The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050750	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 chromosome, complete genome	4994712	662628	700571	4994712	tail,holin,head,portal,integrase,capsid,terminase	Cronobacter_phage(72.22%)	44	662779:662794	695629:695644
WP_000478472.1|662628_664194_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
662779:662794	attL	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000983441.1|664190_664838_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213760.1|665069_665837_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|666094_667876_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|667865_668903_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568372.1|668906_669473_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_000514631.1|669489_670071_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|670214_670436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|670466_670970_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|670979_671207_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|671196_671622_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|671621_672023_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|672090_672324_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|672314_673175_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|673171_675193_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000353141.1|675312_675519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|675492_675816_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|675812_676874_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|676870_678646_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|678806_679610_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|679671_680694_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|680697_681399_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000447487.1|681459_681948_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_000084218.1|681944_682451_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|682447_683155_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|683151_684279_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|684275_684731_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|684740_685034_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|685030_685372_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|685371_685704_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_001670161.1|685675_685864_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000411339.1|685850_686108_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|686295_688266_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|688262_688592_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|688588_689773_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|689765_690353_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|690362_692597_+|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|692609_693164_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|693153_693879_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|693850_694396_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_001680744.1|694398_696099_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
695629:695644	attR	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000340945.1|697467_697770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|698093_698600_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|698723_700571_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 2
NZ_CP050750	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 chromosome, complete genome	4994712	1160211	1188287	4994712	transposase	Escherichia_phage(36.36%)	30	NA	NA
WP_001067855.1|1160211_1160916_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000173534.1|1161892_1162408_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	7.1e-08
WP_005046389.1|1162413_1163337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250919.1|1163392_1164172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000429174.1|1164519_1164819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|1165809_1167018_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|1167383_1168589_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|1169032_1169353_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|1169345_1169732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447544.1|1169739_1170426_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|1170403_1171027_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|1171108_1172314_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000429836.1|1173597_1174032_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|1174103_1174454_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732293.1|1174467_1174743_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|1174778_1175201_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|1175252_1176947_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|1176964_1177327_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|1177323_1177560_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|1177595_1178264_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|1179640_1180345_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|1181100_1181952_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|1182259_1183075_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|1183135_1183939_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1183938_1184775_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|1184835_1185540_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|1185586_1185988_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|1186137_1186998_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001403349.1|1187180_1187606_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.7e-53
WP_001067855.1|1187582_1188287_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_CP050750	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 chromosome, complete genome	4994712	1280008	1355400	4994712	protease,tail,holin,lysis,head,transposase,portal,integrase,capsid,terminase,tRNA	Salmonella_phage(43.1%)	87	1272089:1272105	1361247:1361263
1272089:1272105	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1280008_1281046_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1281161_1281851_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1282169_1282553_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1282614_1283202_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1283304_1284204_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1284221_1285556_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1285686_1286424_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1286408_1288031_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1288294_1288459_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1288455_1289031_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1289062_1289713_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1289712_1290669_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1290665_1291145_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1291642_1292872_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1292849_1293134_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1293174_1293414_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1293456_1294614_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1294576_1297504_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1297630_1297981_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1298002_1298161_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|1298559_1298964_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1299093_1299330_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1299295_1299670_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1299754_1300738_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1300740_1301490_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1301500_1301848_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1301844_1302369_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1302368_1302842_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_001217666.1|1303706_1303946_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_001804676.1|1304001_1304241_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	5.9e-42
WP_000929803.1|1304280_1304883_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1305091_1305703_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1305699_1305840_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1305836_1306514_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1306786_1307350_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1307856_1308045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1308259_1308946_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1309221_1309551_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|1309534_1309987_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|1310004_1310457_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1310692_1311094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1311380_1311926_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1311897_1313829_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1313812_1314016_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1314012_1315593_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1315582_1317079_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1317091_1317439_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1317493_1318522_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1318579_1318939_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1318949_1319333_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1319360_1319939_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1319987_1321118_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1321226_1321628_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_077248250.1|1321635_1322382_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|1322432_1322828_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1322824_1323163_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1323134_1326230_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1326232_1326562_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1326571_1327270_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1327276_1328014_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1327911_1328559_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1328620_1331983_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1332021_1332264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1332317_1334690_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1334686_1335511_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1335500_1336079_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1336175_1336403_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1336509_1336722_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1337474_1337594_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1338306_1338444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1338922_1340416_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1340820_1342620_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1342636_1343611_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1343884_1344565_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1344561_1345467_+	GTPase Era	NA	NA	NA	NA	NA
WP_033567169.1|1345478_1346207_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1346218_1346950_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1346949_1347330_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1347441_1347702_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1347739_1348666_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1348781_1349978_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684027.1|1349999_1350917_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1350955_1351804_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1351919_1352813_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1352823_1354185_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1354188_1354824_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1354848_1355400_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1361247:1361263	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 4
NZ_CP050750	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 chromosome, complete genome	4994712	1709548	1739141	4994712	protease,tail,holin	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1709548_1710043_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1710456_1710948_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1710937_1711201_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1711197_1713684_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1713690_1714386_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1714372_1715242_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1715357_1715807_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1715816_1716419_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_167810335.1|1716439_1717057_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.1e-10
WP_000990028.1|1717053_1717713_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1717764_1718502_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1718498_1718711_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1718707_1719187_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1719183_1721115_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1721111_1721669_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_033572444.1|1721665_1722709_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1722752_1723400_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1724129_1724693_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1724884_1725088_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1725390_1726182_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1726478_1726682_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1726850_1729217_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1729545_1730535_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1730549_1730918_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1730946_1732278_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1732574_1732904_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1733496_1734738_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1734740_1735268_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1735645_1736089_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1736142_1737972_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1738319_1738610_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1738637_1739141_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 5
NZ_CP050750	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 chromosome, complete genome	4994712	1811193	1820364	4994712	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1811193_1812141_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1812124_1812856_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1812836_1812944_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1813003_1813735_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1813957_1815643_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1815639_1816359_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1816405_1816873_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1816929_1817460_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1817631_1818090_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1818330_1820364_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP050750	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 chromosome, complete genome	4994712	1888675	1899181	4994712		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1888675_1890079_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1890256_1891150_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1891526_1892612_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1892611_1893511_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1893558_1894437_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1894437_1894989_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1894994_1895987_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1895983_1896757_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1896761_1897841_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1897867_1899181_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
NZ_CP050750	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 chromosome, complete genome	4994712	1985175	2035862	4994712	protease,tail,holin,head,portal,plate,integrase,capsid,terminase	Salmonella_phage(81.54%)	70	1979753:1979767	1995883:1995897
1979753:1979767	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1985175_1985649_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_000598920.1|1986958_1987756_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1988047_1989037_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|1989038_1989266_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061334.1|1989305_1989875_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|1989878_1990460_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|1990470_1990728_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|1990729_1991263_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|1991333_1991873_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|1992009_1992837_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_167803842.1|1992894_1993266_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	99.2	7.2e-63
WP_023891434.1|1993805_1994030_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|1993992_1994331_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|1994536_1995232_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1995329_1995554_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1995582_1996137_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1995883:1995897	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087404.1|1996133_1997276_+	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|1997272_1997497_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_033567233.1|1997493_1998468_+	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000054228.1|1998464_1998938_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567232.1|1998934_1999810_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000779148.1|1999818_2000208_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061452.1|2000224_2001085_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_070793644.1|2001092_2002082_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_020899401.1|2002095_2002848_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|2002998_2003256_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|2003401_2003788_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|2003774_2004056_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|2004055_2004670_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|2004666_2005059_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001005132.1|2005299_2005854_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	4.5e-101
WP_001135098.1|2005904_2006255_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|2006380_2006875_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_033567282.1|2006871_2008605_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000605609.1|2008616_2008799_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466255.1|2008798_2010040_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_033567207.1|2010017_2010668_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_033572441.1|2010682_2011888_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033572442.1|2011937_2012138_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_000927721.1|2012140_2012464_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033567256.1|2012460_2012865_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_033567257.1|2012836_2013349_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_000779213.1|2013345_2013903_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_065305283.1|2013924_2014089_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_033567258.1|2014078_2015575_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515953.1|2015574_2015931_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|2015927_2016254_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|2016338_2018264_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|2018280_2018730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033567259.1|2018789_2020130_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001066632.1|2020126_2021185_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|2021184_2021718_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|2021722_2022136_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|2022128_2023208_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|2023210_2023798_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|2023784_2025347_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_022742744.1|2025316_2025922_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|2026035_2026269_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|2026343_2026457_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|2026504_2026918_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|2026914_2027127_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|2028320_2028482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|2028608_2029028_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2029030_2030299_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2030753_2030966_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2030976_2031165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2031425_2032622_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2033271_2033571_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2033662_2034358_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2034431_2035862_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP050750	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 chromosome, complete genome	4994712	2139906	2146715	4994712	tail,integrase	Salmonella_phage(33.33%)	11	2142116:2142138	2151831:2151853
WP_000856224.1|2139906_2140137_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2140274_2140649_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2140649_2141525_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2141541_2141895_+	YebY family protein	NA	NA	NA	NA	NA
2142116:2142138	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2142268_2143123_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2143182_2143677_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2143866_2144097_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2144150_2144684_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2144940_2145108_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2145172_2145361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2145833_2146715_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2151831:2151853	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 9
NZ_CP050750	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 chromosome, complete genome	4994712	2933614	3024531	4994712	protease,tail,holin,lysis,integrase,terminase,tRNA	Salmonella_phage(58.7%)	91	2957708:2957727	3021604:3021623
WP_000938191.1|2933614_2934295_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2934915_2935575_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2935661_2935991_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2935987_2936269_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2936317_2937097_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2937122_2937671_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2937885_2939097_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2939154_2939472_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2939516_2939930_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2940103_2940766_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2940860_2941319_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2941354_2943409_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2943532_2943979_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2943997_2946151_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2946137_2946743_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2946959_2947469_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2947825_2948878_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2948949_2949402_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2949587_2951348_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2951416_2951935_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2952034_2952202_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_033567177.1|2952457_2953021_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2953017_2954658_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2954662_2955916_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2955930_2957838_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2957708:2957727	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2957850_2959959_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_167803837.1|2960057_2961167_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2961163_2961706_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2961871_2962882_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2963089_2965702_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2966128_2966320_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2966590_2967277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|2967261_2967561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2967629_2968256_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2968903_2969872_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|2970347_2970929_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|2970928_2973367_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|2973420_2973663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541993.1|2973701_2974577_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001576012.1|2977123_2977828_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|2977725_2978463_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2978472_2979168_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2979257_2979791_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2979907_2980405_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|2980504_2980837_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|2981957_2982503_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|2982971_2983418_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000984584.1|2983435_2983888_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|2983871_2984201_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_001141973.1|2984476_2985163_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2985523_2985973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2986108_2986234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097242.1|2986428_2987118_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_000801757.1|2987114_2987255_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|2987251_2987863_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|2988071_2988674_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|2988758_2988980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|2989089_2989323_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|2989914_2990511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|2990522_2991500_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|2991554_2991812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|2991811_2992456_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|2992459_2992768_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|2992771_2993230_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_020899441.1|2993226_2993574_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000800012.1|2993584_2994334_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062943.1|2994336_2995320_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|2995404_2995725_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|2995759_2995987_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|2996092_2996527_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|2996823_2996955_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|2997003_2997354_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_136614733.1|2997480_3000681_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	78.6	0.0e+00
WP_014344386.1|3000643_3001801_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|3001843_3002083_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3002123_3002372_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|3002416_3003709_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000191399.1|3003903_3005106_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|3005183_3006620_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|3006864_3008079_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3008395_3008857_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3009057_3010458_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|3011064_3012156_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|3012340_3013531_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|3013592_3014240_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|3014267_3014816_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|3015075_3016917_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|3017261_3021728_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
3021604:3021623	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|3021727_3022432_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3022412_3023735_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|3023727_3024531_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP050750	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 chromosome, complete genome	4994712	3074594	3083326	4994712	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3074594_3075849_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3076312_3076771_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3076962_3079239_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3079269_3079590_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3079913_3080135_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3080264_3082211_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3082207_3083326_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 11
NZ_CP050750	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 chromosome, complete genome	4994712	3691965	3737540	4994712	protease,lysis,portal,coat,integrase,terminase	Salmonella_phage(56.92%)	66	3683371:3683387	3746754:3746770
3683371:3683387	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_000915528.1|3691965_3692328_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3692324_3693257_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3693246_3694704_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129928.1|3694762_3696766_-	endorhamnosidase	NA	E7C9U9	Salmonella_phage	100.0	0.0e+00
WP_000532175.1|3696901_3697153_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
WP_001085430.1|3697252_3697432_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000757527.1|3697445_3697811_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_000889769.1|3697841_3698171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262317.1|3698188_3700102_-	hypothetical protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
WP_033572424.1|3700101_3701385_-	phage DNA ejection protein	NA	E7C9U5	Salmonella_phage	94.7	4.5e-221
WP_000964900.1|3701395_3702085_-	hypothetical protein	NA	E7C9U4	Salmonella_phage	100.0	4.3e-109
WP_000627695.1|3702087_3702543_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
WP_022631116.1|3702542_3703244_-	hypothetical protein	NA	B8K1I3	Salmonella_phage	98.7	1.8e-70
WP_033572423.1|3703247_3704666_-	Packaged DNA stabilization protein gp10	NA	A0A220NQZ5	Salmonella_phage	99.6	5.4e-276
WP_001166093.1|3704625_3705126_-	packaged DNA stabilization protein p27	NA	E7C9U0	Salmonella_phage	100.0	2.5e-90
WP_000538674.1|3705109_3705670_-	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_022630931.1|3705710_3707003_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.5	1.2e-242
WP_006831698.1|3707002_3707914_-	scaffolding protein	NA	Q5C834	Enterobacteria_phage	100.0	1.7e-161
WP_000774652.1|3707927_3710105_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000417860.1|3710104_3711604_-|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000729923.1|3711581_3712070_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3712073_3712478_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3712477_3712867_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3712870_3713113_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_015995148.1|3713335_3713866_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	100.0	1.3e-94
WP_001687043.1|3714078_3714546_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3714542_3715040_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3715017_3715221_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_033572422.1|3715757_3716531_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	96.5	1.2e-128
WP_023217800.1|3716688_3716931_-	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	92.5	1.3e-36
WP_033572421.1|3716927_3717110_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	95.0	3.6e-23
WP_023250727.1|3717097_3717568_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	99.4	8.8e-90
WP_023250726.1|3717548_3717785_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	97.4	3.9e-38
WP_033572420.1|3717777_3717954_-	protein ninF	NA	A0A192Y808	Salmonella_phage	91.4	6.9e-24
WP_033572419.1|3717946_3718348_-	hypothetical protein	NA	G9L690	Escherichia_phage	85.7	2.7e-63
WP_000113767.1|3718350_3718527_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	98.3	7.9e-28
WP_000679699.1|3718493_3718667_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
WP_001573980.1|3718663_3719536_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
WP_000736920.1|3719532_3719973_-	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	2.9e-79
WP_001248409.1|3720046_3721423_-	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
WP_000067076.1|3721419_3722253_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	99.6	2.4e-151
WP_001125981.1|3722245_3722392_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3722426_3722708_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000067726.1|3722818_3723034_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_023135942.1|3723152_3723815_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	100.0	1.7e-126
WP_033572418.1|3724166_3724469_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	97.0	6.3e-49
WP_033572417.1|3724481_3725069_-	superinfection exclusion protein B	NA	A0A0M4R594	Salmonella_phage	99.0	6.2e-85
WP_033572416.1|3725261_3725762_+	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.5	1.2e-31
WP_033572415.1|3725795_3726083_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	97.9	1.1e-47
WP_000141641.1|3726417_3726576_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|3726556_3726745_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902090.1|3726734_3726878_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	97.9	9.3e-19
WP_033572414.1|3726874_3727582_+	recombinase	NA	A0A1R3Y600	Salmonella_virus	98.7	2.9e-137
WP_001253476.1|3727581_3727866_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111312.1|3727912_3728206_+	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_001214769.1|3728216_3728387_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	94.6	5.7e-23
WP_050517928.1|3728383_3728908_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	96.9	4.2e-48
WP_033572413.1|3728904_3729810_+	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	95.4	5.3e-51
WP_033572412.1|3729811_3730030_+	DUF4014 family protein	NA	C6ZR28	Salmonella_phage	98.6	3.7e-35
WP_033572411.1|3730033_3730705_+	DUF550 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	64.6	5.6e-90
WP_001277764.1|3731331_3731511_+	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	100.0	1.9e-29
WP_033572425.1|3731611_3732241_+	DUF5420 family protein	NA	A0A220NQT7	Salmonella_phage	96.7	7.3e-116
WP_033572410.1|3732470_3733634_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	99.5	5.3e-229
WP_000893231.1|3733839_3735090_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3735101_3736205_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3736487_3737540_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3746754:3746770	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 12
NZ_CP050750	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 chromosome, complete genome	4994712	4574970	4622014	4994712	tail,plate,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4574970_4575969_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4576056_4577367_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4577613_4578129_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4578227_4578437_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4578458_4578572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4578568_4579894_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4580072_4580681_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4580789_4581158_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4581328_4583749_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4583847_4584720_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4584733_4585231_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4585411_4586329_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4586492_4587851_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4587939_4589049_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4589410_4590601_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4590732_4592277_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4592291_4593182_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4593347_4593758_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4593900_4595997_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4595996_4596734_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_125572646.1|4596730_4597399_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4597432_4597675_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4598118_4599768_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4600112_4601462_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4601594_4601942_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4602517_4602805_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4602807_4603413_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4603425_4603740_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4603899_4604355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4604351_4604549_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4604538_4605966_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4605965_4606490_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4606541_4606859_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4606818_4606947_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4607043_4609398_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4609397_4610351_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4610350_4610560_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4610547_4611591_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4611600_4612323_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4612650_4613013_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4613009_4613939_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4613938_4615486_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4615649_4616009_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4615999_4617115_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4617107_4617740_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4617742_4619488_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4619492_4620098_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4620094_4620550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4620798_4621089_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4621285_4622014_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP050751	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 plasmid pST46-1, complete sequence	260225	70596	120644	260225	transposase,protease	Escherichia_phage(26.32%)	56	NA	NA
WP_042634304.1|70596_71676_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|71677_72451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|72443_73586_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|73595_74654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|74977_75559_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|75558_76716_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|76738_77194_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|77216_78257_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|78305_78884_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|78951_79527_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|79955_81197_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|81759_82041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|82090_82282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151575.1|82373_82715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|83087_83480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|84083_84377_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|84381_85707_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|85767_85974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|86075_86486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|86498_87314_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_001043843.1|87567_87993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572440.1|88737_89037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192809.1|89349_91389_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	2.5e-24
WP_001572342.1|91385_92372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194555.1|93402_93606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287392.1|93947_94352_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000175476.1|94849_95086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|95127_95583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|95642_96308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|96365_96746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|97388_98207_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|98203_99409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|99688_101008_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000220758.1|101030_101198_-	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000833382.1|101258_102686_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|102900_103416_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_015059496.1|104536_104770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|105431_105662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|105998_106460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|106489_106897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|106947_107265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|107641_107992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012783960.1|108101_109691_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
WP_001067855.1|109681_110386_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|110503_110707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|110834_111674_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|111667_112015_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|112237_112690_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|112774_113407_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|113544_114375_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|114505_115060_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|115203_115908_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_167803844.1|115966_116491_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	3.8e-49
WP_015344976.1|116493_119445_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|119453_119855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|119939_120644_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
>prophage 2
NZ_CP050751	Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 plasmid pST46-1, complete sequence	260225	124902	163178	260225	integrase,transposase	Escherichia_phage(50.0%)	37	115152:115211	150231:151052
115152:115211	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|124902_125607_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|125667_126504_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|126503_127307_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|127367_128183_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_165488106.1|128370_128742_-	phenol hydroxylase	NA	NA	NA	NA	NA
WP_000602738.1|130666_131419_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|131840_132866_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|133094_133871_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_001067855.1|133984_134689_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000454193.1|134915_135266_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_167803845.1|135468_136482_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.8	2.1e-72
WP_001456218.1|136648_137491_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000050382.1|137586_138195_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|138252_139044_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|139305_140565_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|140657_141449_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|141618_141951_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_109023896.1|142852_143128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|143130_143922_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|144390_144636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|144673_145537_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_088238917.1|145767_146472_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018329.1|146622_147438_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|147627_148332_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001083725.1|148736_149234_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_071523897.1|149390_149636_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|150282_150987_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|151211_151415_-	hypothetical protein	NA	NA	NA	NA	NA
150231:151052	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCG	NA	NA	NA	NA
WP_000259031.1|151542_152382_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_072644484.1|152562_152727_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_063102497.1|155014_155401_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_057109146.1|155720_156113_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_001067858.1|156447_157152_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_002914189.1|157471_158647_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_000347934.1|158670_161823_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_000888203.1|161892_162372_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|162473_163178_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
