The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050504	Streptomyces sp. DSM 40868 chromosome, complete genome	9195693	2226689	2233583	9195693		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_030790580.1|2226689_2227433_+	nucleotidyltransferase	NA	G3M9V9	Bacillus_virus	30.4	3.6e-13
WP_030790582.1|2227358_2228108_-	nucleotidyltransferase	NA	K4K696	Caulobacter_phage	37.0	1.1e-06
WP_030790585.1|2228112_2229120_-	ADP-ribosylglycohydrolase family protein	NA	A0A1I9SA26	Rhodococcus_phage	31.6	5.2e-23
WP_030790588.1|2229186_2230248_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_030790591.1|2230261_2230879_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.7	1.8e-10
WP_051816086.1|2230875_2231907_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	28.2	5.0e-05
WP_078637733.1|2231925_2232465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078637734.1|2232449_2233583_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.3	7.2e-21
>prophage 2
NZ_CP050504	Streptomyces sp. DSM 40868 chromosome, complete genome	9195693	8315451	8388727	9195693	integrase,transposase	Actinomyces_phage(11.11%)	51	8328954:8328991	8386150:8386187
WP_167513381.1|8315451_8316414_-|integrase	site-specific integrase	integrase	A0A2P1CI94	Actinomyces_phage	27.9	6.1e-13
WP_167513079.1|8321785_8322655_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_167513080.1|8322720_8324553_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_051816360.1|8324554_8325265_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_167513081.1|8325483_8327826_+	CRISPR-associated endonuclease Cas3''	NA	NA	NA	NA	NA
8328954:8328991	attL	GGTGGCGGTCGCCCTCCGGGGCGGCCGAGGATCGCAAC	NA	NA	NA	NA
WP_037703471.1|8329324_8330509_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_167513382.1|8331519_8331813_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_157855698.1|8332961_8333102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030795374.1|8333189_8333882_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_030795377.1|8333912_8334491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030795380.1|8334580_8335615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030795382.1|8335793_8336216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078637880.1|8337334_8337610_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_051816346.1|8337712_8338624_+	helix-turn-helix domain-containing protein	NA	A0A1J0MBX1	Streptomyces_phage	28.2	2.1e-10
WP_030795389.1|8338661_8339492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157855699.1|8339669_8340014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157855700.1|8341215_8341557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167513082.1|8342216_8342507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157855701.1|8342907_8343261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051816349.1|8345172_8345796_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_030795409.1|8345967_8346174_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167512927.1|8346237_8347326_+|integrase	site-specific integrase	integrase	Q8LTU1	Saccharomonospora_phage	24.0	1.4e-18
WP_157855685.1|8347376_8347535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157855684.1|8348134_8348323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037703389.1|8348389_8348899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030794508.1|8349215_8350325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157855683.1|8350418_8350694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051816285.1|8351680_8353612_-	AAA family ATPase	NA	G3MA40	Bacillus_virus	22.1	3.7e-09
WP_030794503.1|8353608_8355579_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_037703386.1|8357874_8358855_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_051816283.1|8358931_8361619_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_030794489.1|8362008_8362890_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_030794486.1|8362918_8363758_-	alpha/beta hydrolase	NA	A0A1I9SC21	Mycobacterium_phage	34.0	8.3e-06
WP_030794483.1|8363823_8364399_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_051816281.1|8364395_8364938_-	DoxX family protein	NA	NA	NA	NA	NA
WP_078637851.1|8364976_8365576_-	hydrolase	NA	NA	NA	NA	NA
WP_030794475.1|8365845_8367744_-	amidohydrolase	NA	NA	NA	NA	NA
WP_157855682.1|8367824_8368214_-	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_030794469.1|8368312_8369020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030794466.1|8369144_8370113_-	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	37.6	1.4e-57
WP_030794463.1|8370282_8371254_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	38.3	3.7e-42
WP_063766474.1|8371617_8372610_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106980824.1|8373387_8373846_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_030794453.1|8373735_8376474_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_030794450.1|8376597_8377863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037703384.1|8377867_8381515_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	22.8	2.2e-50
WP_030794446.1|8381838_8382357_-	DUF4396 domain-containing protein	NA	NA	NA	NA	NA
WP_030794443.1|8382845_8384045_+	MFS transporter	NA	NA	NA	NA	NA
WP_030794440.1|8384660_8384948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167513083.1|8386268_8386643_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.2	7.4e-23
8386150:8386187	attR	GGTGGCGGTCGCCCTCCGGGGCGGCCGAGGATCGCAAC	NA	NA	NA	NA
WP_078637885.1|8388328_8388727_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP050504	Streptomyces sp. DSM 40868 chromosome, complete genome	9195693	8501548	8561993	9195693	transposase	Streptomyces_phage(44.44%)	55	NA	NA
WP_037703471.1|8501548_8502733_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_157855693.1|8502870_8503473_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_030795042.1|8503970_8504264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030795044.1|8504276_8505095_+	DUF317 domain-containing protein	NA	NA	NA	NA	NA
WP_030795047.1|8505213_8505909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030795050.1|8505987_8506467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030795053.1|8506550_8508272_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_078637869.1|8508268_8508931_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_030795064.1|8509252_8509444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167513088.1|8509440_8510919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030795070.1|8510915_8511560_-	WhiB family transcriptional regulator	NA	A0A023ZXD5	Mycobacterium_phage	40.5	1.9e-10
WP_030795073.1|8511723_8512416_-	hypothetical protein	NA	K4IBK0	Streptomyces_phage	47.3	5.0e-49
WP_030795076.1|8512418_8513330_-	DNA-binding protein	NA	A0A1J0MC24	Streptomyces_phage	38.0	3.9e-09
WP_030795079.1|8514050_8514491_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_051816314.1|8514503_8515415_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_030795085.1|8516035_8516563_+	hypothetical protein	NA	V5UP92	Mycobacterium_phage	30.4	1.8e-11
WP_030795088.1|8516559_8517744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030795090.1|8517740_8518337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051816316.1|8518451_8518784_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_106980841.1|8518935_8519753_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_030795569.1|8520661_8520886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106980841.1|8521058_8521875_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_078637828.1|8522319_8523306_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_030794044.1|8523611_8523932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030794047.1|8524987_8525182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078637829.1|8525149_8525722_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_157855674.1|8526366_8526585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030794054.1|8526807_8528199_-	hypothetical protein	NA	K4IBI5	Streptomyces_phage	30.6	5.9e-33
WP_030794057.1|8529433_8530480_-	anthranilate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_030794060.1|8530675_8531566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106980819.1|8531562_8532717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030794067.1|8532713_8534258_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_030794070.1|8534250_8534871_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_051816220.1|8534884_8535799_+	NAD-dependent epimerase/dehydratase family protein	NA	Q58M85	Prochlorococcus_phage	28.3	4.8e-15
WP_078637831.1|8535795_8536725_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_051816222.1|8536754_8537816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030794080.1|8537914_8538622_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_037703336.1|8538602_8539094_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_051816234.1|8539268_8540696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078637833.1|8540692_8541181_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_030794092.1|8541598_8542078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030794094.1|8542077_8543472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030794095.1|8543468_8544905_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	31.2	1.7e-30
WP_030794097.1|8544967_8546080_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_030794099.1|8546097_8548917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051816236.1|8549392_8550481_+	methyltransferase domain-containing protein	NA	A0A1J0MC37	Streptomyces_phage	36.6	2.0e-44
WP_030794112.1|8553220_8553619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030794114.1|8553711_8554932_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	54.6	8.4e-108
WP_030794116.1|8555486_8555999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157855675.1|8556089_8557454_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_030794125.1|8558206_8558551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030794131.1|8559427_8559967_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_030794133.1|8560045_8560330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030794136.1|8560326_8560980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106980841.1|8561175_8561993_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
