The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	0	2265	4745573		Escherichia_phage(100.0%)	1	NA	NA
WP_001610016.1|0_2265_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	96.9	0.0e+00
>prophage 2
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	6282	34500	4745573	tRNA,tail,capsid,plate,head,holin,portal,lysis,terminase	Escherichia_phage(46.88%)	36	NA	NA
WP_001610013.1|6282_7317_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	1.6e-200
WP_001610011.1|7316_9089_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_001297840.1|9262_10117_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	97.9	2.4e-133
WP_001610010.1|10175_11249_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	8.2e-200
WP_001610008.1|11252_11990_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	98.0	2.2e-127
WP_001610007.1|12089_12599_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	1.2e-89
WP_000846399.1|12598_12802_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|12805_13087_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001610005.1|13086_13584_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_001610004.1|13598_14024_+	hypothetical protein	NA	Q858W1	Yersinia_virus	91.5	7.2e-59
WP_000040671.1|14011_14437_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	98.6	6.5e-68
WP_072146842.1|14408_14582_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_001403141.1|14544_15012_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	4.3e-81
WP_001610001.1|15004_15463_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	63.8	1.2e-43
WP_001609999.1|15459_16215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024191601.1|16292_16928_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	7.6e-113
WP_000127163.1|16924_17272_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121474.1|17276_18185_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001285325.1|18177_18708_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_167778693.1|18718_21037_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	67.9	3.1e-212
WP_001609987.1|21040_21568_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	94.3	1.2e-90
WP_032158485.1|21789_22383_+	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.5	4.5e-107
WP_001286716.1|22712_23903_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|23915_24434_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|24490_24766_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|24798_24918_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001609984.1|24910_27358_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.0	0.0e+00
WP_001609983.1|27372_27852_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.1e-84
WP_001609982.1|27851_29015_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	98.4	5.0e-203
WP_000468308.1|29096_29315_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|29587_30949_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001220181.1|31051_31348_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|31349_31646_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|31854_32187_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137869.1|32377_33100_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000675150.1|33096_34500_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 3
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	56160	56367	4745573		Escherichia_phage(100.0%)	1	NA	NA
WP_047086332.1|56160_56367_-	hypothetical protein	NA	A0A1D7XFU5	Escherichia_phage	63.9	2.1e-16
>prophage 4
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	67725	69985	4745573	tail	Salmonella_phage(50.0%)	2	NA	NA
WP_137515880.1|67725_68313_+	hypothetical protein	NA	A0A291LGD5	Salmonella_phage	46.5	2.8e-16
WP_167778696.1|68227_69985_+|tail	tail fiber domain-containing protein	tail	A0A0D4D9I5	Escherichia_phage	42.5	9.2e-100
>prophage 5
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	86899	97375	4745573		Catovirus(20.0%)	9	NA	NA
WP_001295424.1|86899_87541_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|87632_88214_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252335.1|88235_90089_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001300971.1|90362_91946_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_162829205.1|92146_92296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978094.1|92604_93744_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|93749_94193_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_167778700.1|94195_96358_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654503.1|96535_97375_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 6
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	101619	108501	4745573		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|101619_102741_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043606.1|102743_103709_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_001298845.1|103711_104191_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699721.1|104187_105411_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079291.1|105413_106850_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.0	3.7e-46
WP_001387746.1|107130_108501_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.3e-32
>prophage 7
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	114117	127161	4745573		Enterobacteria_phage(22.22%)	13	NA	NA
WP_047660639.1|114117_115512_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	8.3e-19
WP_000999466.1|115669_116665_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183060.1|116907_117801_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_062893804.1|118173_119259_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	8.8e-101
WP_116986961.1|119258_120158_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	2.2e-28
WP_116986960.1|120215_121103_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.1e-106
WP_063114864.1|121176_121578_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_167778702.1|121579_122527_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_167778703.1|122519_123143_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_116986957.1|123338_123884_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.3	9.6e-48
WP_116986956.1|123939_125046_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.4	7.7e-44
WP_116986955.1|125042_126320_+	O-antigen translocase	NA	NA	NA	NA	NA
WP_167778704.1|126297_127161_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	23.1	1.2e-07
>prophage 8
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	130272	133094	4745573		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_075631240.1|130272_131679_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_116986952.1|131927_133094_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.7	1.1e-114
>prophage 9
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	141797	142697	4745573		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|141797_142697_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 10
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	150341	151508	4745573		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001296209.1|150341_151508_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 11
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	170274	171084	4745573		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000035.1|170274_171084_+	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.1	2.6e-09
>prophage 12
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	196118	196649	4745573		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|196118_196649_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 13
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	200193	212617	4745573		Bacillus_phage(28.57%)	12	NA	NA
WP_001339045.1|200193_200865_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826770.1|200864_202223_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_167778706.1|202330_203182_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824355.1|203773_204889_-	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.7	1.0e-91
WP_001313057.1|205455_205821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365545.1|205860_206556_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	1.1e-06
WP_071678563.1|206622_208041_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786004.1|208021_208492_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212238.1|208480_209401_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|209573_210491_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|210569_210752_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001389132.1|210922_212617_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 14
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	229845	231765	4745573	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_061892850.1|229845_231054_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	2.7e-207
WP_000334568.1|231093_231765_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	1.6e-81
>prophage 15
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	243580	244333	4745573		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|243580_244333_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 16
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	256320	257835	4745573		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187810.1|256320_257835_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 17
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	267922	273566	4745573		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001297437.1|267922_269584_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000483220.1|269629_271231_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_000204335.1|271249_272110_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036378.1|272112_273162_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|273176_273566_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 18
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	278818	280552	4745573	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|278818_280552_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 19
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	288447	290498	4745573		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019584.1|288447_289191_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|289231_289627_-	membrane protein	NA	NA	NA	NA	NA
WP_000639271.1|289679_290498_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.9e-72
>prophage 20
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	294516	301580	4745573		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|294516_295038_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024917.1|295039_295642_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|295712_295778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|295916_296528_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|296536_297547_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|297693_298479_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|298475_299231_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|299309_300242_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|300257_301580_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 21
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	305578	307054	4745573		Cyanophage(100.0%)	1	NA	NA
WP_000301730.1|305578_307054_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	5.8e-79
>prophage 22
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	315110	319580	4745573		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|315110_315773_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011652.1|315796_316453_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|316554_316785_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|316923_317298_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879285.1|317301_318174_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|318186_318528_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812734.1|318923_319580_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	4.7e-57
>prophage 23
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	327076	329125	4745573		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|327076_329125_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 24
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	334455	334665	4745573		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|334455_334665_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 25
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	340304	341861	4745573		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|340304_341861_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 26
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	345723	353830	4745573	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854972.1|345723_347085_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|347158_347338_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|347457_347817_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|348179_348524_-	RidA family protein	NA	NA	NA	NA	NA
WP_167778708.1|348655_350566_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.4	4.5e-92
WP_001220979.1|350623_351319_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000268230.1|351358_351940_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|352144_353830_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 27
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	362203	364382	4745573	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_001349736.1|362203_363166_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	1.8e-41
WP_167778710.1|363173_364382_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.3	2.8e-204
>prophage 28
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	370332	374909	4745573		Bacillus_phage(100.0%)	3	NA	NA
WP_001295489.1|370332_371823_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
WP_000616433.1|372003_373479_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|373625_374909_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 29
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	378227	379082	4745573		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|378227_379082_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 30
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	382325	382967	4745573		Tupanvirus(100.0%)	1	NA	NA
WP_001135062.1|382325_382967_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 31
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	387893	389855	4745573		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|387893_389855_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 32
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	395453	396107	4745573		Bacillus_phage(100.0%)	1	NA	NA
WP_000882826.1|395453_396107_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.7	3.3e-10
>prophage 33
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	402870	404091	4745573		Klosneuvirus(100.0%)	1	NA	NA
WP_000082041.1|402870_404091_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.5e-27
>prophage 34
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	411567	412395	4745573		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|411567_412395_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 35
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	418522	420784	4745573		Tupanvirus(100.0%)	1	NA	NA
WP_000077870.1|418522_420784_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.2e-144
>prophage 36
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	432083	451623	4745573	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144192.1|432083_434012_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|434015_434558_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|434654_434852_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|434904_435261_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|435383_435428_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|435711_436695_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672359.1|436709_439097_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|439101_439401_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956529.1|439501_440482_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|440544_441096_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|441095_441845_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209780.1|441922_442387_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001315654.1|442633_443347_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_167778713.1|443409_444846_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|444849_445041_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|445172_446219_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|446375_447209_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_167778714.1|447541_449920_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	7.9e-171
WP_001356268.1|449976_451623_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	7.7e-32
>prophage 37
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	470268	475352	4745573		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|470268_470637_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_001297388.1|470645_472133_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948855.1|472142_472889_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_000908012.1|472863_474135_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144602.1|474131_475352_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	2.6e-93
>prophage 38
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	483642	485909	4745573		Escherichia_phage(50.0%)	3	NA	NA
WP_001349911.1|483642_484311_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001088967.1|484307_485093_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587552.1|485096_485909_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 39
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	491413	500205	4745573		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|491413_492055_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098911.1|492094_493243_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_001182363.1|493533_494745_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|494857_495790_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|495786_496812_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|497110_497200_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|497365_498535_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|498680_499262_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|499389_500205_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 40
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	509008	510507	4745573		Indivirus(50.0%)	2	NA	NA
WP_000250661.1|509008_509905_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
WP_001296937.1|509985_510507_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 41
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	517418	518693	4745573	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|517418_518693_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 42
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	538479	540291	4745573		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945924.1|538479_540291_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 43
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	550186	551488	4745573		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|550186_551488_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 44
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	569249	584687	4745573		Escherichia_phage(44.44%)	15	NA	NA
WP_000148710.1|569249_569864_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|569906_570761_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|570762_571380_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|571390_573814_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_167778718.1|573874_576301_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	5.0e-213
WP_001295396.1|576499_576805_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|576912_577623_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|577625_578186_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|578220_578562_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|578696_579023_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|579228_580443_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|580454_581474_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_000151243.1|581531_582899_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527797.1|582987_584448_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000214712.1|584483_584687_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 45
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	590053	590944	4745573		Bacillus_phage(100.0%)	1	NA	NA
WP_000592826.1|590053_590944_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 46
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	600194	600578	4745573		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|600194_600578_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 47
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	608323	609742	4745573		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|608323_609742_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 48
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	617623	619159	4745573		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194889.1|617623_619159_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
>prophage 49
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	644569	651505	4745573		Bacillus_phage(50.0%)	3	NA	NA
WP_001296749.1|644569_646255_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.5	1.7e-10
WP_000832440.1|646292_648665_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001307214.1|648709_651505_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
>prophage 50
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	656779	660586	4745573		Bacillus_virus(50.0%)	2	NA	NA
WP_000426261.1|656779_658162_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001307211.1|658186_660586_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 51
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	664902	666808	4745573		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193563.1|664902_665889_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	3.2e-17
WP_000072429.1|665881_666808_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-13
>prophage 52
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	670082	671524	4745573		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|670082_671093_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|671239_671524_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 53
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	677536	677827	4745573		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001295648.1|677536_677827_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.7e-25
>prophage 54
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	684712	686257	4745573		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|684712_686257_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 55
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	692061	705553	4745573	transposase	uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_167778722.1|692061_696324_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
WP_071524591.1|696404_696647_-	DUF3969 family protein	NA	NA	NA	NA	NA
WP_000960005.1|696864_697317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126716684.1|697346_698255_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001001073.1|698762_698972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065225630.1|699169_703378_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
WP_065225629.1|703444_705553_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	2.8e-26
>prophage 56
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	710462	712565	4745573		Salmonella_phage(100.0%)	1	NA	NA
WP_000689355.1|710462_712565_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 57
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	716833	717643	4745573		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|716833_717643_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 58
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	721024	731198	4745573	transposase	Mycoplasma_phage(20.0%)	10	NA	NA
WP_000220396.1|721024_722038_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047456.1|722055_723201_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760592.1|723445_724852_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|724930_725347_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|725392_725569_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|725790_726021_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001593323.1|726112_728074_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.6	1.2e-23
WP_000429155.1|728146_728683_-	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001348055.1|728735_729950_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_001372110.1|729989_731198_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	4.9e-209
>prophage 59
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	742709	745055	4745573	transposase	Mannheimia_phage(33.33%)	4	NA	NA
WP_001569797.1|742709_743816_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.1e-08
WP_001320773.1|743885_744035_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|744106_744280_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|744524_745055_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 60
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	748994	752897	4745573		Klosneuvirus(100.0%)	1	NA	NA
WP_000139614.1|748994_752897_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 61
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	784183	785173	4745573		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|784183_785173_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 62
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	790132	797402	4745573	tRNA	Enterobacteria_phage(20.0%)	7	NA	NA
WP_000837924.1|790132_791266_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|791406_791841_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000081418.1|792016_792952_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_000123738.1|793080_794454_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001296046.1|794483_794657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|794931_795915_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001307164.1|796169_797402_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 63
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	803727	804243	4745573		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945013.1|803727_804243_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.8e-24
>prophage 64
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	822423	823506	4745573		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|822423_823506_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 65
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	837509	838775	4745573		Klosneuvirus(100.0%)	1	NA	NA
WP_000069226.1|837509_838775_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
>prophage 66
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	851690	857350	4745573		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|851690_852497_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968857.1|852564_852918_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|853287_854076_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_167778726.1|854220_855348_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484982.1|855415_857350_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 67
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	865165	865756	4745573		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|865165_865756_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 68
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	870680	947206	4745573	tail,transposase,capsid,plate,holin,protease,integrase,terminase,portal,head	Enterobacteria_phage(25.53%)	87	888772:888786	945728:945742
WP_001297122.1|870680_873278_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|873657_873909_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|873944_874994_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|875213_875972_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_001278904.1|875968_876559_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|876598_877471_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|877571_878192_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001542848.1|878188_879070_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|879207_879252_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_167778728.1|879343_880906_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|880905_882501_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|882504_883863_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|883874_885068_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|885067_885874_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|886254_886434_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|886519_887020_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079504.1|887065_887572_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_167778729.1|888219_888780_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	3.2e-54
888772:888786	attL	CAGCTTTAGCAGATA	NA	NA	NA	NA
WP_096844825.1|889397_890186_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_167778730.1|890425_890965_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	42.1	3.9e-33
WP_089578468.1|890974_891766_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	55.8	2.6e-17
WP_167778731.1|891812_896144_-	leucine-rich repeat protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	33.0	3.5e-15
WP_063079846.1|896152_897307_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	32.2	6.4e-33
WP_049595185.1|897308_897746_-	hypothetical protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	41.6	4.3e-22
WP_049595184.1|897747_898329_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	33.3	1.6e-16
WP_049595183.1|898325_899414_-	hypothetical protein	NA	Q8SBG7	Shigella_phage	31.7	7.3e-39
WP_063079844.1|899410_900817_-	multidrug DMT transporter permease	NA	J7FAD8	Agrobacterium_phage	33.0	4.0e-05
WP_115203063.1|900827_902786_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	42.8	2.5e-21
WP_049595180.1|902921_903200_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_096093789.1|903202_903568_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_167778732.1|903607_905110_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	43.7	1.7e-102
WP_000497760.1|905106_905343_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_096093785.1|905356_905917_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_167778733.1|905916_906249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000146203.1|906232_906418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290410.1|906419_907475_-|capsid	major capsid protein	capsid	A0A2D1GMR5	Marinobacter_phage	31.5	9.6e-36
WP_000109150.1|907530_907932_-|head	head decoration protein	head	NA	NA	NA	NA
WP_097427312.1|907931_908510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063079839.1|908502_909363_-	S49 family peptidase	NA	A0A2H4PRE9	Proteus_phage	46.4	1.4e-48
WP_089641351.1|909359_911000_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	37.5	7.1e-94
WP_000981815.1|911008_911260_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_167778734.1|911256_913236_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	45.1	1.0e-134
WP_167778735.1|913189_913807_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_063079834.1|914566_915232_-	hypothetical protein	NA	G8EY51	Synechococcus_phage	30.2	4.5e-07
WP_167778840.1|915291_915588_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	93.9	1.1e-48
WP_137466182.1|915762_915945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049595171.1|915959_916337_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	99.2	3.5e-65
WP_167778736.1|916339_916615_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	94.5	4.0e-42
WP_167778737.1|916604_916997_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	85.4	4.1e-48
WP_167778738.1|918496_919543_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.3	1.1e-185
WP_000917767.1|919693_919891_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_049595169.1|920176_920995_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_077793029.1|921145_921517_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.7	8.8e-53
WP_167778739.1|921506_921878_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	9.2e-34
WP_049595167.1|921890_922940_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	7.9e-107
WP_049595214.1|922941_923214_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	4.7e-11
WP_064757999.1|923400_923733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|923829_923985_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_049595164.1|926122_926722_-	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	68.4	9.3e-28
WP_049595163.1|926931_927114_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	91.7	1.1e-24
WP_073533567.1|927209_927665_-	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	48.6	3.9e-34
WP_049595161.1|927651_927957_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.0	1.7e-49
WP_049595212.1|927953_928235_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	63.4	3.1e-26
WP_049595160.1|928273_929020_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	86.4	1.9e-102
WP_049595159.1|929042_929789_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	82.9	1.1e-113
WP_073533565.1|929795_930602_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	89.4	1.5e-65
WP_089578666.1|930672_931098_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_073533564.1|931094_931310_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_073534244.1|931359_932076_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	41.6	3.2e-51
WP_000447543.1|932349_932505_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.1e-08
WP_167778740.1|932506_932653_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	82.5	4.3e-11
WP_157905264.1|932649_932853_-	DUF2622 domain-containing protein	NA	NA	NA	NA	NA
WP_049595150.1|933481_933664_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090191.1|933666_933870_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_049595149.1|933950_936422_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	5.5e-58
WP_000113184.1|936485_936734_+	excisionase	NA	NA	NA	NA	NA
WP_000113656.1|936711_937842_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	5.7e-103
WP_000737219.1|937887_938526_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028540.1|938882_939626_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|939655_940195_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|940299_940698_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000171274.1|940737_941457_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_167778741.1|941547_943068_+	recombinase family protein	NA	NA	NA	NA	NA
WP_167778742.1|943100_943871_-	hypothetical protein	NA	A0A291AY96	Shigella_phage	58.2	6.5e-74
WP_167778743.1|944027_946160_-	tape measure protein	NA	K4HYW1	Escherichia_phage	31.5	4.2e-46
945728:945742	attR	CAGCTTTAGCAGATA	NA	NA	NA	NA
WP_001774388.1|946261_946471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167778744.1|946495_947206_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 69
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	950853	952412	4745573		Yersinia_phage(50.0%)	2	NA	NA
WP_096889795.1|950853_951516_-	DNA methylase	NA	A0A2C9CWW2	Yersinia_phage	33.3	8.5e-06
WP_000996136.1|951860_952412_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	40.9	1.1e-27
>prophage 70
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	957326	959341	4745573		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|957326_958331_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|958327_959341_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 71
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	968755	978766	4745573		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|968755_969373_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|969978_970392_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|970535_971444_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|971645_972659_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001295622.1|972750_973656_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|973768_974227_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|974276_975119_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|975843_976521_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|976520_977231_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|977227_978766_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 72
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	990020	997925	4745573	transposase	Spodoptera_litura_granulovirus(25.0%)	10	NA	NA
WP_001146442.1|990020_990251_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
WP_001295620.1|990520_991621_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_167778748.1|991937_993056_-|transposase	transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.1e-08
WP_000170926.1|993126_993234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170954.1|993661_993769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000811065.1|993917_994772_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|994807_995617_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|995620_996013_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|996009_996843_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|996842_997925_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 73
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1001061	1003813	4745573		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|1001061_1002009_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|1002133_1003813_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 74
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1030573	1032261	4745573		Salmonella_phage(50.0%)	2	NA	NA
WP_000457616.1|1030573_1031842_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_000897378.1|1031841_1032261_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 75
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1040797	1043119	4745573		Escherichia_phage(100.0%)	1	NA	NA
WP_021542089.1|1040797_1043119_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.8	1.5e-89
>prophage 76
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1048986	1052715	4745573		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000332303.1|1048986_1049718_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|1049938_1050343_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|1050395_1050506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|1051038_1051362_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_000444487.1|1051464_1052715_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 77
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1055851	1057222	4745573		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|1055851_1057222_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 78
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1062242	1064220	4745573		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531601.1|1062242_1063379_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799401.1|1063362_1064220_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 79
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1067496	1071219	4745573		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|1067496_1068318_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291270.1|1068333_1069245_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251350.1|1069273_1070518_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|1070517_1071219_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 80
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1078508	1078766	4745573		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1078508_1078766_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 81
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1091098	1092741	4745573		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267920.1|1091098_1092103_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|1092099_1092741_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 82
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1096013	1097195	4745573		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|1096013_1096250_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|1096460_1097195_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 83
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1109553	1110495	4745573		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001323587.1|1109553_1110495_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 84
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1126341	1126587	4745573		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1126341_1126587_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 85
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1131249	1132170	4745573		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1131249_1132170_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 86
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1141478	1142012	4745573		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000845150.1|1141478_1142012_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	1.7e-25
>prophage 87
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1146146	1146980	4745573		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189312.1|1146146_1146980_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 88
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1152215	1154777	4745573	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_085947771.1|1152215_1153377_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000409849.1|1153418_1154777_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
>prophage 89
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1161596	1162520	4745573		Cronobacter_phage(100.0%)	1	NA	NA
WP_001307105.1|1161596_1162520_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 90
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1177297	1179397	4745573		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028095.1|1177297_1177792_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240629.1|1177812_1179141_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	5.3e-233
WP_001273658.1|1179223_1179397_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 91
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1183700	1195955	4745573		Klosneuvirus(20.0%)	13	NA	NA
WP_000420629.1|1183700_1184621_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|1184620_1184926_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209854.1|1185018_1185618_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062102.1|1185614_1188161_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	5.9e-71
WP_001230242.1|1188160_1189333_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|1189462_1190155_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264933.1|1190127_1191156_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001367057.1|1191238_1193983_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000829672.1|1194054_1195128_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1195175_1195349_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001315395.1|1195338_1195569_-	protein YmcE	NA	NA	NA	NA	NA
WP_071528578.1|1195543_1195732_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1195742_1195955_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 92
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1215220	1215880	4745573	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1215220_1215880_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 93
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1220113	1222168	4745573		Bacillus_phage(100.0%)	1	NA	NA
WP_000420533.1|1220113_1222168_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 94
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1234767	1236675	4745573		Tupanvirus(100.0%)	1	NA	NA
WP_000053124.1|1234767_1236675_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	8.3e-54
>prophage 95
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1252597	1264861	4745573	tRNA,transposase	Bacillus_virus(16.67%)	9	NA	NA
WP_001090508.1|1252597_1253365_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193844.1|1253571_1256184_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001297200.1|1256449_1257652_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117889.1|1257820_1259221_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	3.1e-82
WP_000977920.1|1259822_1260911_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|1261095_1262286_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109487.1|1262507_1263155_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001347776.1|1263181_1263730_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	34.7	3.2e-06
WP_001178386.1|1263814_1264861_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	2.9e-08
>prophage 96
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1279536	1284077	4745573		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|1279536_1281285_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705706.1|1281321_1283586_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1283792_1284077_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 97
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1289163	1290252	4745573		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|1289163_1290252_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 98
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1294350	1297565	4745573		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|1294350_1296633_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|1296824_1297565_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 99
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1303875	1327634	4745573	tRNA,protease	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|1303875_1304493_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_167778753.1|1304503_1306948_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|1307186_1308479_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067740.1|1308569_1309913_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_001295343.1|1309923_1310535_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_096926065.1|1310689_1314757_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1314891_1315386_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|1315930_1316896_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|1317018_1318785_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_167778754.1|1318785_1320507_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.2e-21
WP_001241678.1|1320548_1321253_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1321537_1321756_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1322440_1324717_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1324747_1325068_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1325390_1325615_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188193.1|1325687_1327634_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
>prophage 100
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1336893	1338612	4745573		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815350.1|1336893_1338612_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 101
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1342199	1344937	4745573		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255144.1|1342199_1343030_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|1343026_1343350_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|1343475_1343991_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1344208_1344937_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 102
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1348274	1357425	4745573		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149732.1|1348274_1349402_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|1349442_1349931_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|1349990_1350836_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_167778755.1|1350832_1351786_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000995994.1|1351795_1352929_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_000126072.1|1353023_1354136_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1354487_1354964_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1355051_1355954_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189120.1|1356014_1356737_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|1356720_1357008_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|1357167_1357425_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 103
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1365991	1367194	4745573		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1365991_1367194_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 104
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1378529	1380401	4745573		Planktothrix_phage(100.0%)	1	NA	NA
WP_001296993.1|1378529_1380401_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 105
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1383628	1387759	4745573		Synechococcus_phage(50.0%)	3	NA	NA
WP_000424893.1|1383628_1384291_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_001442269.1|1384421_1385321_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209359.1|1385326_1387759_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
>prophage 106
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1391651	1393244	4745573		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|1391651_1393244_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 107
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1398241	1403466	4745573		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|1398241_1398757_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1398809_1398875_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|1399109_1399997_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1400295_1400799_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1401202_1401949_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1402087_1402747_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|1402743_1403466_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 108
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1407006	1421818	4745573		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|1407006_1407267_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_167778757.1|1407531_1409814_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990176.1|1409855_1410533_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|1410606_1410873_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|1411137_1411398_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443536.1|1411626_1412712_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386551.1|1412852_1413815_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001398823.1|1413842_1415993_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	7.4e-43
WP_001145128.1|1416112_1416595_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000007102.1|1416826_1418191_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|1418419_1419091_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000976401.1|1419090_1420089_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996107.1|1420081_1421818_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 109
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1433129	1434038	4745573		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|1433129_1434038_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 110
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1440519	1441809	4745573		Klosneuvirus(100.0%)	1	NA	NA
WP_001389241.1|1440519_1441809_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 111
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1452164	1458738	4745573		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891685.1|1452164_1453223_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604034.1|1453225_1453915_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101994.1|1453914_1454688_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1454854_1455004_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|1455132_1455921_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096869.1|1455988_1457461_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265443.1|1457721_1458738_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 112
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1463094	1466614	4745573		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|1463094_1464147_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|1464462_1464843_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951296.1|1464956_1465898_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	3.7e-23
WP_000345410.1|1465894_1466614_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 113
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1502496	1503288	4745573		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|1502496_1503288_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 114
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1506666	1526792	4745573		Hokovirus(28.57%)	14	NA	NA
WP_001032694.1|1506666_1508148_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000628041.1|1508189_1509608_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	1.8e-61
WP_001076004.1|1509604_1510114_-	YbgA family protein	NA	NA	NA	NA	NA
WP_000832338.1|1511628_1512198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000267506.1|1512194_1513628_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.6	1.9e-26
WP_167778758.1|1513745_1514072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167778759.1|1514071_1518265_-	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
WP_000424924.1|1518507_1518714_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|1519026_1519116_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741137.1|1519115_1520789_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087967.1|1520811_1522860_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_001297248.1|1522868_1523441_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001297245.1|1523433_1526118_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_000186103.1|1526114_1526792_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 115
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1533436	1534201	4745573		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|1533436_1534201_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 116
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1538351	1542165	4745573	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|1538351_1540016_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023104.1|1540218_1542165_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 117
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1546791	1548456	4745573		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337088.1|1546791_1548456_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.4e-84
>prophage 118
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1552591	1553632	4745573		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|1552591_1553632_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 119
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1561528	1565061	4745573		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|1561528_1562254_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207522.1|1562371_1563307_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367872.1|1563390_1565061_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	2.3e-76
>prophage 120
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1572000	1574583	4745573	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|1572000_1574583_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 121
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1581593	1584033	4745573		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|1581593_1582682_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1582821_1584033_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 122
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1588848	1589495	4745573		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|1588848_1589232_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1589285_1589495_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 123
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1604920	1607035	4745573		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|1604920_1605349_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|1605469_1607035_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 124
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1610144	1611967	4745573		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029813.1|1610144_1611365_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
WP_000502941.1|1611337_1611967_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 125
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1626513	1632556	4745573		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|1626513_1627329_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096744.1|1627325_1628459_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077701.1|1628674_1632556_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	5.8e-62
>prophage 126
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1643985	1647129	4745573		Leptospira_phage(100.0%)	1	NA	NA
WP_167778766.1|1643985_1647129_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 127
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1650274	1728064	4745573	tRNA,tail,transposase,capsid,protease,integrase,terminase,portal,lysis,head	Enterobacteria_phage(46.94%)	76	1670191:1670237	1717860:1717906
WP_000770941.1|1650274_1650958_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000253830.1|1650947_1652396_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000103240.1|1653132_1655034_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-26
WP_001160804.1|1655061_1655523_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_167778767.1|1655542_1660342_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.7	8.9e-20
WP_000092528.1|1660343_1660709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167778768.1|1661013_1661175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137526149.1|1661710_1662847_+|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_000383951.1|1663115_1665353_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_167778769.1|1665339_1668312_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|1668312_1669203_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|1669385_1670147_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1670191:1670237	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001298108.1|1670589_1671027_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|1671051_1671636_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201842.1|1672134_1673088_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_024230114.1|1673274_1674759_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024230115.1|1674942_1675248_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	74.5	3.6e-12
WP_000239881.1|1675304_1675973_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|1676470_1676653_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|1676731_1677232_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|1677268_1677775_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_167778770.1|1677793_1678684_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_057697314.1|1678803_1679385_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.6e-101
WP_072147513.1|1679384_1682780_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001230375.1|1682844_1683444_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_167778771.1|1683513_1686927_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.9	0.0e+00
WP_001351519.1|1686987_1687620_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	5.5e-95
WP_032146220.1|1687556_1688300_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-145
WP_001152619.1|1688304_1689003_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_021520659.1|1689002_1689332_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_097746356.1|1689328_1691890_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.6	0.0e+00
WP_000459458.1|1691882_1692317_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000479164.1|1692298_1692721_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_097746363.1|1692736_1693477_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	1.5e-128
WP_097746357.1|1693484_1693880_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	9.4e-69
WP_077127738.1|1693876_1694455_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.3e-79
WP_000753006.1|1694466_1694820_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
WP_097746358.1|1694831_1695230_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	97.7	6.6e-62
WP_000063277.1|1695271_1696297_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001295978.1|1696352_1696685_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123331.1|1696694_1698014_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
WP_001440634.1|1697994_1699596_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	2.9e-310
WP_000198149.1|1699592_1699799_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_097746359.1|1699795_1701721_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453611.1|1701695_1702241_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001205742.1|1702584_1702740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000738423.1|1702908_1703202_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228697.1|1703292_1703475_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|1703691_1704189_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|1704188_1704404_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|1704993_1706091_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|1706280_1706664_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_001547120.1|1706681_1707671_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.3	6.4e-191
WP_097746362.1|1707678_1708476_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	1.7e-149
WP_000767127.1|1708495_1708885_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210176.1|1708881_1709208_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_072248950.1|1709207_1709702_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	7.3e-87
WP_001406328.1|1709698_1710640_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	5.6e-152
WP_001250269.1|1710629_1710809_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001191674.1|1711527_1711788_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|1711885_1712578_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000559922.1|1712897_1713413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|1713882_1714245_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_158147493.1|1714310_1715135_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	3.0e-149
WP_001242717.1|1715788_1716151_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206811.1|1716150_1716456_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_000051902.1|1716682_1717846_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805428.1|1718180_1718813_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1717860:1717906	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_167778772.1|1718815_1719331_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691054.1|1719341_1720349_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000988366.1|1722999_1723692_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|1723911_1724454_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|1724933_1725800_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1725801_1726014_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|1726121_1726643_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|1726678_1728064_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 128
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1739542	1740688	4745573		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|1739542_1740688_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 129
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1746878	1748660	4745573		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096878.1|1746878_1748660_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 130
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1755036	1762853	4745573		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000014664.1|1755036_1759326_-	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	2.1e-20
WP_000561899.1|1759755_1762170_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|1762166_1762853_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 131
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1765989	1766667	4745573		Bacillus_virus(100.0%)	1	NA	NA
WP_001157550.1|1765989_1766667_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	3.1e-27
>prophage 132
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1771206	1774166	4745573		uncultured_virus(50.0%)	2	NA	NA
WP_000078268.1|1771206_1773711_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.8e-115
WP_001344274.1|1773824_1774166_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
>prophage 133
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1782410	1790972	4745573		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_167778773.1|1782410_1783370_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.2e-15
WP_001250088.1|1783366_1784329_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|1784564_1785209_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678208.1|1785389_1787264_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|1787373_1787979_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1787978_1788308_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122008.1|1788360_1790292_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1790420_1790972_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 134
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1797980	1801130	4745573		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1797980_1801130_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 135
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1809965	1813512	4745573		Bacillus_phage(100.0%)	2	NA	NA
WP_001256180.1|1809965_1811747_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.1e-42
WP_001235598.1|1811739_1813512_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	8.8e-50
>prophage 136
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1816835	1817531	4745573		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|1816835_1817531_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 137
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1820659	1825706	4745573	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1820659_1820932_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|1821140_1823495_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|1823682_1824957_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|1825082_1825706_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 138
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1849412	1858393	4745573	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|1849412_1849883_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150472.1|1849971_1851075_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_000543535.1|1851078_1851528_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295327.1|1851678_1852218_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|1852516_1853401_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1853577_1853925_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|1854053_1855025_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|1855035_1856883_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1856910_1857243_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|1857265_1858393_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 139
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1865345	1875317	4745573		Bacillus_phage(60.0%)	7	NA	NA
WP_000893578.1|1865345_1866641_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|1866698_1867388_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|1867577_1868780_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698883.1|1868776_1871920_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001345723.1|1872045_1873230_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219320.1|1873372_1874281_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|1874405_1875317_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 140
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1879606	1880722	4745573		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|1879606_1880722_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 141
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1888137	1889295	4745573		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|1888137_1889295_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 142
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1896170	1896938	4745573		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939364.1|1896170_1896938_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	2.5e-25
>prophage 143
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1902234	1903344	4745573		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|1902234_1903344_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 144
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1907901	1909862	4745573		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|1907901_1908915_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|1908911_1909862_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 145
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1915272	1919552	4745573		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805907.1|1915272_1916355_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.7	3.7e-192
WP_000177923.1|1916477_1919552_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.2	0.0e+00
>prophage 146
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1923392	1928987	4745573		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952485.1|1923392_1924292_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
WP_001299008.1|1924331_1925615_-	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000076236.1|1925604_1926864_-	cytosine permease	NA	NA	NA	NA	NA
WP_000010293.1|1927100_1928987_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 147
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1937363	1941901	4745573		Acanthamoeba_polyphaga_mimivirus(50.0%)	4	NA	NA
WP_000692742.1|1937363_1938413_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
WP_000750340.1|1938499_1939456_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818900.1|1939452_1940424_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447335.1|1940416_1941901_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
>prophage 148
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1953894	1966008	4745573	integrase,holin	Escherichia_phage(50.0%)	6	1964397:1964410	1970596:1970609
WP_001676347.1|1953894_1957878_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	4.2e-124
WP_000131044.1|1958450_1960484_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001301903.1|1960612_1961200_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089101.1|1961213_1962686_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|1962699_1964370_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
1964397:1964410	attL	CGATCTGATTGAGA	NA	NA	NA	NA
WP_001295805.1|1965444_1966008_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001295805.1|1965444_1966008_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
1970596:1970609	attR	CGATCTGATTGAGA	NA	NA	NA	NA
>prophage 149
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1975932	1979237	4745573		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001046294.1|1975932_1977258_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474084.1|1977366_1977603_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|1977614_1978208_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|1978367_1979237_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
>prophage 150
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	1998117	2005699	4745573		Streptococcus_phage(50.0%)	6	NA	NA
WP_000667026.1|1998117_2000316_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121356.1|2000325_2001282_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|2001260_2001671_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000893255.1|2001987_2003241_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|2003252_2004356_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|2004643_2005699_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 151
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2010376	2011516	4745573		Mycobacterium_phage(100.0%)	1	NA	NA
WP_167778777.1|2010376_2011516_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	1.6e-31
>prophage 152
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2016594	2020513	4745573		Clostridioides_phage(50.0%)	6	NA	NA
WP_000543899.1|2016594_2017368_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|2017553_2017814_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615979.1|2017816_2018095_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|2018250_2018991_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|2018961_2019729_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|2019934_2020513_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 153
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2024678	2099586	4745573	tRNA,plate,transposase,protease	uncultured_Caudovirales_phage(18.18%)	59	NA	NA
WP_032297119.1|2024678_2025815_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000508712.1|2026214_2030966_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	1.1e-22
WP_000103360.1|2031041_2033183_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	6.3e-26
WP_001142958.1|2033392_2033911_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_167778778.1|2034607_2035108_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|2035142_2035367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|2035417_2036893_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|2036899_2037313_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393845.1|2037316_2039167_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|2039130_2040213_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|2040237_2041518_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|2041514_2042039_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|2042041_2043373_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343302.1|2043377_2044139_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614399.1|2044147_2046913_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088862.1|2046909_2047653_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240545.1|2047657_2049070_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_167778842.1|2049178_2052613_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|2052623_2053976_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|2053999_2054482_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|2054525_2055440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|2055449_2055929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|2056065_2056851_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|2057390_2058122_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|2058186_2058654_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|2058650_2059373_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052707.1|2059406_2060162_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|2060233_2061592_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211729.1|2061639_2062410_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|2062487_2063288_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|2063528_2064443_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997043.1|2064439_2065243_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_001140187.1|2071129_2071705_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|2071892_2072924_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|2072916_2073570_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|2073609_2074425_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|2074542_2074947_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|2074943_2075651_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|2075762_2077481_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000239192.1|2078512_2079223_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|2079236_2079659_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|2079655_2080201_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|2080366_2080567_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|2080553_2080814_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|2080862_2082161_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|2082225_2082615_-	VOC family protein	NA	NA	NA	NA	NA
WP_167778779.1|2082671_2084813_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|2084911_2085871_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294774.1|2085883_2089366_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|2089402_2089999_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000166359.1|2089995_2091144_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|2091143_2091932_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2091935_2092391_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|2092495_2093521_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|2093524_2094010_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|2094131_2096564_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|2096593_2097946_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_000922446.1|2097957_2098815_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295562.1|2098827_2099586_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 154
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2111470	2112895	4745573	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|2111470_2112895_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 155
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2116824	2117169	4745573		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2116824_2117169_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 156
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2123080	2123878	4745573		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158933.1|2123080_2123878_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.8	4.6e-14
>prophage 157
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2129121	2135927	4745573	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001542630.1|2129121_2131551_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.9e-40
WP_001294697.1|2131624_2132155_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|2132169_2132874_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|2133051_2133507_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937432.1|2133543_2134470_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|2134508_2135927_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 158
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2145833	2146736	4745573		Sodalis_phage(100.0%)	1	NA	NA
WP_000339945.1|2145833_2146736_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 159
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2149998	2156466	4745573		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|2149998_2150925_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|2151033_2151696_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|2151736_2152273_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000996827.1|2152478_2154869_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001189602.1|2154915_2156466_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 160
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2164116	2165541	4745573		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|2164116_2165541_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 161
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2174168	2174720	4745573		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|2174168_2174720_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 162
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2178965	2180009	4745573		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|2178965_2180009_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 163
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2205982	2207707	4745573		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425668.1|2205982_2207707_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 164
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2220408	2221107	4745573		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|2220408_2221107_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 165
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2227439	2232862	4745573		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035654.1|2227439_2229791_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
WP_001117011.1|2229955_2232862_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 166
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2241885	2243285	4745573		Microcystis_phage(50.0%)	2	NA	NA
WP_000257186.1|2241885_2242728_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_001445796.1|2242805_2243285_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 167
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2251179	2256840	4745573		Vibrio_phage(50.0%)	4	NA	NA
WP_000787111.1|2251179_2252694_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|2252724_2253867_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349938.1|2253995_2255213_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001297614.1|2255286_2256840_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
>prophage 168
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2262310	2263459	4745573		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|2262310_2263459_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 169
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2267865	2270682	4745573	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|2267865_2270682_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 170
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2277715	2286784	4745573		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681368.1|2277715_2278882_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
WP_000935262.1|2279410_2279620_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|2279723_2280854_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2280942_2282859_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843559.1|2283235_2283640_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102379.1|2283665_2284379_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|2284527_2285094_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|2285128_2285716_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130189.1|2285830_2286784_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
>prophage 171
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2293563	2295677	4745573		Bacillus_phage(50.0%)	2	NA	NA
WP_001188656.1|2293563_2294253_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	5.2e-30
WP_001219604.1|2294252_2295677_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
>prophage 172
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2306507	2311862	4745573		Bacillus_phage(33.33%)	3	NA	NA
WP_000409465.1|2306507_2308445_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2308655_2310323_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|2310629_2311862_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 173
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2318605	2319928	4745573		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477808.1|2318605_2319928_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
>prophage 174
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2325563	2328439	4745573		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2325563_2325725_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2325851_2326457_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|2326849_2328439_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 175
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2336100	2337380	4745573		Salmonella_phage(50.0%)	2	NA	NA
WP_000098819.1|2336100_2336640_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	8.4e-28
WP_000799911.1|2336642_2337380_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 176
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2340606	2345971	4745573		Tupanvirus(50.0%)	4	NA	NA
WP_000106030.1|2340606_2341629_-	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091569.1|2341767_2342682_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410129.1|2342896_2344258_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919567.1|2344306_2345971_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 177
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2362580	2366549	4745573		Synechococcus_phage(50.0%)	2	NA	NA
WP_001593930.1|2362580_2365013_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
WP_000939429.1|2365043_2366549_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.8e-34
>prophage 178
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2373092	2374049	4745573	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_001593925.1|2373092_2374049_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	3.0e-60
>prophage 179
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2381550	2382105	4745573		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|2381550_2382105_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 180
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2388672	2390133	4745573		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|2388672_2390133_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 181
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2400406	2402083	4745573		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|2400406_2401003_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|2401480_2402083_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 182
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2405446	2413673	4745573		Stx2-converting_phage(33.33%)	7	NA	NA
WP_000991447.1|2405446_2406427_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.6	3.9e-100
WP_001338066.1|2406434_2406557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168559.1|2406638_2407511_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000177023.1|2407680_2409756_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	4.5e-37
WP_000504880.1|2409748_2411092_+	McrC family protein	NA	NA	NA	NA	NA
WP_000148644.1|2411088_2411475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001593915.1|2411525_2413673_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	42.3	5.7e-19
>prophage 183
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2425026	2438606	4745573	tRNA	Tupanvirus(20.0%)	8	NA	NA
WP_001022619.1|2425026_2426496_+	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
WP_001593906.1|2428443_2429463_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	2.4e-44
WP_001347963.1|2429592_2431095_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001295681.1|2431213_2432296_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|2432295_2433396_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2433662_2435174_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|2435307_2435751_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416396.1|2435750_2438606_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 184
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2446884	2452981	4745573		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|2446884_2447820_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2447832_2448294_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2448366_2448753_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471889.1|2448958_2451655_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|2451795_2451849_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|2452033_2452981_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 185
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2456619	2459380	4745573		Vibrio_phage(50.0%)	2	NA	NA
WP_000187795.1|2456619_2458758_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106236.1|2458915_2459380_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.9	2.9e-53
>prophage 186
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2463690	2470348	4745573		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|2463690_2464689_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|2464721_2465717_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|2465703_2466726_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205794.1|2466739_2468242_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|2468551_2469508_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|2469817_2470348_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 187
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2513677	2514841	4745573		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943965.1|2513677_2514841_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
>prophage 188
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2518773	2531805	4745573	tRNA,protease	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076316.1|2518773_2521215_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|2521253_2521679_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2521883_2523182_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2523285_2523483_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2523564_2524569_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_167778786.1|2524571_2525831_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_167778787.1|2525916_2527197_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2527273_2527582_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|2527667_2528618_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122507.1|2528610_2530458_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990321.1|2530467_2531805_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 189
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2535720	2536266	4745573		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2535720_2536266_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 190
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2544249	2545227	4745573		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2544249_2545227_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 191
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2550147	2550681	4745573		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|2550147_2550681_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 192
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2555182	2557166	4745573		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|2555182_2556829_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2556872_2557166_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 193
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2571443	2574655	4745573	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856834.1|2571443_2572901_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
WP_001295087.1|2573137_2574655_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.0e-87
>prophage 194
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2595851	2597354	4745573		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|2595851_2597354_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 195
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2602193	2602982	4745573		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|2602193_2602982_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 196
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2608541	2610091	4745573		Bacillus_virus(50.0%)	2	NA	NA
WP_001039799.1|2608541_2609300_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
WP_000611404.1|2609410_2610091_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
>prophage 197
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2614066	2616052	4745573		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001307516.1|2614066_2616052_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 198
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2621297	2623445	4745573		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|2621297_2623445_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 199
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2632727	2634686	4745573		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|2632727_2634686_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 200
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2640269	2641619	4745573		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2640269_2641619_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 201
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2645436	2649049	4745573		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2645436_2645973_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|2646226_2649049_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 202
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2653256	2655804	4745573		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|2653256_2654336_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|2654388_2655804_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 203
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2662431	2663040	4745573		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2662431_2663040_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 204
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2672255	2673371	4745573		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2672255_2673371_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 205
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2689232	2690024	4745573		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130538.1|2689232_2690024_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.5e-46
>prophage 206
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2695673	2699357	4745573		Dickeya_phage(100.0%)	1	NA	NA
WP_000096010.1|2695673_2699357_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 207
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2714732	2716322	4745573		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|2714732_2716322_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 208
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2721690	2723454	4745573		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2721690_2721963_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|2722149_2722740_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362392.1|2722782_2723454_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 209
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2732669	2740998	4745573		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|2732669_2736893_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|2736969_2740998_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 210
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2745114	2748167	4745573		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2745114_2746299_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|2747216_2748167_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 211
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2756673	2758518	4745573		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|2756673_2758518_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 212
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2765268	2766483	4745573		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690934.1|2765268_2766483_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
>prophage 213
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2778666	2785913	4745573		Serratia_phage(33.33%)	5	NA	NA
WP_000184829.1|2778666_2780964_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2781014_2781335_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|2781349_2782429_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174083.1|2782737_2785239_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424837.1|2785250_2785913_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.1e-28
>prophage 214
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2798905	2803090	4745573		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_167778791.1|2798905_2803090_-	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
>prophage 215
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2808727	2813230	4745573		Erwinia_phage(50.0%)	5	NA	NA
WP_001293343.1|2808727_2810059_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|2810125_2811052_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2811144_2811630_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2811714_2811960_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2812384_2813230_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 216
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2824805	2829666	4745573		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|2824805_2825504_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2825500_2826874_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|2826979_2827654_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|2827802_2828786_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|2829045_2829666_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 217
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2844429	2847480	4745573		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|2844429_2847480_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 218
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2860204	2864935	4745573		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_167778793.1|2860204_2861215_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	6.4e-05
WP_000094544.1|2861247_2862135_-	aldolase	NA	NA	NA	NA	NA
WP_001299483.1|2862159_2863038_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.7e-47
WP_000160872.1|2863210_2864107_+	sugar kinase	NA	NA	NA	NA	NA
WP_000022286.1|2864146_2864935_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
>prophage 219
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2872251	2874722	4745573		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190580.1|2872251_2873301_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|2873312_2874722_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 220
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2878800	2881587	4745573		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|2878800_2881587_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 221
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2895274	2895889	4745573		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2895274_2895889_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 222
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2904679	2907966	4745573		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|2904679_2905456_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|2905458_2905974_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|2905977_2906247_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|2906325_2907966_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 223
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2920377	2922207	4745573		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|2920377_2922207_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 224
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2929691	2933550	4745573		Bacillus_phage(100.0%)	3	NA	NA
WP_000383406.1|2929691_2931854_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|2931937_2932654_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|2932653_2933550_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 225
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2952051	2958195	4745573		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|2952051_2953182_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145198.1|2953186_2953861_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|2953838_2954720_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226604.1|2954738_2955806_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000006625.1|2955805_2957068_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866673.1|2957064_2958195_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.0	1.9e-26
>prophage 226
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2962237	2967649	4745573		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|2962237_2962567_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|2962697_2963963_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001299253.1|2964096_2965581_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238891.1|2965627_2967649_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	1.9e-112
>prophage 227
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2975977	2977624	4745573		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012621.1|2975977_2977624_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	7.4e-67
>prophage 228
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	2991013	2996866	4745573		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|2991013_2991904_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|2991928_2992894_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387753.1|2992898_2994404_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_000715936.1|2994411_2994831_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|2994997_2996866_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 229
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3000034	3001027	4745573		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845106.1|3000034_3001027_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 230
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3012979	3016341	4745573		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|3012979_3014350_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|3014511_3016341_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 231
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3021872	3025713	4745573		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|3021872_3022913_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|3022999_3023959_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|3023958_3024849_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|3024939_3025713_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 232
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3036702	3038040	4745573		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|3036702_3038040_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 233
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3048238	3055607	4745573		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|3048238_3048496_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|3048459_3048819_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3048835_3048976_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|3049205_3049286_-	protein YsdD	NA	NA	NA	NA	NA
WP_105454012.1|3049582_3050986_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|3050990_3052091_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|3052090_3053164_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|3053192_3055607_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 234
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3060313	3061462	4745573		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|3060313_3061462_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 235
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3065888	3066842	4745573		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|3065888_3066302_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243428.1|3066413_3066842_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 236
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3073195	3082357	4745573		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087147.1|3073195_3074911_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828483.1|3074907_3076401_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_000511287.1|3076447_3076897_-	membrane protein	NA	NA	NA	NA	NA
WP_000703959.1|3077006_3077354_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|3077343_3077706_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148039.1|3077702_3078200_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|3078207_3079392_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|3079810_3079900_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|3080464_3080563_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168480.1|3080668_3082357_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 237
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3089662	3090997	4745573		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|3089662_3090997_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 238
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3103115	3104507	4745573		environmental_Halophage(100.0%)	1	NA	NA
WP_167778798.1|3103115_3104507_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 239
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3109628	3116379	4745573		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|3109628_3111737_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3111755_3112031_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|3112085_3112709_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_001384873.1|3112966_3114649_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	8.7e-23
WP_000924289.1|3114645_3115263_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001297374.1|3115554_3116379_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
>prophage 240
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3119752	3124315	4745573		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|3119752_3120211_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050139.1|3120188_3121409_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001297375.1|3121580_3122249_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000091955.1|3122465_3122702_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|3122722_3122890_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|3122987_3123797_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|3123835_3124315_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 241
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3136246	3146975	4745573		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587764.1|3136246_3137179_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_000842823.1|3137482_3138340_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|3138614_3139811_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|3139820_3140846_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982078.1|3141084_3142119_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_000483860.1|3142105_3143065_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|3143068_3144352_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116566.1|3144361_3145906_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|3146150_3146582_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|3146723_3146975_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 242
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3168937	3179628	4745573	tRNA	uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_001346013.1|3168937_3169771_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
WP_000072850.1|3169923_3170766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001271686.1|3170870_3171254_-	protein YhhH	NA	NA	NA	NA	NA
WP_167778800.1|3171225_3175461_-	rhs element protein RhsB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
WP_000779792.1|3175689_3176298_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206275.1|3176395_3177787_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582487.1|3177783_3179628_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.6	1.3e-16
>prophage 243
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3203815	3205357	4745573		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146482.1|3203815_3205357_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 244
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3210675	3211671	4745573		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_167778802.1|3210675_3211671_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	7.0e-12
>prophage 245
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3215895	3216108	4745573		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3215895_3216108_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 246
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3219762	3222096	4745573		Escherichia_phage(100.0%)	1	NA	NA
WP_000013914.1|3219762_3222096_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.0	2.7e-70
>prophage 247
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3237844	3239829	4745573		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196496.1|3237844_3238828_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
WP_000107035.1|3238824_3239829_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 248
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3287910	3288558	4745573		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|3287910_3288558_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 249
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3293435	3295570	4745573		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065786.1|3293435_3293861_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
WP_000922639.1|3293873_3295163_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|3295216_3295570_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 250
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3298915	3300958	4745573		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|3298915_3300958_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 251
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3314388	3320285	4745573		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000149165.1|3314388_3317124_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
WP_001314210.1|3317123_3318248_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001259385.1|3318320_3318596_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	50.0	3.7e-16
WP_000593555.1|3318592_3318952_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|3319071_3319473_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173666.1|3319478_3320285_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 252
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3328178	3332310	4745573		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|3328178_3328844_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|3329064_3329310_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_167778804.1|3329411_3331610_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	8.5e-119
WP_000964718.1|3331683_3332310_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 253
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3335316	3338135	4745573		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|3335316_3335985_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|3335977_3337036_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3337280_3338135_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 254
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3343868	3345351	4745573		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082110.1|3343868_3344636_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|3344637_3345351_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 255
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3348892	3350703	4745573		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907785.1|3348892_3349963_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073602.1|3349959_3350703_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.7	5.8e-11
>prophage 256
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3370712	3373160	4745573		Dickeya_phage(100.0%)	1	NA	NA
WP_000993455.1|3370712_3373160_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 257
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3382389	3383616	4745573		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105503.1|3382389_3383616_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.5	1.3e-132
>prophage 258
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3387995	3390389	4745573		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|3387995_3390389_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 259
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3403800	3407567	4745573		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|3403800_3404520_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|3404516_3405869_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001298201.1|3405944_3407567_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 260
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3424470	3425307	4745573		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|3424470_3425307_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 261
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3444321	3453862	4745573		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601847.1|3444321_3444885_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963797.1|3444970_3446191_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|3446257_3448348_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|3448398_3449031_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3449332_3449737_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274684.1|3449791_3450661_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3450714_3450933_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057356.1|3450926_3451949_-	hydrolase	NA	NA	NA	NA	NA
WP_000634793.1|3451948_3453862_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
>prophage 262
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3459432	3465006	4745573		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|3459432_3459819_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820720.1|3459818_3460178_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903387.1|3460185_3460473_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3460598_3460973_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3461069_3461540_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3461636_3463751_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3463821_3465006_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 263
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3484883	3486355	4745573	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004432.1|3484883_3485831_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|3485845_3486355_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 264
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3496690	3500844	4745573		Bacillus_virus(50.0%)	4	NA	NA
WP_000078332.1|3496690_3497449_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	6.9e-20
WP_001307418.1|3497456_3498560_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_167778808.1|3498569_3499751_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|3499818_3500844_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 265
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3507348	3508233	4745573		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258919.1|3507348_3508233_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	4.9e-25
>prophage 266
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3518798	3519842	4745573		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3518798_3519842_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 267
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3536338	3538863	4745573	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|3536338_3537406_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|3537495_3538863_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 268
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3542829	3543327	4745573	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3542829_3543327_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 269
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3547031	3551779	4745573		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108459.1|3547031_3548522_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|3548569_3549259_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209003.1|3549255_3550131_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979882.1|3550127_3550592_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445144.1|3550651_3551779_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
>prophage 270
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3558528	3573323	4745573		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001176896.1|3558528_3559458_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|3559553_3561890_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|3562119_3562773_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|3562769_3563498_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620387.1|3563494_3564127_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3564340_3564613_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3564609_3565464_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|3565509_3566001_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3566118_3566406_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|3566428_3567862_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3567909_3568635_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3568641_3569199_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|3569167_3569743_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|3569739_3570306_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|3570326_3571313_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922901.1|3571326_3572304_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|3572513_3573323_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 271
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3577391	3578869	4745573		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|3577391_3577670_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|3577897_3578869_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 272
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3585497	3588370	4745573	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3585497_3587432_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|3587521_3588370_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 273
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3592452	3599091	4745573		Dickeya_phage(50.0%)	4	NA	NA
WP_000207685.1|3592452_3593796_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3594426_3594879_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|3594906_3596394_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|3596418_3599091_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 274
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3604572	3606462	4745573		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3604572_3606462_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 275
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3612289	3620083	4745573		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189314.1|3612289_3612592_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449030.1|3612642_3613086_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|3613065_3613584_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001300423.1|3613711_3614347_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147574.1|3614419_3615460_+	permease	NA	NA	NA	NA	NA
WP_000646043.1|3615573_3616149_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|3616158_3616749_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246855.1|3616768_3617164_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249105.1|3617121_3619158_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809262.1|3619222_3620083_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
>prophage 276
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3643092	3644238	4745573		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|3643092_3644238_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 277
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3652225	3654520	4745573		Tetraselmis_virus(100.0%)	1	NA	NA
WP_167778815.1|3652225_3654520_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	5.7e-158
>prophage 278
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3680753	3681719	4745573		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|3680753_3681719_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 279
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3693526	3709709	4745573	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082882.1|3693526_3696619_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.0e-157
WP_000212470.1|3696802_3697786_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|3698004_3698337_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001297164.1|3698378_3699758_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000094682.1|3700175_3701696_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|3701849_3702473_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001065895.1|3702749_3703514_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|3703767_3704274_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|3704351_3706193_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|3706387_3708133_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|3708243_3708459_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|3708695_3709709_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 280
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3716093	3717332	4745573	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|3716093_3717332_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 281
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3722469	3723903	4745573		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3722469_3723903_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 282
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3733418	3744380	4745573		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|3733418_3734072_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|3734332_3734503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|3734560_3735334_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_001299419.1|3735476_3736265_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|3736302_3737463_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|3737468_3738140_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|3738287_3739769_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|3739973_3740603_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|3740603_3741026_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|3741050_3741878_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|3741877_3742459_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|3742487_3744380_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 283
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3748207	3759030	4745573		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|3748207_3748600_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183494.1|3748652_3749135_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001281881.1|3749680_3751939_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|3752171_3752909_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|3752983_3754396_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|3754506_3756726_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|3756768_3757026_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691598.1|3757076_3758003_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|3758202_3759030_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 284
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3765106	3765991	4745573		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|3765106_3765991_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 285
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3788205	3789378	4745573		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|3788205_3789378_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 286
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3842908	3844063	4745573		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3842908_3844063_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 287
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3865063	3865741	4745573		Bacillus_virus(100.0%)	1	NA	NA
WP_000956872.1|3865063_3865741_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	4.9e-09
>prophage 288
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3883792	3885025	4745573		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3883792_3885025_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 289
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3893553	3898926	4745573		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195024.1|3893553_3896427_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.9	8.2e-263
WP_000951964.1|3896692_3897436_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001307385.1|3897492_3898926_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	25.9	5.7e-31
>prophage 290
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3902850	3918242	4745573	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|3902850_3903747_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|3903771_3904482_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813215.1|3904487_3906221_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|3906311_3907409_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|3907419_3908937_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192814.1|3908979_3909528_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|3909582_3909654_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|3909650_3909776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|3909777_3911226_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_097294757.1|3911661_3913581_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|3913580_3914069_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|3914104_3915472_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|3915507_3916824_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280215.1|3916841_3918242_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 291
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3942521	3945471	4745573	integrase	Clostridium_phage(50.0%)	2	3943412:3943430	3954226:3954244
WP_001272558.1|3942521_3943277_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
3943412:3943430	attL	TTCCCTTCGCCCGCTCCAA	NA	NA	NA	NA
WP_097470198.1|3943518_3945471_+|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	24.6	2.2e-09
WP_097470198.1|3943518_3945471_+|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	24.6	2.2e-09
3954226:3954244	attR	TTCCCTTCGCCCGCTCCAA	NA	NA	NA	NA
>prophage 292
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3950513	3951735	4745573		Mycobacterium_phage(50.0%)	2	NA	NA
WP_097470193.1|3950513_3950981_-	DUF1643 domain-containing protein	NA	A0A0F6WE62	Mycobacterium_phage	43.0	1.6e-27
WP_123007250.1|3951174_3951735_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.7	4.2e-22
>prophage 293
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3976918	3979406	4745573		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603504.1|3976918_3977680_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|3977987_3979406_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 294
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	3989037	3995810	4745573		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|3989037_3989751_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|3989819_3990509_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|3991193_3991724_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|3991736_3993983_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|3994133_3995009_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|3995015_3995810_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 295
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4001287	4016454	4745573	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_001138163.1|4001287_4004176_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.2e-67
WP_001285985.1|4004168_4007711_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.5e-08
WP_000775946.1|4007710_4009537_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_000237948.1|4009598_4010930_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|4011161_4012415_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|4012774_4013872_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_167778823.1|4013948_4014755_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	6.5e-16
WP_000184251.1|4014805_4015249_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001347723.1|4015248_4016454_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	7.8e-74
>prophage 296
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4027980	4028736	4745573		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|4027980_4028736_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 297
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4033594	4034443	4745573		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|4033594_4034443_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 298
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4041977	4046092	4745573		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|4041977_4044734_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046785.1|4044790_4046092_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
>prophage 299
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4050124	4055044	4745573		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_000210878.1|4050124_4051762_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|4051849_4053148_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001268451.1|4053207_4054080_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001288227.1|4054093_4054234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199970.1|4054372_4055044_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 300
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4060249	4061035	4745573		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|4060249_4061035_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 301
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4086411	4088444	4745573		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|4086411_4087839_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|4087838_4088444_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 302
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4091556	4095272	4745573		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|4091556_4092318_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4092311_4092938_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|4093077_4094217_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4094279_4095272_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 303
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4100486	4107626	4745573		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4100486_4101125_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|4101121_4102384_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|4102380_4103289_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|4103484_4104252_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|4104302_4104959_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272898.1|4105064_4107626_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 304
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4126697	4127708	4745573		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001363554.1|4126697_4127708_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.0	2.3e-26
>prophage 305
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4135281	4136247	4745573		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|4135281_4136247_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 306
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4141713	4147273	4745573	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132235.1|4141713_4142211_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	1.5e-31
WP_000963143.1|4142290_4143352_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|4143594_4144095_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_167778827.1|4144222_4146853_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4147087_4147273_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 307
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4160456	4165752	4745573		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|4160456_4161659_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777968.1|4162013_4162973_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.2e-132
WP_000246536.1|4162982_4165127_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	5.4e-195
WP_000080944.1|4165099_4165510_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|4165506_4165752_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 308
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4169687	4173812	4745573		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|4169687_4170137_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|4170137_4170800_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|4170820_4172221_-	GABA permease	NA	NA	NA	NA	NA
WP_000097641.1|4172531_4173812_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
>prophage 309
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4183293	4183551	4745573		Salmonella_phage(100.0%)	1	NA	NA
WP_000340075.1|4183293_4183551_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	69.2	1.2e-05
>prophage 310
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4187818	4188301	4745573		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|4187818_4188301_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 311
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4202047	4203118	4745573		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168044.1|4202047_4203118_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 312
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4209024	4211598	4745573		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4209024_4211598_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 313
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4217453	4218752	4745573		Burkholderia_virus(100.0%)	1	NA	NA
WP_000230376.1|4217453_4218752_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 314
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4224045	4227134	4745573	tRNA	Achromobacter_phage(33.33%)	4	NA	NA
WP_001098726.1|4224045_4224465_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|4224671_4225709_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|4225756_4226446_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|4226750_4227134_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
>prophage 315
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4230248	4231583	4745573		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_000219193.1|4230248_4231583_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 316
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4237354	4241097	4745573		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|4237354_4239154_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|4239169_4240144_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4240416_4241097_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 317
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4244555	4244816	4745573		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|4244555_4244816_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 318
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4248935	4260243	4745573		Bacillus_phage(50.0%)	7	NA	NA
WP_167778830.1|4248935_4252823_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	3.5e-131
WP_001297612.1|4253398_4254826_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215888.1|4254990_4255704_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|4255693_4257028_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|4257088_4257427_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|4257471_4258662_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|4258989_4260243_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 319
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4266001	4267513	4745573		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493471.1|4266001_4267513_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 320
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4282677	4289134	4745573		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4282677_4283892_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4283919_4284306_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4284322_4284646_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|4284741_4285257_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|4285273_4287124_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|4287125_4287461_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|4287472_4287673_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133582.1|4287850_4289134_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 321
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4299019	4299451	4745573		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|4299019_4299451_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 322
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4308280	4314765	4745573		Escherichia_phage(66.67%)	7	NA	NA
WP_000937933.1|4308280_4309651_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
WP_001299507.1|4309812_4311279_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|4311347_4312925_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755185.1|4313019_4313559_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	93.9	1.4e-43
WP_001317257.1|4313574_4314093_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
WP_000076001.1|4314403_4314595_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|4314612_4314765_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 323
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4321011	4325013	4745573		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|4321011_4321650_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|4321649_4322687_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|4323011_4323638_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|4323723_4325013_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 324
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4346102	4346816	4745573		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4346102_4346816_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 325
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4364835	4365786	4745573		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4364835_4365786_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 326
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4384340	4389278	4745573		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102891.1|4384340_4385210_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|4385423_4385849_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000842944.1|4385835_4386285_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838945.1|4386345_4386921_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|4387016_4387916_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_167778833.1|4387973_4389278_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.2e-08
>prophage 327
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4392756	4408126	4745573		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517431.1|4392756_4393548_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
WP_000290223.1|4393718_4394735_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_167778834.1|4394734_4395568_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|4395567_4396443_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021039.1|4396432_4397530_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001297645.1|4397663_4398575_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000719943.1|4398577_4398946_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|4399050_4399902_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|4399943_4400453_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|4400493_4402221_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4402265_4402523_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|4402906_4403878_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254843.1|4404062_4404824_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|4405053_4406040_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|4406110_4408126_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 328
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4433819	4434554	4745573		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4433819_4434554_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 329
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4438372	4439293	4745573		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|4438372_4439293_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 330
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4442984	4450561	4745573		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283499.1|4442984_4444679_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|4444748_4445693_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|4445766_4446912_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001325644.1|4446967_4450561_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
>prophage 331
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4457202	4458636	4745573		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|4457202_4458636_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 332
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4461676	4462609	4745573		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|4461676_4462609_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 333
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4480491	4481577	4745573		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|4480491_4481577_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 334
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4490141	4491278	4745573		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|4490141_4491278_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 335
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4497754	4499272	4745573		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|4497754_4499272_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 336
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4503483	4505356	4745573		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|4503483_4504257_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156113.1|4504453_4505356_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
>prophage 337
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4515915	4519143	4745573		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203389.1|4515915_4516566_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_001012899.1|4516652_4518485_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|4518543_4519143_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 338
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4553559	4558563	4745573		Tupanvirus(50.0%)	4	NA	NA
WP_000860263.1|4553559_4555542_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
WP_000461661.1|4555541_4556510_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_001342601.1|4556513_4557653_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.9e-29
WP_001297077.1|4557960_4558563_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 339
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4561715	4562618	4745573	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_167778836.1|4561715_4562618_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	7.4e-69
>prophage 340
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4568511	4582566	4745573		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000779091.1|4568511_4569588_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301049.1|4570049_4570700_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|4570753_4571008_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|4571007_4572138_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075170.1|4572226_4574512_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_097345480.1|4575207_4578942_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	23.3	1.0e-18
WP_000990766.1|4579069_4579792_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_167778837.1|4579938_4582566_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 341
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4592266	4595116	4745573		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|4592266_4595116_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 342
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4599392	4605170	4745573		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865571.1|4599392_4600496_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	6.2e-118
WP_000406101.1|4600607_4601663_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000710366.1|4601736_4602801_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000884953.1|4602800_4603451_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422188.1|4603526_4605170_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
>prophage 343
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4613937	4614555	4745573		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|4613937_4614555_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 344
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4626254	4633901	4745573		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|4626254_4627262_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494183.1|4627399_4627684_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578079.1|4627808_4629569_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001234850.1|4629717_4630413_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213361.1|4630440_4631631_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|4631963_4632308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194940.1|4632311_4633901_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
>prophage 345
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4639655	4643956	4745573		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|4639655_4640222_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001296828.1|4640633_4641347_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|4641385_4642372_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000848214.1|4642489_4643956_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	8.7e-43
>prophage 346
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4658451	4659309	4745573		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|4658451_4659309_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 347
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4663378	4667164	4745573		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489247.1|4663378_4665370_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425438.1|4665401_4666238_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|4666495_4667164_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 348
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4670858	4672379	4745573		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|4670858_4672379_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 349
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4692694	4702136	4745573		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|4692694_4693621_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|4693625_4694357_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|4694337_4694445_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4694504_4695236_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4695457_4697143_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4697139_4697859_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4697905_4698376_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4698416_4698878_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|4699002_4701003_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|4700999_4702136_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 350
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4714647	4716681	4745573	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|4714647_4716681_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 351
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4727328	4730885	4745573		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001307284.1|4727328_4728147_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000434038.1|4728198_4728945_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|4728918_4729884_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|4729880_4730885_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 352
NZ_CP050646	Escherichia coli strain PapM-36-2 chromosome, complete genome	4745573	4740105	4745312	4745573	integrase	Salmonella_phage(44.44%)	10	4737592:4737604	4744597:4744609
4737592:4737604	attL	CGCATTACTGCTG	NA	NA	NA	NA
WP_000807362.1|4740105_4741005_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|4741419_4741737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985264.1|4742001_4743015_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.4e-193
WP_001306384.1|4743130_4743430_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|4743544_4743820_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|4743830_4744001_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001610018.1|4743997_4744498_+	hypothetical protein	NA	U5N0V9	Enterobacteria_phage	98.8	2.9e-91
WP_000557698.1|4744561_4744786_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
4744597:4744609	attR	CGCATTACTGCTG	NA	NA	NA	NA
WP_001277898.1|4744785_4745085_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113264.1|4745087_4745312_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
