The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042938	Mycoplasma bovis strain MJ1 chromosome, complete genome	1024574	78679	89382	1024574	transposase,tRNA	Faecalibacterium_phage(16.67%)	7	NA	NA
WP_078086171.1|78679_79708_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
WP_041309069.1|79910_80675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954530.1|80667_81648_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.6	8.1e-53
WP_013954531.1|81772_86149_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	31.8	6.2e-12
WP_013954532.1|86554_87778_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	35.1	1.5e-61
WP_013456569.1|87767_88733_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.9	3.6e-29
WP_013954533.1|88722_89382_+	uracil-DNA glycosylase	NA	A0A068EP41	Falconid_herpesvirus	36.4	1.6e-28
>prophage 2
NZ_CP042938	Mycoplasma bovis strain MJ1 chromosome, complete genome	1024574	322439	410598	1024574	transposase,tRNA	Tupanvirus(16.67%)	58	NA	NA
WP_013954691.1|322439_323684_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	5.3e-09
WP_013456216.1|324124_325474_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	1.0e-13
WP_013954692.1|325466_327077_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_013954693.1|327142_328582_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_013954694.1|328693_330781_-	peptidase S41	NA	NA	NA	NA	NA
WP_013954695.1|330744_332136_-	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_075271185.1|332138_334448_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_013954697.1|334766_336128_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013954698.1|336647_337481_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	45.7	3.6e-54
WP_013954699.1|337787_338741_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_013954700.1|338790_339687_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_167662296.1|339695_341594_-	peptidase S41	NA	NA	NA	NA	NA
WP_013954702.1|341617_342121_-	hypothetical protein	NA	S6AVW3	Thermus_phage	32.8	5.6e-10
WP_078086168.1|342423_344025_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_167662297.1|344410_345775_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_167662298.1|345885_346671_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_013456620.1|346675_348205_-	RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	33.7	2.0e-29
WP_167662299.1|348197_350138_-	DNA primase	NA	A0A1S5RFD7	Helicobacter_phage	35.0	1.7e-41
WP_167662300.1|350179_351556_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	31.8	5.6e-52
WP_013954709.1|351667_353455_-	membrane protein	NA	NA	NA	NA	NA
WP_013954710.1|353905_355261_+	alkylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013456298.1|355263_356196_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	1.3e-07
WP_013456124.1|356159_357911_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013456114.1|358017_358263_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_167662301.1|358343_360863_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_038582866.1|361099_362146_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0K0KVL7	Prochlorococcus_phage	26.9	1.0e-13
WP_167662369.1|362294_364133_-	type I DNA topoisomerase	NA	A0A2P1ELA0	Moumouvirus	32.1	4.8e-75
WP_013456432.1|364512_364950_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_013456362.1|364991_365390_+	single-stranded DNA-binding protein	NA	A0A0H3U4B5	Staphylococcus_phage	30.3	9.3e-08
WP_013456088.1|365409_365736_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_167662302.1|365870_367199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456295.1|367275_367731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167662303.1|367781_369452_-	APC family permease	NA	NA	NA	NA	NA
WP_013456205.1|369690_371007_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.1	2.7e-11
WP_167662304.1|371075_372779_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	21.8	2.6e-14
WP_167662305.1|372891_374136_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	26.6	4.1e-09
WP_013456084.1|374203_374995_-	aquaporin family protein	NA	M1HQW3	Paramecium_bursaria_Chlorella_virus	27.5	7.3e-12
WP_167662306.1|375003_376512_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_013456345.1|376801_378193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456049.1|378325_379327_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013456401.1|379328_380297_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013456470.1|380410_381154_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_013456409.1|381333_381618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456558.1|381610_383257_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_167662307.1|383263_384268_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_167662308.1|384260_384935_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	31.9	1.2e-18
WP_167662309.1|385007_387986_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013954721.1|388038_389391_-	YitT family protein	NA	NA	NA	NA	NA
WP_013954722.1|389485_390322_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_013954723.1|390308_391040_-	DNA processing protein DprA	NA	NA	NA	NA	NA
WP_013954660.1|391162_392551_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_038582875.1|392896_393937_+	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.7	5.2e-34
WP_038582700.1|394270_395299_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013954726.1|395563_398365_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_013954727.1|398593_405625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167662310.1|406337_407726_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_141774540.1|408195_409230_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_078086171.1|409569_410598_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
>prophage 3
NZ_CP042938	Mycoplasma bovis strain MJ1 chromosome, complete genome	1024574	477581	523821	1024574	transposase,tRNA	Faecalibacterium_phage(40.0%)	36	NA	NA
WP_078086163.1|477581_478610_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_152028753.1|479036_479720_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_167662318.1|479729_481676_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.7	1.0e-70
WP_152028751.1|481685_482246_+	single-stranded DNA-binding protein	NA	B8R683	Lactobacillus_phage	41.0	1.4e-14
WP_013456196.1|482366_482993_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_152028750.1|482961_483690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152028749.1|483710_486050_+|tRNA	class I tRNA ligase family protein	tRNA	A0A2H4PQS0	Staphylococcus_phage	33.1	1.0e-109
WP_167662319.1|486127_489259_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.0	9.2e-135
WP_013455922.1|489359_490076_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_013456007.1|490264_490771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167662320.1|490875_491787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456542.1|491922_492336_-	ATP synthase F1 subunit epsilon	NA	NA	NA	NA	NA
WP_013456276.1|492351_493815_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_013456581.1|493867_494731_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_013954807.1|494723_496310_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_013954808.1|496302_496863_-	ATP synthase F1 subunit delta	NA	NA	NA	NA	NA
WP_013954809.1|496865_497438_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_013456149.1|497442_497670_-	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_013456258.1|497685_498504_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_013954810.1|498504_498942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167662321.1|499142_500816_+	restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_013954812.1|501078_501882_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_078086173.1|502356_503385_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	32.9	1.1e-20
WP_014829937.1|503636_504338_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_014829938.1|504949_505390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954815.1|505382_507131_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.9e-101
WP_014829939.1|507138_508134_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_167662322.1|508250_509015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167662323.1|509303_510146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167662324.1|510514_511903_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167662325.1|512155_512314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167662326.1|514765_515527_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_167662367.1|518806_519835_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_167662327.1|520039_520990_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_167662305.1|521282_522527_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	26.6	4.1e-09
WP_078086163.1|522792_523821_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
>prophage 4
NZ_CP042938	Mycoplasma bovis strain MJ1 chromosome, complete genome	1024574	710948	744971	1024574	transposase	Faecalibacterium_phage(60.0%)	37	NA	NA
WP_167662337.1|710948_712382_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954924.1|717599_718592_+	histidine acid phosphatase	NA	NA	NA	NA	NA
WP_078086178.1|719139_720168_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_013954925.1|721167_722211_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013456526.1|722341_722776_-	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_013954926.1|722794_723490_-	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_013456329.1|723492_723843_-	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_013455947.1|723867_724407_-	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_013954927.1|724416_724812_-	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_013455972.1|724813_724999_-	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_013022166.1|725001_725547_-	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_004023949.1|725549_725876_-	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_004023950.1|725888_726257_-	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_013456343.1|726260_726527_-	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_013456156.1|726526_726724_-	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_013456225.1|726723_727149_-	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_013954928.1|727148_727799_-	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_013954929.1|727801_728146_-	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_013954930.1|728148_728427_-	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_013954931.1|728426_729272_-	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_013456175.1|729341_729782_-	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_038582884.1|729781_730741_-	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_013954934.1|730761_731592_-	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_013456535.1|731645_731951_-	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_078086178.1|732826_733855_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_013456552.1|734102_734378_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_013456517.1|735032_736025_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	54.3	5.0e-95
WP_075270947.1|736110_736923_+	YmdB family metallophosphoesterase	NA	NA	NA	NA	NA
WP_013456256.1|736974_738060_-	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_013954940.1|738307_739018_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_013456038.1|739054_739333_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_013455997.1|739339_739639_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_013456093.1|739831_740098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456268.1|740191_740614_-	MscL family protein	NA	NA	NA	NA	NA
WP_078086171.1|740916_741945_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
WP_014829846.1|742404_743724_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_013954489.1|743726_744971_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	3.1e-09
>prophage 5
NZ_CP042938	Mycoplasma bovis strain MJ1 chromosome, complete genome	1024574	763045	825761	1024574	tRNA,transposase,integrase	Staphylococcus_phage(18.75%)	44	762384:762410	822978:823004
762384:762410	attL	TTAATAACCCTTCATCAGCGTAAGCTT	NA	NA	NA	NA
WP_167662340.1|763045_763966_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	48.3	2.8e-79
WP_167662341.1|764011_767209_-	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_167662342.1|767217_768447_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954952.1|768451_771130_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.6	7.0e-91
WP_013954954.1|772486_772975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954957.1|774050_774605_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_075271008.1|774613_776542_-	peptidase S41	NA	NA	NA	NA	NA
WP_075271007.1|776568_778611_-	peptidase S41	NA	NA	NA	NA	NA
WP_075271178.1|778898_780290_+|tRNA	glutamate--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	25.2	6.6e-08
WP_013456580.1|780280_780682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456621.1|780944_782093_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	52.4	3.8e-102
WP_013456353.1|782309_783275_-	YwaF family protein	NA	NA	NA	NA	NA
WP_013456411.1|783291_784650_-	signal recognition particle protein	NA	D6PHS7	uncultured_phage	29.0	8.7e-05
WP_013456099.1|784668_785493_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013456213.1|785564_785804_-	hypothetical protein	NA	A0A172JI00	Bacillus_phage	40.9	4.6e-10
WP_078086163.1|786249_787278_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_078086163.1|787698_788727_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_167662343.1|788959_790378_-|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
WP_167662344.1|790982_792416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013455927.1|792640_793657_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_075271002.1|793807_794809_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	23.1	1.7e-10
WP_075271001.1|795025_796210_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_013456619.1|796589_797894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271000.1|797893_798790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456433.1|798893_800255_-	peptidase M17	NA	Q6GYZ8	Mycoplasma_phage	56.4	3.1e-103
WP_081375096.1|800329_801598_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_013954974.1|801653_803696_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_013456179.1|803861_805955_-	elongation factor G	NA	A0A1B0RXH7	Streptococcus_phage	25.2	1.8e-54
WP_013456121.1|805984_806455_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004024001.1|806485_806899_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_013954975.1|807219_808437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167662345.1|808474_810088_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	8.3e-55
WP_041309168.1|810193_810394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078086168.1|810903_812505_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_041309168.1|812653_812854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041309169.1|812973_813705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456337.1|814324_815179_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456540.1|815652_817041_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167662346.1|817475_819308_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	6.8e-29
WP_038582898.1|819318_821103_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	1.0e-29
WP_013954985.1|821326_822796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456163.1|823054_823300_-	YneF family protein	NA	NA	NA	NA	NA
822978:823004	attR	AAGCTTACGCTGATGAAGGGTTATTAA	NA	NA	NA	NA
WP_013954986.1|823325_824414_-	M42 family peptidase	NA	NA	NA	NA	NA
WP_014829974.1|824516_825761_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	26.6	6.9e-09
>prophage 6
NZ_CP042938	Mycoplasma bovis strain MJ1 chromosome, complete genome	1024574	944232	1006261	1024574	transposase,tRNA,integrase	Faecalibacterium_phage(22.22%)	49	943900:943951	983392:983443
943900:943951	attL	ATATTCATTAACAAAGCAAAAAGCACCACAAGTTAACTTGCGGCGCTTTTTG	NA	NA	NA	NA
WP_078086180.1|944232_945261_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_075270934.1|945471_946479_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_167662357.1|947027_947672_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_167662358.1|947847_948408_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_041309184.1|949458_950319_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_013456322.1|950311_950926_-	abortive infection protein	NA	NA	NA	NA	NA
WP_167662359.1|952163_952721_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_075275861.1|952763_953495_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_167662374.1|953542_954418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829995.1|955173_956034_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_167662360.1|956153_956684_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_115304825.1|957738_958572_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456123.1|965121_965871_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013955063.1|966269_968114_+	ribonuclease J	NA	NA	NA	NA	NA
WP_013955064.1|968249_969401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456444.1|969590_972008_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_101456648.1|972106_973540_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_101456752.1|973716_973992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456338.1|974289_975711_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_013456387.1|975703_977017_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_013456031.1|977016_977322_-|tRNA	glutamyl-tRNA(Gln) amidotransferase	tRNA	NA	NA	NA	NA
WP_013456120.1|977327_978182_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_013456616.1|978193_978772_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.7	1.2e-11
WP_101456737.1|978761_979523_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_013456430.1|979515_980256_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_013456524.1|980265_980580_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_013456382.1|980753_982064_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_013456261.1|982066_982732_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_014829997.1|982802_983264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955073.1|983551_984685_-	DnaJ domain-containing protein	NA	A0A1V0SBY2	Catovirus	32.2	3.0e-27
983392:983443	attR	ATATTCATTAACAAAGCAAAAAGCACCACAAGTTAACTTGCGGCGCTTTTTG	NA	NA	NA	NA
WP_080551570.1|985064_986093_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013955074.1|986456_986798_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_075271047.1|986971_988207_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	33.4	4.3e-59
WP_167662361.1|988217_988820_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_167662362.1|988881_989784_+	DegV family protein	NA	NA	NA	NA	NA
WP_013455932.1|989946_990180_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_167662363.1|990219_990942_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_013456073.1|990941_992018_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_013955080.1|992143_992716_-	cell division protein Fic	NA	NA	NA	NA	NA
WP_013955081.1|992737_994159_-	YitT family protein	NA	NA	NA	NA	NA
WP_013955084.1|995686_997654_+	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	41.5	8.7e-131
WP_013955085.1|997776_998091_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	39.0	1.7e-12
WP_013955086.1|998143_998590_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	37.4	1.8e-12
WP_167662375.1|999933_1001535_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_167662364.1|1001827_1002826_-	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_038582834.1|1002941_1003151_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456532.1|1003287_1004247_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_013955092.1|1004442_1004838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013955093.1|1005016_1006261_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.3	1.1e-09
