.1|2865412_2866093_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2866711_2867371_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2867457_2867787_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2867783_2868065_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2868113_2868893_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2868918_2869467_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2869681_2870893_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2870950_2871268_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001676378.1|2871312_2871726_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_058662153.1|2871899_2872562_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2872656_2873115_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2873150_2875205_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2875328_2875775_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2875793_2877947_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2877933_2878539_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2878755_2879265_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2879621_2880674_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2880745_2881198_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2881383_2883144_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2883212_2883731_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2883830_2883998_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2884253_2884817_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2884813_2886454_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2886458_2887712_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2887726_2889634_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2889646_2891755_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2891853_2892963_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2892959_2893502_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2893667_2894678_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2894885_2897498_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2897924_2898116_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2898386_2899073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2899432_2900059_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2900706_2901675_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2901900_2902149_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2902152_2902734_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2902733_2904443_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2904439_2905066_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2905049_2905679_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|2905699_2906110_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 8
NZ_CP050723	Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 chromosome, complete genome	4679573	2977311	2984624	4679573	protease,integrase	Ralstonia_phage(16.67%)	7	2972108:2972122	2983360:2983374
2972108:2972122	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2977311_2977689_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2977850_2978048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2978260_2980537_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2980567_2980888_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2981211_2981433_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2981562_2983509_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2983360:2983374	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2983505_2984624_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP050724	Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence	115154	1796	58277	115154	integrase,transposase,protease	Escherichia_phage(41.67%)	55	18151:18210	48681:49501
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2542_2800_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2732_3134_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|4444_5149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_157698536.1|5125_5452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023281052.1|5459_5909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039021305.1|6556_7096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039021304.1|7106_7556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039021303.1|7539_8082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567331.1|8153_8561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567330.1|8603_8807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023281053.1|9055_11104_+	site-specific DNA-methyltransferase	NA	A0A1B0XWD0	Campylobacter_phage	37.8	9.5e-64
WP_167813221.1|11108_13745_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_023281055.1|13787_14372_-	mobilization protein MobX	NA	NA	NA	NA	NA
WP_000583524.1|15409_16006_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.7	7.1e-36
WP_032193599.1|17468_18173_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
18151:18210	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067858.1|18202_18907_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001175594.1|19105_19429_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044502555.1|19533_20571_+	permease	NA	NA	NA	NA	NA
WP_000521603.1|20863_21481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024126035.1|21671_23228_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000194575.1|23490_24081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343085.1|24080_24338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350635.1|24691_26830_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044768.1|26991_27408_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|27404_27635_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000741348.1|27942_29508_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000253407.1|29564_30434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952231.1|30435_31524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000991830.1|31821_32754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246635.1|32757_33753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|34432_34783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129823.1|34833_35577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|35573_36350_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|36407_36665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|36793_36898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000957857.1|37127_37316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072648941.1|37325_38525_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_024129958.1|39010_39364_-	DNA distortion protein 3	NA	NA	NA	NA	NA
WP_001074384.1|39500_39947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435064.1|39950_40793_-	replication initiation protein	NA	NA	NA	NA	NA
WP_024129959.1|40813_41653_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000121743.1|42887_43139_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000220561.1|43128_43410_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
WP_072648941.1|43906_45106_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|45115_45304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572405.1|46882_47677_+	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
WP_001067858.1|47983_48688_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000888203.1|48776_49256_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_058914901.1|49325_52478_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
48681:49501	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCAAAAGAACAAGATTCACCGCAACCCAGGACACTGCCATGTTAGATTACCGCTTCCCGACAGCTTTGCAGATGGTTCTCAGCGTAGCAATGGCGGAGCAGATGGGTGAACGTTCGACGAGTGCGATTCTGGCCTACGGCCTGGAAGCGAACCCGAGCTTTATCCGTAAACTAATGGTTCCGCTAACTCGTGACGGCATTATCGTCTCCACGCTTGGTCGCAACGGCTCAATTCATCTTGGCCGTCCGGCGGACAAGATCACCCTGCGTGATATCTATCTTTCGGTTATCGAAGATAAAAAACTGTGGGCGTCGCGTCCTGACGTCCCGGCCCGCTGCGTGGTCAGCGCCAACGCCTGCTGGTACTTCAAATCGGTTGCCGATGAAGCAGAGCAGGCTTCGTTAAACGTCCTCGCTCGCCATACCGTGGCCAGCGCGCTGGAGGCGGTCAAAAACGCCGATACCAGCGGCTGCGACCCGGTGCCGGAAATGATCGCCCGCTTTAAAAAAGCGCATTAATCATTTTCTGGTGACGAAAAAAAACCGCCTTCAAATTGTGAAGGCGGTTTTTTTGTTATCTGCTGCAGGCTAGGCGGGCAGATCCTCCTGGACCGGCTTCCTGCGGGTCACCAGTTTCCGTAGCGTCACGTAAAACACCGGCGTCAGGAACAGACCGAAGAGCGTCACGCCCAGCATCCCGGAGAACACCGTGATCCCGGTGACGCCGCGGACTTCCGCCCCCGCGCCGTGGCCGAGGATCAGCG	NA	NA	NA	NA
WP_063865358.1|52501_53677_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA2	NA	NA	NA	NA	NA
WP_001067855.1|53996_54701_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013023839.1|55752_56229_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_015387340.1|56275_57151_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001067858.1|57572_58277_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
NZ_CP050725	Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-2, complete sequence	64336	0	1905	64336		Stx_converting_phage(100.0%)	2	NA	NA
WP_015059604.1|1304_1466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751876.1|1518_1905_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	46.9	3.0e-27
>prophage 2
NZ_CP050725	Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-2, complete sequence	64336	11473	12031	64336		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000725064.1|11473_12031_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	37.4	5.8e-24
>prophage 3
NZ_CP050725	Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-2, complete sequence	64336	26373	60485	64336	transposase,integrase	Enterobacteria_phage(21.43%)	35	23194:23208	61637:61651
23194:23208	attL	AACAGGAACTGGTGA	NA	NA	NA	NA
WP_001143760.1|26373_29379_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|29542_30100_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|30282_31143_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001676653.1|31941_32106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137853.1|32148_33900_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_000925628.1|34170_34593_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|34592_35867_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000064277.1|35948_36923_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	5.1e-84
WP_000427676.1|36922_38128_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|38542_39484_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|39480_40086_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|40142_40478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|40661_41078_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001247117.1|41163_42279_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001135409.1|42536_43025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541566.1|43679_44420_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_001240330.1|44626_45187_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
WP_000098781.1|45170_46835_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_077907510.1|46767_47793_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001121400.1|47981_49019_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000346690.1|49626_50520_+	virulence genes transcriptional activator SpvR	NA	NA	NA	NA	NA
WP_001576629.1|50693_50858_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
WP_001676649.1|51031_51799_+	virulence protein SpvA	NA	NA	NA	NA	NA
WP_001526987.1|51761_51929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676648.1|51980_53756_+	SPI-2 type III secretion system effector NAD(+)--protein-arginine ADP-ribosyltransferase SpvB	NA	NA	NA	NA	NA
WP_167813222.1|54036_54762_+	type III secretion system effector phosphothreonine lyase SpvC	NA	NA	NA	NA	NA
WP_001676646.1|55023_55674_+	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
WP_000064919.1|55800_56226_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
WP_001675600.1|56282_56642_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	76.7	3.0e-42
WP_000900095.1|56708_57269_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_071530243.1|57424_57712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905606.1|57988_58474_-	membrane protein	NA	NA	NA	NA	NA
WP_001541544.1|58467_58977_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000545756.1|58980_59694_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000082169.1|59702_60485_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
61637:61651	attR	TCACCAGTTCCTGTT	NA	NA	NA	NA
