The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046173	Nocardia terpenica strain AUSMDU00012715 chromosome, complete genome	9306871	2178734	2248102	9306871	capsid,tRNA,terminase,coat,protease,integrase	Mycobacterium_phage(17.24%)	74	2213992:2214007	2237255:2237270
WP_167491387.1|2178734_2179718_-	hypothetical protein	NA	A0A2H4J9K9	uncultured_Caudovirales_phage	59.7	1.4e-81
WP_167485851.1|2180019_2181696_-	hypothetical protein	NA	A0A1B3AZV1	Gordonia_phage	37.4	1.2e-96
WP_167485852.1|2182399_2185972_-	hypothetical protein	NA	E0YQ16	Mycobacterium_phage	27.3	7.7e-53
WP_167485853.1|2185999_2186383_-	hypothetical protein	NA	G9FH94	Rhodococcus_phage	41.1	5.4e-13
WP_167485854.1|2186393_2187032_-	hypothetical protein	NA	A0A142KAP1	Gordonia_phage	31.1	1.6e-17
WP_167485855.1|2187048_2187819_-	hypothetical protein	NA	A0A220NQQ6	Corynebacterium_phage	46.7	2.2e-05
WP_167485856.1|2187815_2188256_-	hypothetical protein	NA	A0A1J0MC59	Streptomyces_phage	36.5	9.9e-11
WP_167485857.1|2188252_2188594_-	hypothetical protein	NA	A0A1V0E617	Streptomyces_phage	46.7	8.5e-18
WP_167485858.1|2188606_2188933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485859.1|2188929_2189358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485860.1|2189435_2190341_-|coat	P22 coat protein - protein 5 domain protein	coat	E5DV53	Deep-sea_thermophilic_phage	38.4	4.7e-47
WP_167485861.1|2190371_2191091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156674249.1|2191194_2191368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485862.1|2191364_2193155_-	hypothetical protein	NA	K4IBG1	Streptomyces_phage	30.8	1.1e-60
WP_167485863.1|2193196_2193871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167485864.1|2193859_2195467_-|capsid	capsid protein	capsid	A0A162E1F1	Gordonia_phage	41.4	8.2e-95
WP_167485865.1|2195469_2196777_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E630	Streptomyces_phage	45.5	2.4e-97
WP_167485866.1|2196773_2197196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485867.1|2197836_2198154_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_167485868.1|2198154_2198451_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_167485869.1|2198447_2199863_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_167485870.1|2199866_2200139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167485871.1|2200204_2200639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167485872.1|2200646_2201366_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_167485873.1|2201455_2204128_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	33.8	4.1e-59
WP_167485874.1|2204129_2204795_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_167485875.1|2204794_2205337_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_167485876.1|2205336_2205942_-	DNA transporter	NA	NA	NA	NA	NA
WP_167485877.1|2205938_2206808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485878.1|2206804_2207671_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	NA	NA	NA	NA
WP_167485879.1|2207782_2208049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485880.1|2208052_2208754_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_167485881.1|2209430_2210666_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167485882.1|2210836_2212396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485883.1|2212606_2213350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485884.1|2213392_2213839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485885.1|2213843_2214413_-	hypothetical protein	NA	A0A222ZHS9	Arthrobacter_phage	35.2	1.4e-17
2213992:2214007	attL	CGCACACCGGAATTCG	NA	NA	NA	NA
WP_167485886.1|2214409_2214988_-	ParB N-terminal domain-containing protein	NA	A0A0F6YS52	Mycobacterium_phage	72.3	8.3e-74
WP_167485887.1|2214984_2216067_-	phosphoadenosine phosphosulfate reductase family protein	NA	X2KT43	Mycobacterium_phage	62.8	1.3e-133
WP_167485888.1|2216089_2216689_-	hypothetical protein	NA	A0A0U4B623	Arthrobacter_phage	43.9	2.8e-32
WP_167485889.1|2216688_2217150_-	hypothetical protein	NA	G8IR46	Mycobacterium_virus	52.5	5.0e-13
WP_167485890.1|2217973_2218486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485891.1|2218537_2218843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485892.1|2219005_2219632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485893.1|2219761_2219983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485894.1|2219979_2220429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485895.1|2220506_2221118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485896.1|2221644_2221893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485897.1|2222046_2222604_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_167485898.1|2222930_2223476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485899.1|2223517_2223679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485900.1|2223675_2224158_-	hypothetical protein	NA	A0A1J0MCA7	Streptomyces_phage	53.8	1.3e-08
WP_167485901.1|2224356_2224821_-	hypothetical protein	NA	I4AZL1	Saccharomonospora_phage	32.2	1.3e-05
WP_167484343.1|2224842_2225958_-	hypothetical protein	NA	A0A0A7RVZ8	Mycobacterium_phage	38.4	1.5e-47
WP_167485902.1|2226592_2227672_-	AAA family ATPase	NA	B5U5A4	Mycobacterium_virus	53.8	4.4e-84
WP_167485903.1|2227688_2228636_-	YqaJ viral recombinase family protein	NA	A0A142F2J2	Mycobacterium_phage	30.4	8.4e-23
WP_167485904.1|2228632_2228773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485905.1|2228769_2229060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485906.1|2229146_2229368_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167485907.1|2229622_2229997_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167485908.1|2230204_2230762_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_167485909.1|2230811_2232056_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A162E140	Gordonia_phage	35.8	1.7e-47
WP_167485910.1|2232523_2233003_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_167485911.1|2233102_2234590_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	5.7e-26
WP_167485912.1|2234653_2235907_+	bifunctional glycosyltransferase family 2/GtrA family protein	NA	NA	NA	NA	NA
WP_167485913.1|2235976_2237965_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
2237255:2237270	attR	CGCACACCGGAATTCG	NA	NA	NA	NA
WP_167485914.1|2237978_2240549_-	polynucleotide kinase-phosphatase	NA	A0A2L0UZN4	Agrobacterium_phage	25.2	8.1e-20
WP_167485915.1|2240548_2242042_-	3' terminal RNA ribose 2'-O-methyltransferase Hen1	NA	NA	NA	NA	NA
WP_167485916.1|2242112_2242682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167485917.1|2242905_2243472_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_167485918.1|2243628_2245008_+	trigger factor	NA	NA	NA	NA	NA
WP_167485919.1|2245205_2245793_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	47.8	1.7e-42
WP_167485920.1|2245820_2246486_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2H4JEX1	uncultured_Caudovirales_phage	30.0	1.5e-05
WP_167485921.1|2246818_2248102_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.1	3.3e-139
>prophage 2
NZ_CP046173	Nocardia terpenica strain AUSMDU00012715 chromosome, complete genome	9306871	5754723	5790121	9306871	portal,capsid,tail	Mycobacterium_phage(26.92%)	42	NA	NA
WP_167488548.1|5754723_5754975_-	hypothetical protein	NA	A0A0E3XA12	Gordonia_phage	62.3	4.8e-18
WP_167488549.1|5754974_5755733_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZX49	Mycobacterium_phage	57.2	1.0e-71
WP_167488550.1|5755733_5756252_-	DUF2744 domain-containing protein	NA	G9FH98	Rhodococcus_phage	33.9	1.2e-15
WP_167488551.1|5756274_5758173_-|tail	phage tail protein	tail	G9FH97	Rhodococcus_phage	39.1	2.4e-117
WP_167488552.1|5758169_5759162_-|tail	phage tail protein	tail	G9FH96	Rhodococcus_phage	38.4	2.5e-54
WP_167488553.1|5759246_5763992_-	hypothetical protein	NA	G1JXZ0	Mycobacterium_virus	41.9	2.0e-32
WP_167488554.1|5763995_5764349_-	hypothetical protein	NA	A0A2D1G9P6	Mycobacterium_phage	45.6	1.0e-18
WP_167488555.1|5764381_5764696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167488556.1|5764807_5765434_-	hypothetical protein	NA	A0A160DDD4	Gordonia_phage	33.8	2.9e-16
WP_167488557.1|5765543_5765957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167488558.1|5765949_5766222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167488559.1|5766223_5766586_-	hypothetical protein	NA	M4W615	Mycobacterium_phage	30.6	3.4e-09
WP_167488560.1|5767052_5768114_-|capsid	phage major capsid protein	capsid	I3NL99	Bifidobacterium_phage	48.3	2.6e-73
WP_167488561.1|5768194_5768671_-	hypothetical protein	NA	G1D4C0	Mycobacterium_virus	31.4	2.2e-08
WP_167488562.1|5768822_5769107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167488563.1|5769060_5770014_-	hypothetical protein	NA	A0A2P1A0Q1	Gordonia_phage	28.3	7.4e-27
WP_167488564.1|5770010_5771468_-|portal	phage portal protein	portal	M4W9R6	Mycobacterium_phage	42.0	1.1e-87
WP_167488565.1|5771468_5772938_-	hypothetical protein	NA	K4HN93	Propionibacterium_phage	35.4	1.6e-68
WP_167488566.1|5772900_5773101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167488567.1|5773117_5773807_-	DNA cytosine methyltransferase	NA	G1DAQ1	Mycobacterium_virus	60.8	1.0e-70
WP_167488568.1|5773788_5774274_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_167491762.1|5774652_5774847_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_167488569.1|5775063_5775420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167488570.1|5775480_5775678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167488571.1|5776658_5777147_-	DNA cytosine methyltransferase	NA	A0A1C9M029	Mycobacterium_phage	64.8	2.0e-60
WP_167488572.1|5777297_5777573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167488573.1|5777916_5778420_-	hypothetical protein	NA	A0A2H4JAA0	uncultured_Caudovirales_phage	40.0	1.4e-13
WP_167488574.1|5778406_5778793_-	hypothetical protein	NA	G9FH66	Rhodococcus_phage	51.3	1.6e-25
WP_167488575.1|5778797_5779523_-	alpha/beta fold hydrolase	NA	A0A2L1IWJ0	Gordonia_phage	30.2	9.9e-16
WP_167488576.1|5779611_5779794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167488577.1|5779786_5780164_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_167488578.1|5780180_5781302_-	AAA family ATPase	NA	A0A142K988	Gordonia_phage	52.1	2.1e-17
WP_167488579.1|5781730_5782357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167488580.1|5782353_5783139_-	Bro-N domain-containing protein	NA	A0A160DFU1	Gordonia_phage	30.1	4.0e-10
WP_167488581.1|5783184_5783436_-	hypothetical protein	NA	A0A2H4J2A7	uncultured_Caudovirales_phage	42.4	1.4e-09
WP_167488582.1|5783470_5784151_-	hypothetical protein	NA	A0A2H4JAX5	uncultured_Caudovirales_phage	50.7	2.1e-47
WP_167488583.1|5784360_5785182_-	hypothetical protein	NA	A0A2H4J3W2	uncultured_Caudovirales_phage	40.6	1.8e-50
WP_167488584.1|5785217_5786030_-	hypothetical protein	NA	H6U5J3	Mycobacterium_phage	43.8	1.8e-42
WP_167488585.1|5786300_5786639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167488586.1|5786846_5787332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167488587.1|5787696_5788362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167488588.1|5788525_5790121_-	recombinase family protein	NA	A0A222ZSW3	Mycobacterium_phage	30.5	3.1e-38
>prophage 3
NZ_CP046173	Nocardia terpenica strain AUSMDU00012715 chromosome, complete genome	9306871	8565202	8591985	9306871	transposase,integrase,tRNA	Staphylococcus_phage(16.67%)	24	8585562:8585621	8590946:8591031
WP_167490690.1|8565202_8568058_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	45.2	5.9e-213
WP_167490691.1|8568061_8568868_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_167490692.1|8568955_8569654_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_167490693.1|8569747_8571085_+	glycogen debranching protein	NA	NA	NA	NA	NA
WP_167490694.1|8571182_8571914_+	glycoside hydrolase	NA	A0A2P0ZLG2	Lactobacillus_phage	29.0	8.8e-12
WP_167490695.1|8572067_8572364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490696.1|8572468_8573194_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	1.4e-25
WP_167490697.1|8573190_8575005_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_167490698.1|8575072_8575867_-	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_167490699.1|8576043_8577129_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.3	2.1e-22
WP_167490700.1|8577148_8577640_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167490701.1|8577747_8578917_+	thiolase family protein	NA	NA	NA	NA	NA
WP_167490702.1|8578938_8579913_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_167490703.1|8579983_8580505_-	TIGR04338 family metallohydrolase	NA	NA	NA	NA	NA
WP_167492093.1|8580515_8581346_-	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_167490704.1|8581418_8582480_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_167490705.1|8582469_8582715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490706.1|8583495_8584182_+	hypothetical protein	NA	Q8JKX3	Natrialba_phage	31.4	9.7e-21
WP_167490707.1|8584680_8585106_+	hypothetical protein	NA	NA	NA	NA	NA
8585562:8585621	attL	GTATTGACCCGGAACTAATTGGTTGAAGTGTAAATCGTGTGTGGGGCTTCGAAGTACCCT	NA	NA	NA	NA
WP_167490708.1|8586479_8586872_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167490709.1|8586861_8589108_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_167490710.1|8589104_8590187_-|integrase	site-specific integrase	integrase	A0A1B0V6A4	Roseobacter_phage	31.8	4.2e-10
WP_167490711.1|8590748_8590952_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_167492094.1|8590959_8591985_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
8590946:8591031	attR	GTATTGACCCGGAACTAATTGGTTGAAGTGTAAATCGTGTGTGGGGCTTCGAAGTACCCTCGGACCTGACCGGGCAGCTTCTGCAC	NA	NA	NA	NA
>prophage 4
NZ_CP046173	Nocardia terpenica strain AUSMDU00012715 chromosome, complete genome	9306871	8643661	8685956	9306871	transposase,integrase	Gordonia_phage(28.57%)	25	8670947:8670963	8685031:8685047
WP_167492094.1|8643661_8644687_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167490740.1|8645468_8645918_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B3AZE5	Gordonia_phage	44.1	1.4e-20
WP_167490741.1|8646054_8646366_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	43.6	2.3e-14
WP_167490742.1|8647574_8647889_+	transglycosylase family protein	NA	A0A1I9SA30	Rhodococcus_phage	52.5	8.1e-23
WP_167490743.1|8648413_8648602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490744.1|8649811_8651167_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A223FZJ1	Rhodococcus_phage	43.5	1.6e-88
WP_167490745.1|8651163_8651541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490746.1|8651533_8651926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167492098.1|8653214_8653817_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_167490747.1|8655544_8656072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490748.1|8656218_8657235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490749.1|8657293_8657737_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167490750.1|8659884_8661066_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	43.9	1.8e-06
WP_167490751.1|8661338_8661650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490752.1|8662482_8663679_-	hypothetical protein	NA	J9PVC2	Bacillus_phage	36.5	3.4e-37
WP_167490753.1|8663695_8664937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167492099.1|8666758_8668216_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_167490754.1|8668325_8668505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490755.1|8668627_8669071_-|transposase	transposase	transposase	NA	NA	NA	NA
8670947:8670963	attL	GCGCAGGATGTTGGCCA	NA	NA	NA	NA
WP_167490756.1|8673465_8673783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167492100.1|8679927_8681358_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.5	3.9e-56
WP_167490757.1|8681530_8683135_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_167490758.1|8683131_8683455_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167490759.1|8683451_8684528_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_167492101.1|8684753_8685956_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
8685031:8685047	attR	TGGCCAACATCCTGCGC	NA	NA	NA	NA
>prophage 5
NZ_CP046173	Nocardia terpenica strain AUSMDU00012715 chromosome, complete genome	9306871	8699680	8843567	9306871	transposase,integrase	Gordonia_phage(21.05%)	106	8729066:8729125	8841910:8843274
WP_167492094.1|8699680_8700706_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167490770.1|8700919_8701429_+	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	53.3	4.5e-31
WP_167490771.1|8702764_8703665_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.0	3.5e-18
WP_167490772.1|8705409_8706618_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_167490773.1|8708435_8708603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490774.1|8708687_8708837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490775.1|8709656_8711417_-	hypothetical protein	NA	J9PVC2	Bacillus_phage	37.9	2.0e-41
WP_167492102.1|8711598_8711649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490776.1|8712106_8712355_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167490777.1|8712418_8713336_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167490771.1|8713395_8714295_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.0	3.5e-18
WP_167492094.1|8714390_8715416_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167490778.1|8715497_8715704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490779.1|8715839_8717294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167492103.1|8717783_8719085_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	83.3	5.3e-201
WP_167490780.1|8719090_8719552_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_167490781.1|8719590_8719764_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167492094.1|8719810_8720836_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167490782.1|8720991_8721336_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167490783.1|8721335_8722055_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	44.0	2.5e-35
WP_167490784.1|8723890_8725096_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_167490785.1|8725077_8726589_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_167484370.1|8726679_8727207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490786.1|8727581_8728730_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.8	9.5e-37
8729066:8729125	attL	TTGGCGGGTTTTCGGTCTCGGGAATGTTGGGGACGAGTGGGCCGGCCAGGCCGTGGTGGT	NA	NA	NA	NA
WP_167490787.1|8731897_8732560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490788.1|8732652_8732865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490789.1|8733262_8734396_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_167490790.1|8735155_8735761_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_167490791.1|8735844_8736318_-	ester cyclase	NA	NA	NA	NA	NA
WP_167490792.1|8736709_8736919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167492104.1|8738424_8738682_-|transposase	transposase	transposase	A0A0N7C035	Escherichia_phage	50.7	4.0e-12
WP_167492104.1|8740124_8740382_+|transposase	transposase	transposase	A0A0N7C035	Escherichia_phage	50.7	4.0e-12
WP_167492105.1|8740513_8742250_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_167490793.1|8742774_8743821_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_167492106.1|8743817_8744819_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_167490794.1|8744815_8745868_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_167490795.1|8745864_8746974_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_167492107.1|8748861_8750142_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_167490796.1|8750193_8751516_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167490797.1|8754186_8754390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490798.1|8754570_8755011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490799.1|8755481_8755685_+	transglycosylase family protein	NA	NA	NA	NA	NA
WP_167490800.1|8755737_8756364_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_167490801.1|8756578_8757235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490802.1|8757750_8758065_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_167490803.1|8758452_8759628_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_167490796.1|8759986_8761309_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167490804.1|8761401_8761713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490805.1|8762142_8762712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167492094.1|8762708_8763734_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167490806.1|8765621_8765840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490807.1|8765958_8766294_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_167490808.1|8766616_8766967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490809.1|8767159_8768071_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167492103.1|8768048_8769350_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	83.3	5.3e-201
WP_167490780.1|8769355_8769817_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_167490810.1|8770829_8771651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167492094.1|8772059_8773085_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167490811.1|8773313_8773487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490812.1|8773770_8774130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490813.1|8774384_8776127_+	FAD-dependent oxidoreductase	NA	A0A2K9L4X0	Tupanvirus	29.6	1.7e-21
WP_167490814.1|8776169_8778572_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_167490815.1|8778700_8778868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490816.1|8780641_8780995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490817.1|8781132_8781516_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_167492105.1|8782051_8783788_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_167492104.1|8783919_8784177_-|transposase	transposase	transposase	A0A0N7C035	Escherichia_phage	50.7	4.0e-12
WP_167490741.1|8786250_8786562_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	43.6	2.3e-14
WP_167490818.1|8786576_8786783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167484369.1|8789469_8790285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490819.1|8792109_8792694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490820.1|8792739_8792967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490821.1|8793011_8794028_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167490822.1|8795260_8795854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490823.1|8796435_8797197_+	DUF4239 domain-containing protein	NA	NA	NA	NA	NA
WP_167490824.1|8798126_8799248_-	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_167490825.1|8799397_8800036_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_167490741.1|8800914_8801226_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	43.6	2.3e-14
WP_167492108.1|8801227_8801908_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	43.8	3.0e-30
WP_167490826.1|8802111_8802429_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167490827.1|8802434_8802734_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167490828.1|8804839_8805811_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_167490829.1|8805807_8807496_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_167490830.1|8807489_8808485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490831.1|8808481_8809288_+	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_167492109.1|8811973_8812324_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167490832.1|8812370_8812925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490833.1|8812921_8813890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167492110.1|8814033_8814564_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_167490834.1|8814766_8815900_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_167490835.1|8817195_8818257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490836.1|8818249_8819212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490837.1|8820562_8821993_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.9	2.2e-51
WP_167490838.1|8823979_8825260_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_167490839.1|8825428_8826412_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167490840.1|8828608_8828920_+|transposase	transposase	transposase	A0A2P1JR32	Mycobacterium_phage	45.3	1.4e-11
WP_167490841.1|8829019_8830309_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.9	1.9e-38
WP_167490842.1|8830390_8831374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490843.1|8831370_8832324_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_167490844.1|8832429_8832576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490845.1|8832810_8833092_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167490846.1|8834794_8835514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490847.1|8835435_8837172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490848.1|8839045_8839231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490849.1|8840627_8841629_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167492111.1|8842067_8843567_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	29.0	1.1e-08
8841910:8843274	attR	ACCACCACGGCCTGGCCGGCCCACTCGTCCCCAACATTCCCGAGACCGAAAACCCGCCAAGGGCGTGTCCGAGATCTGGCTCTTGTGCACTTCGGGTGGTGATTCGGTGATCTTGACGGCACGATGTTGCGGTGTGCGAGGTGAATGTGCCTGCTGCCATGGTGTTTTCGGGGTTGTCGCCGCTGGTGGTGGAGGATGTGGTCGACGAGGGTCGTGAGGTTGTGGTGTGGGCGCGAACGCCCGACGATCCGGCGGCGTGTCCGGGCTGTAGTGCCAGGTCCGCGCGGGTGCACGGCTATCACTGGCGCAGACTCGCCGATGTGCCACTCGACGGGCGTCCGGTGATCGTAAACGTGCAGGTCCGCCGACTGGTCCGCCCAACCGCAGGCTGTCGCAACACCTTTCGCGAGCAGGTAGCCGGTGTTCTGGAACGCTACCAGCGCCGCACCACACGCCTGGCCTGCCAGGTGCAGTCGGTGGTGCGCGAACTTGCCGGGCAGGCCGGCGCCCGGCTGCTGGACCAGCTGTCGGTCCGGTTGTCCCGGAATACCGCCGTGCGGGTGCTGCTGGGAATCCCCTTGCCGCAGCGGCCGATTCCGGCGGTGGTCAGCGTCGACGATTTCGCGTTGCTGCGTCGGCACCGGTACGCCACGGTCGTGATCGACCCGGTTACCCACGACCGCATCGATGTCCTATCCGACCGTAAGTCCGCCACCCTCGCCGCGTGGCTGGCCGGGCACGCGCAGATCACGACGGTCGTGCGAGACGGTTCCACGACCTATGCCGAAGGCGTGCGTCGTGCACGACCTGCGGCAACCCAAGTTTCGGACCGCTGGCATCTGTGGCACGGCCTGGCCCAGGTGGTGGAGAAAGCCGTCGCCGCACACGGCCGATGCTGGGCCGCCGCCGGCCCGAAACGACACCGGCTGACGCGCGAGACCACCACCATCGAACGCTGGCACGCCGTGCACGAGCTGCTCGACTCCGGTGTCGGGCTGCTGGATTGTTCCCGCCGACTGGGGCTGGCGCTGAACACTGTGAAACGGTATTCCCGTGCGCCGGAGCCGGATTCGCTGCGTCGACCGCCGCAGTATCGGCCCGGGCTGGTCGATCCCTACCGTGATCACCTGCGGTCCCGACGCGCCGCGGAGCCCGGCGTGCCGGTCAGACAGCTGTTCACCGAGATCAAGGCCCTCGGCTACACCGGCGGGCTGAATCTGCTCTACCGATACGTCAACGAAGGGCGACTCGCCGGTGACCGGGTCGCGGTCTCGGGCCGTAAGCTCGCCGGCTGGATTATGACCCGCCCCTCCGAACTCTCCGACACCCGCCGCGCTCACCTGGGCGAACTCGTCGCCGCCTGCC	NA	NA	NA	NA
>prophage 6
NZ_CP046173	Nocardia terpenica strain AUSMDU00012715 chromosome, complete genome	9306871	8862128	9017704	9306871	tRNA,transposase,integrase,tail	Bacillus_phage(20.0%)	114	8919974:8919991	8973778:8973795
WP_167490860.1|8862128_8862560_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_167490861.1|8864066_8864237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490862.1|8864627_8865071_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_167490863.1|8865097_8866399_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	36.8	1.0e-39
WP_167490864.1|8866999_8867428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167484370.1|8869473_8870001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490865.1|8871148_8871676_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167492112.1|8872030_8872477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490866.1|8876370_8877834_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_167490867.1|8878082_8879252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490868.1|8879254_8880283_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_167492113.1|8880325_8882206_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_167492114.1|8882409_8883063_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_167490869.1|8883472_8885212_-	hypothetical protein	NA	J9PVC2	Bacillus_phage	36.7	3.1e-39
WP_167492115.1|8887397_8888801_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167490870.1|8890599_8890845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167492116.1|8892721_8893456_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_167492117.1|8893681_8895541_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_167490868.1|8895583_8896612_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_167490867.1|8896614_8897784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490866.1|8898032_8899496_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_167490871.1|8899495_8901232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490865.1|8904192_8904720_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167484370.1|8905867_8906395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490803.1|8907427_8908603_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_167490872.1|8908846_8909086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490873.1|8909252_8909789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490874.1|8910010_8910826_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_167490875.1|8910836_8911106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490876.1|8911562_8911988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490877.1|8912427_8913090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490878.1|8913196_8913436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490879.1|8913630_8913927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490880.1|8913910_8914054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490881.1|8914209_8914446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490882.1|8914521_8914725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167492118.1|8914818_8915091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490883.1|8915083_8915410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490884.1|8915698_8916025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490885.1|8916390_8916552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490886.1|8916948_8917326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490887.1|8919470_8920928_+|transposase	transposase	transposase	NA	NA	NA	NA
8919974:8919991	attL	CGCGGTCACCGCCGCCCA	NA	NA	NA	NA
WP_167490873.1|8921069_8921606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490874.1|8921827_8922643_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_167490875.1|8922653_8922923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490888.1|8924707_8926183_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.9	7.1e-53
WP_167490889.1|8927159_8928392_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167490890.1|8928513_8928915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490891.1|8933156_8934200_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_167490892.1|8934716_8935538_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167492119.1|8935557_8936565_-	universal stress protein	NA	NA	NA	NA	NA
WP_167490893.1|8937306_8938260_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_167490894.1|8941623_8942970_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_167490895.1|8943890_8944277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490896.1|8944584_8944731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490897.1|8944907_8945354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490898.1|8946236_8946893_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167490708.1|8949308_8949701_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167490709.1|8949690_8951937_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_167490710.1|8951933_8953016_-|integrase	site-specific integrase	integrase	A0A1B0V6A4	Roseobacter_phage	31.8	4.2e-10
WP_167490899.1|8955742_8957074_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	25.9	6.0e-35
WP_167490900.1|8957100_8958096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490901.1|8958456_8959050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490741.1|8959136_8959448_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	43.6	2.3e-14
WP_167492094.1|8961732_8962758_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167490902.1|8962989_8963508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490903.1|8963623_8964676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490904.1|8964719_8966099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167492120.1|8967492_8968482_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_167490905.1|8968951_8969944_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_167492121.1|8970996_8972103_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_167490906.1|8972099_8973065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490907.1|8973233_8974445_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
8973778:8973795	attR	TGGGCGGCGGTGACCGCG	NA	NA	NA	NA
WP_167492122.1|8974753_8975800_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_167490908.1|8975979_8977032_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_167492094.1|8978283_8979309_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167490909.1|8980667_8981873_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_167490910.1|8982026_8982998_+	DUF5593 domain-containg protein	NA	NA	NA	NA	NA
WP_167490911.1|8983633_8984287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490912.1|8984339_8985488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490913.1|8985533_8985959_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167490914.1|8986795_8987587_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167490915.1|8988393_8989194_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_167490916.1|8989194_8989986_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167490917.1|8990633_8991425_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167490918.1|8991333_8992074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490919.1|8992089_8992644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490920.1|8993214_8994249_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_167490921.1|8994405_8994975_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_167490922.1|8994944_8995781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490923.1|8995777_8996464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490924.1|8996460_8997684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490925.1|8997680_8999726_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	34.7	3.1e-30
WP_167492123.1|8999778_9001572_-	radical SAM protein	NA	NA	NA	NA	NA
WP_167490771.1|9002349_9003249_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.0	3.5e-18
WP_167490926.1|9003246_9003498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490927.1|9003534_9004041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490928.1|9004652_9005624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490929.1|9005635_9006112_+	dethiobiotin synthetase	NA	NA	NA	NA	NA
WP_167490930.1|9006415_9007339_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	38.3	6.2e-39
WP_167490931.1|9007335_9008049_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_167490932.1|9008206_9008518_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_167492124.1|9008675_9009251_+	MspA family porin	NA	NA	NA	NA	NA
WP_167490933.1|9009310_9010456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490934.1|9010482_9011019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490935.1|9012665_9012932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490936.1|9013129_9013522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490937.1|9013610_9013973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490938.1|9013969_9014596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167490939.1|9015123_9015402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490940.1|9015532_9015829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490941.1|9015858_9016032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490942.1|9016229_9016967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167490943.1|9016960_9017704_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	A0A167R1P4	Powai_lake_megavirus	22.8	5.4e-09
