The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050712	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 chromosome, complete genome	4679142	1414477	1420530	4679142		Salmonella_virus(50.0%)	6	NA	NA
WP_105789229.1|1414477_1414645_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
WP_105789228.1|1414660_1414804_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_000400616.1|1415793_1417716_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_000703599.1|1417733_1417988_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|1417956_1418346_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000377779.1|1419588_1420530_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 2
NZ_CP050712	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 chromosome, complete genome	4679142	1656831	1666002	4679142	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1656831_1657779_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1657762_1658494_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1658474_1658582_-	protein YohO	NA	NA	NA	NA	NA
WP_001240420.1|1658641_1659373_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
WP_000272845.1|1659595_1661281_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1661277_1661997_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1662043_1662511_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1662567_1663098_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1663269_1663728_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1663968_1666002_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP050712	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 chromosome, complete genome	4679142	1733200	1743707	4679142		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1733200_1734604_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1734781_1735675_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1736051_1737137_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1737136_1738036_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1738083_1738962_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1738962_1739514_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1739519_1740494_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1740509_1741283_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1741287_1742367_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1742393_1743707_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP050712	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 chromosome, complete genome	4679142	1856630	1904126	4679142	plate,tail,holin,integrase,capsid,transposase,protease,head,portal,terminase	Salmonella_phage(79.25%)	60	1859531:1859545	1907721:1907735
WP_001680077.1|1856630_1857905_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
WP_000598920.1|1859230_1860028_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1859531:1859545	attL	AGGGATGCCGCTGGC	NA	NA	NA	NA
WP_000532847.1|1860319_1861309_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|1861310_1861538_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061370.1|1861577_1862147_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_000208076.1|1862143_1863007_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_000267991.1|1863003_1863297_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000065085.1|1863568_1863928_-	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000071068.1|1863924_1864440_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000764235.1|1864436_1864667_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1864737_1865277_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000551790.1|1865371_1866289_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_000078504.1|1866858_1867110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067433.1|1867185_1867371_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_001020644.1|1867576_1868272_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_001191666.1|1868369_1868594_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509728.1|1868622_1869177_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
WP_001087406.1|1869173_1870331_+	peptidase	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_000620702.1|1870327_1870552_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000096529.1|1870548_1871523_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000054227.1|1871519_1871993_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_000200166.1|1871989_1872871_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000779149.1|1872879_1873269_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_001061459.1|1873285_1874146_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
WP_012543375.1|1874153_1875143_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_001047141.1|1875156_1875909_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
WP_000357930.1|1875958_1877032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765639.1|1877044_1877617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294874.1|1877705_1878095_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000226304.1|1878081_1878363_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001075993.1|1878362_1878980_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000127618.1|1878976_1879516_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001135228.1|1879539_1879890_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000501481.1|1880036_1880474_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_000257219.1|1880473_1882204_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
WP_000838395.1|1882200_1882359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077905357.1|1882475_1883570_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000003793.1|1883562_1884165_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_000766103.1|1884174_1885404_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000927251.1|1885483_1885807_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000776844.1|1885803_1886208_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_001135695.1|1886179_1886692_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000779215.1|1886688_1887249_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_000497739.1|1887252_1887417_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007993.1|1887406_1888903_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000515952.1|1888902_1889259_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1889255_1889582_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785387.1|1889666_1891595_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000863817.1|1891628_1892969_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_001066630.1|1892965_1894024_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273650.1|1894023_1894557_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_000605050.1|1894561_1894975_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001699732.1|1894967_1896047_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	5.5e-204
WP_001207832.1|1896049_1896637_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554738.1|1896623_1898186_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	9.8e-287
WP_015701331.1|1898155_1898755_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000492926.1|1899039_1900047_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1900259_1900481_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_001176778.1|1901823_1902642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028172.1|1903103_1904126_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
1907721:1907735	attR	AGGGATGCCGCTGGC	NA	NA	NA	NA
>prophage 5
NZ_CP050712	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 chromosome, complete genome	4679142	2436312	2452256	4679142	holin,tRNA	Escherichia_phage(64.71%)	23	NA	NA
WP_001082296.1|2436312_2436747_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2436796_2437135_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000729249.1|2437774_2437948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000802786.1|2437980_2438526_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2438522_2438804_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2438793_2438982_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2438903_2439299_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2441469_2442006_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2442002_2442293_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2442292_2442892_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000734094.1|2442954_2443125_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000882662.1|2443415_2443628_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556390.1|2443997_2444930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2444926_2445481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2445642_2445972_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2446244_2446712_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2447096_2447252_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2447359_2447881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|2448318_2448540_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2448624_2448942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2448969_2449587_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2449903_2450839_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2450882_2452256_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP050712	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 chromosome, complete genome	4679142	2643546	2692796	4679142	tail,holin,integrase,lysis,protease	Salmonella_phage(27.27%)	48	2673311:2673340	2692932:2692961
WP_000984498.1|2643546_2644428_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|2644621_2646670_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2646689_2647376_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|2647473_2647971_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2648099_2649383_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_164092565.1|2649351_2651985_+	MCE family protein	NA	NA	NA	NA	NA
WP_001531515.1|2652062_2653502_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2653619_2653856_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|2653966_2654158_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986173.1|2654176_2654827_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_001134856.1|2655050_2655215_-	membrane protein	NA	NA	NA	NA	NA
WP_000182071.1|2655499_2656222_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|2656905_2657301_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|2657630_2658107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025515.1|2658479_2658899_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001576019.1|2659271_2659541_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001576018.1|2659706_2659847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2662985_2663900_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2664032_2664191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|2664200_2664815_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000951652.1|2665302_2665449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|2665949_2666075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012543349.1|2666644_2666845_+	phage encoded PagK	NA	NA	NA	NA	NA
WP_001687735.1|2666941_2667442_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_000348541.1|2669546_2670038_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_001576014.1|2670092_2670281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2670345_2670513_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|2670769_2671303_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_001013467.1|2671356_2671587_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_077681935.1|2671776_2672271_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
WP_000622159.1|2672914_2673184_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	47.8	2.7e-11
2673311:2673340	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_001536069.1|2674128_2674929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|2675408_2676131_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001152416.1|2680185_2680881_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2680970_2681504_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2682398_2682878_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2682895_2683348_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2683331_2683661_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2683936_2684623_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2684983_2685433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2685806_2686331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2686427_2687117_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2687246_2687474_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2687470_2688070_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|2688133_2688439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2689070_2691050_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2691463_2691742_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2691716_2692796_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2692932:2692961	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP050712	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 chromosome, complete genome	4679142	2865187	2905885	4679142	tail,protease	Salmonella_phage(28.57%)	40	NA	NA
WP_000938186.1|2865187_2865868_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2866486_2867146_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2867232_2867562_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2867558_2867840_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2867888_2868668_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2868693_2869242_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2869456_2870668_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2870725_2871043_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001676378.1|2871087_2871501_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2871674_2872337_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2872431_2872890_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2872925_2874980_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2875103_2875550_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2875568_2877722_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_066038538.1|2877708_2878314_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2878530_2879040_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2879396_2880449_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2880520_2880973_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2881158_2882919_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2882987_2883506_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2883605_2883773_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2884028_2884592_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2884588_2886229_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2886233_2887487_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2887501_2889409_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2889421_2891530_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2891628_2892738_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2892734_2893277_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2893442_2894453_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2894660_2897273_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2897699_2897891_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2898161_2898848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2899207_2899834_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2900481_2901450_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2901675_2901924_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2901927_2902509_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2902508_2904218_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2904214_2904841_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2904824_2905454_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|2905474_2905885_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 8
NZ_CP050712	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 chromosome, complete genome	4679142	2977164	2984477	4679142	integrase,protease	Ralstonia_phage(16.67%)	7	2971961:2971975	2983213:2983227
2971961:2971975	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2977164_2977542_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2977703_2977901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2978113_2980390_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2980420_2980741_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2981064_2981286_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2981415_2983362_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2983213:2983227	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2983358_2984477_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP050713	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence	106652	2413	49796	106652	transposase,integrase	Escherichia_phage(46.67%)	49	19101:19160	46213:47034
WP_072648941.1|2413_3613_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|3622_3811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557619.1|4230_4488_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|4420_4822_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|6132_6837_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|7853_8558_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|10454_11459_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|11640_11817_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|12146_12962_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|13022_13826_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|13825_14662_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_058914914.1|14967_15213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001493764.1|15241_15892_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032153701.1|15997_17197_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000743213.1|17562_17787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|17783_18521_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|19006_19147_-	hypothetical protein	NA	NA	NA	NA	NA
19101:19160	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|19152_19857_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063865358.1|20239_21415_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA2	NA	NA	NA	NA	NA
WP_058914901.1|21438_24591_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_000888203.1|24660_25140_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|25228_25933_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000572405.1|26239_27034_-	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
WP_000957857.1|28612_28801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072648941.1|28810_30010_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_024129958.1|30495_30849_-	DNA distortion protein 3	NA	NA	NA	NA	NA
WP_001074384.1|30985_31432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435064.1|31435_32278_-	replication initiation protein	NA	NA	NA	NA	NA
WP_024129959.1|32298_33138_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000121743.1|34372_34624_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000220561.1|34613_34895_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
WP_072648941.1|35391_36591_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|36600_36789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|37018_37123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|37251_37509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|37566_38343_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|38339_39083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|39133_39484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246635.1|40163_41159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991830.1|41162_42095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|42198_42903_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_049824851.1|42912_43383_+	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_014839978.1|43402_44191_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014839979.1|44190_44709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|44713_45130_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|45515_46220_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013023839.1|47271_47748_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
46213:47034	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGTGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCTGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCA	NA	NA	NA	NA
WP_015387340.1|47794_48670_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001067858.1|49091_49796_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
NZ_CP050714	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-2, complete sequence	59372	0	1905	59372		Stx_converting_phage(100.0%)	2	NA	NA
WP_015059604.1|1304_1466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751876.1|1518_1905_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	46.9	3.0e-27
>prophage 2
NZ_CP050714	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-2, complete sequence	59372	11473	12031	59372		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000725064.1|11473_12031_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	37.4	5.8e-24
>prophage 3
NZ_CP050714	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-2, complete sequence	59372	29215	36123	59372	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925628.1|29215_29638_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|29637_30912_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000064277.1|30993_31968_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	5.1e-84
WP_000427676.1|31967_33173_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|33587_34529_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|34525_35131_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|35187_35523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|35706_36123_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
>prophage 4
NZ_CP050714	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-2, complete sequence	59372	39671	40232	59372		Ralstonia_phage(100.0%)	1	NA	NA
WP_001240330.1|39671_40232_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
>prophage 5
NZ_CP050714	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-2, complete sequence	59372	45738	45903	59372		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|45738_45903_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 6
NZ_CP050714	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-2, complete sequence	59372	50845	51678	59372	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_000064919.1|50845_51271_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
WP_001541541.1|51327_51678_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 7
NZ_CP050714	Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-2, complete sequence	59372	54738	55521	59372	integrase	Macacine_betaherpesvirus(100.0%)	1	51013:51024	57721:57732
51013:51024	attL	TATTTACCATCA	NA	NA	NA	NA
WP_000082169.1|54738_55521_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_000082169.1|54738_55521_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
57721:57732	attR	TGATGGTAAATA	NA	NA	NA	NA
