The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039734	Sulfurospirillum sp. ACSDCE chromosome, complete genome	2737849	768621	780062	2737849		Escherichia_phage(22.22%)	10	NA	NA
WP_167749440.1|768621_769959_-	lipopolysaccharide biosynthesis protein RfbH	NA	A0A218MN59	uncultured_virus	35.3	9.3e-68
WP_096047221.1|770884_772633_-	thiamine pyrophosphate-binding protein	NA	E4WLQ6	Ostreococcus_tauri_virus	34.0	1.2e-83
WP_167750624.1|772629_773727_-	CDP-glucose 4,6-dehydratase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	27.9	5.5e-18
WP_096047222.1|773726_774500_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_096047223.1|774518_775388_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	36.8	2.9e-38
WP_096047224.1|775380_775956_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.3	2.6e-43
WP_167749441.1|775988_776807_-	DNA ligase	NA	A0A1X9VNU1	Mimivirus	35.2	6.3e-35
WP_167749442.1|776807_777830_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	46.1	1.2e-78
WP_167749443.1|777826_778690_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.6	2.7e-105
WP_096047228.1|778691_780062_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	32.7	9.8e-57
>prophage 2
NZ_CP039734	Sulfurospirillum sp. ACSDCE chromosome, complete genome	2737849	891162	898814	2737849		Campylobacter_virus(33.33%)	9	NA	NA
WP_096047310.1|891162_891843_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	55.8	5.2e-67
WP_087439308.1|891842_892421_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2P1CLA1	Pantoea_phage	30.5	1.4e-12
WP_162494884.1|892563_892713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167749514.1|892885_894349_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087439310.1|894524_895064_+	6-carboxytetrahydropterin synthase	NA	D5GVR0	Campylobacter_virus	42.7	8.9e-38
WP_087439311.1|895165_895864_-	dUTPase	NA	NA	NA	NA	NA
WP_096047311.1|895879_896662_-	patatin	NA	G8DDB1	Micromonas_pusilla_virus	26.5	2.4e-07
WP_096047312.1|896646_897420_-	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	46.3	1.2e-62
WP_096047313.1|897416_898814_-	phosphate starvation-inducible protein PhoH	NA	D5GV52	Campylobacter_virus	39.9	7.6e-81
>prophage 3
NZ_CP039734	Sulfurospirillum sp. ACSDCE chromosome, complete genome	2737849	2670786	2729793	2737849	protease,integrase,tRNA,transposase	Bacillus_phage(18.18%)	60	2668073:2668095	2729827:2729849
2668073:2668095	attL	TGAGTTTTGCAAGATGTCTAATA	NA	NA	NA	NA
WP_167750569.1|2670786_2672037_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_087438591.1|2672407_2673280_+	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_087438593.1|2674874_2675372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087438594.1|2675368_2675809_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_087438595.1|2675839_2677141_-	TolC family protein	NA	NA	NA	NA	NA
WP_167750570.1|2677271_2678429_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_167750571.1|2678436_2680050_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.8	2.5e-11
WP_167750572.1|2680046_2681165_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_167750573.1|2681161_2682241_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_088437344.1|2682293_2682899_-	MarC family protein	NA	NA	NA	NA	NA
WP_087439857.1|2682964_2683570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088437345.1|2683640_2684300_+	DUF1847 domain-containing protein	NA	NA	NA	NA	NA
WP_167750574.1|2684363_2685728_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.8	4.0e-18
WP_087438600.1|2685720_2686398_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_087438601.1|2686387_2687446_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_167750575.1|2687445_2687988_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_087438603.1|2687984_2688752_-	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_087438604.1|2688751_2689645_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_096046614.1|2689646_2690948_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	26.9	1.0e-39
WP_167750576.1|2690954_2692019_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_088437347.1|2692093_2693809_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	1.1e-60
WP_088437348.1|2693809_2695207_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.7	4.8e-51
WP_088437349.1|2695193_2696603_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_167750577.1|2696734_2698666_+	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_167750578.1|2698662_2699220_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_167750579.1|2699233_2700268_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_087438612.1|2700321_2700546_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_167750580.1|2700538_2701258_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_087438613.1|2701254_2701524_+	acylphosphatase	NA	NA	NA	NA	NA
WP_167750581.1|2701529_2702969_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_167750582.1|2703040_2705149_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_167750583.1|2705145_2706357_+	acetate kinase	NA	NA	NA	NA	NA
WP_167750584.1|2706405_2706852_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	37.4	1.1e-20
WP_167750585.1|2706933_2707641_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_087438618.1|2707665_2708109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087438619.1|2708157_2709399_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_087438620.1|2709395_2711147_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_167750586.1|2711210_2712092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096046631.1|2712084_2712894_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_096046632.1|2712886_2714431_-	pilus (MSHA type) biogenesis protein MshL	NA	R9TEZ5	Vibrio_phage	25.7	3.2e-11
WP_096046633.1|2714399_2714828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096046634.1|2714824_2715472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167750587.1|2715464_2716991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167750588.1|2717049_2717940_-	GTPase Era	NA	NA	NA	NA	NA
WP_167750589.1|2717953_2719279_-	HslU--HslV peptidase ATPase subunit	NA	A0A1B2IDZ7	Erwinia_phage	24.3	2.7e-27
WP_167750590.1|2719275_2719821_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_167750591.1|2719826_2720273_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_167750592.1|2720286_2720709_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_096046641.1|2720715_2721945_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_167750593.1|2722101_2722347_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_167750594.1|2722346_2723330_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.9	8.6e-47
WP_167750595.1|2723326_2723758_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_096046645.1|2723744_2724467_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.9	1.8e-25
WP_167750596.1|2724485_2725757_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_096046647.1|2725753_2726584_-	adenylosuccinate lyase	NA	NA	NA	NA	NA
WP_096046648.1|2726647_2727373_-	arginyltransferase	NA	NA	NA	NA	NA
WP_167750597.1|2727376_2727547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167750598.1|2727677_2728235_+|integrase	site-specific integrase	integrase	A0A0H5AW64	Pseudomonas_phage	27.4	1.8e-09
WP_084613060.1|2728945_2729410_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_025343414.1|2729331_2729793_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
2729827:2729849	attR	TGAGTTTTGCAAGATGTCTAATA	NA	NA	NA	NA
