The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050382	Escherichia coli strain 52148 chromosome, complete genome	4859628	176562	274485	4859628	lysis,tail,terminase,protease,integrase,holin,transposase,tRNA,capsid,portal,plate,head	Escherichia_phage(49.06%)	101	186262:186297	283370:283405
WP_000187022.1|176562_177663_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|177702_178062_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|178061_178712_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|179042_180443_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|180425_181343_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|181609_182983_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001352356.1|183043_183820_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|183827_184832_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|184985_186137_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
186262:186297	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGC	NA	NA	NA	NA
WP_001005586.1|186734_189386_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556306.1|189567_191301_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274643.1|191515_192367_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323841.1|192353_192695_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204105.1|192696_193575_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184811.1|193540_195838_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|195888_196209_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|196223_197303_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039023143.1|197611_200113_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_000424840.1|200124_200787_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|200797_201901_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647894.1|202175_202793_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|202819_203725_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001295695.1|203817_205998_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007529.1|206326_207217_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|207565_209998_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|210000_211161_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|211437_211755_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797353.1|211938_212547_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|212607_212820_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001333520.1|213022_215221_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|215376_216402_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|216493_217453_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|217545_218076_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|218085_219417_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|219483_220410_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|220502_220988_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|221072_221318_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|221742_222588_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|222610_224119_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|224253_225264_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|225360_226107_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323547.1|226111_226540_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655989.1|226566_226866_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|227077_227518_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|227618_228218_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216327.1|228325_229093_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001326656.1|229147_229903_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045683.1|230009_230999_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|231318_232281_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|232461_233364_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_167317318.1|233571_234084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947770.1|234375_235745_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000468308.1|235817_236036_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882940.1|236117_237281_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|237280_237760_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069960.1|237774_240222_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000785970.1|240214_240334_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|240366_240642_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|240698_241217_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286718.1|241229_242420_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_062914736.1|242479_243082_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001333339.1|243089_244625_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|244673_245021_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|245017_245422_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001333405.1|245563_246079_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
WP_024176421.1|246093_246696_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
WP_001032315.1|246667_247084_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
WP_000216970.1|247086_248382_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.8	1.6e-141
WP_001285346.1|248378_248990_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_001121501.1|248982_249891_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
WP_000127167.1|249895_250243_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001093698.1|250239_250875_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_001001770.1|250941_251394_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
WP_000917160.1|251386_251854_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
WP_001440152.1|251816_251990_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040631.1|251961_252387_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	94.3	1.3e-63
WP_000736582.1|252374_252800_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.7e-55
WP_001144097.1|252814_253312_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000123123.1|253311_253593_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846414.1|253596_253800_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
WP_000988633.1|253799_254309_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_024176422.1|254408_255152_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	96.4	4.6e-125
WP_001248567.1|255155_256229_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_001085956.1|256287_257142_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
WP_000156872.1|257315_259088_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038166.1|259087_260122_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
WP_000012516.1|260493_262977_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001016257.1|264294_265041_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|265055_266597_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_165737238.1|266711_268082_-	replication endonuclease	NA	A0A0F7LA09	Escherichia_phage	99.5	1.3e-255
WP_000027659.1|268071_268347_-	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|268343_268568_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|268567_268870_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|268869_269094_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|269157_269658_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|269827_270100_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|270236_270530_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|270599_271580_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|271766_272267_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|272416_273115_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|273111_274485_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
283370:283405	attR	GCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
>prophage 2
NZ_CP050382	Escherichia coli strain 52148 chromosome, complete genome	4859628	1658452	1671635	4859628		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1658452_1659214_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1659207_1659834_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1659973_1661113_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1661175_1662168_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1662261_1663626_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1663714_1664491_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1664495_1665134_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1665130_1666393_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847984.1|1666389_1667298_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001300386.1|1667493_1668261_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1668311_1668968_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_039023140.1|1669073_1671635_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 3
NZ_CP050382	Escherichia coli strain 52148 chromosome, complete genome	4859628	2274516	2283959	4859628		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569343.1|2274516_2275443_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783134.1|2275447_2276179_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2276159_2276267_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|2276326_2277058_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|2277279_2278965_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|2278961_2279681_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001551352.1|2279727_2280198_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001295429.1|2280239_2280701_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551351.1|2280825_2282826_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001551350.1|2282822_2283959_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 4
NZ_CP050382	Escherichia coli strain 52148 chromosome, complete genome	4859628	2379949	2386378	4859628		Enterobacteria_phage(33.33%)	6	NA	NA
WP_029487813.1|2379949_2381356_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.1e-37
WP_029487815.1|2381579_2382644_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.1	1.2e-102
WP_023297950.1|2382670_2383540_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_029487820.1|2383571_2384462_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.9	1.8e-27
WP_023297948.1|2384476_2385031_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
WP_029487822.1|2385211_2386378_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	9.1e-112
>prophage 5
NZ_CP050382	Escherichia coli strain 52148 chromosome, complete genome	4859628	3233891	3289933	4859628	tail,terminase,integrase,holin,capsid,tRNA,portal,head	Escherichia_phage(45.65%)	64	3242083:3242097	3290035:3290049
WP_001297484.1|3233891_3234998_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|3235033_3235675_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|3235678_3237049_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|3237217_3237889_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|3237888_3239349_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|3239424_3240546_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359434.1|3240594_3241821_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3242070_3243207_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
3242083:3242097	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|3243190_3244054_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|3244608_3245277_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042047081.1|3245514_3246045_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_001189123.1|3247458_3248967_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001233546.1|3252920_3253520_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|3253587_3257067_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|3257127_3257736_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|3257672_3258416_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|3258421_3259120_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|3259119_3259476_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|3259453_3262681_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|3262727_3262988_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_000164661.1|3263029_3263401_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000097535.1|3263415_3264120_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|3264180_3264525_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|3264521_3264971_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|3264967_3265306_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|3265314_3265632_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|3265708_3266926_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000923134.1|3267531_3268758_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_000811487.1|3268747_3268909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140892.1|3268905_3270663_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|3270662_3271145_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|3271292_3271643_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|3272168_3272462_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|3272552_3272735_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|3272951_3273485_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|3273548_3273899_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|3273903_3274119_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001333561.1|3274268_3274430_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000874243.1|3274426_3274615_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|3274875_3275211_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|3275281_3275494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|3275982_3276069_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000762879.1|3276463_3277285_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|3277281_3277662_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|3277662_3278721_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|3278722_3279001_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|3279168_3279381_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_011076332.1|3279583_3279802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000753060.1|3280246_3280423_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001224662.1|3280415_3280598_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|3280691_3281048_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|3281105_3281528_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|3281568_3282639_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|3282710_3283136_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|3283119_3283362_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|3283753_3284092_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_042046576.1|3284445_3284745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|3284816_3285035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|3284999_3285203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|3285603_3285792_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|3285788_3285980_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|3286073_3288515_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|3288576_3288846_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|3288814_3289933_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
3290035:3290049	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 6
NZ_CP050382	Escherichia coli strain 52148 chromosome, complete genome	4859628	4221436	4282111	4859628	lysis,tail,terminase,protease,integrase,transposase,portal	Enterobacteria_phage(43.14%)	68	4222806:4222854	4267575:4267623
WP_000772656.1|4221436_4222645_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
4222806:4222854	attL	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_039023233.1|4223283_4224126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039023231.1|4224626_4224824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371964.1|4225519_4226101_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_039023230.1|4226078_4226960_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_072240810.1|4227637_4227766_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
WP_086708942.1|4227820_4231579_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	93.4	0.0e+00
WP_001230375.1|4231643_4232243_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_039023163.1|4232312_4235810_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.0	0.0e+00
WP_032158484.1|4235870_4236518_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	6.2e-110
WP_032151194.1|4236415_4237159_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
WP_001152385.1|4237164_4237863_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_039023164.1|4237872_4238202_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	1.7e-60
WP_039023165.1|4238201_4241267_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_001161009.1|4241238_4241568_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|4241576_4241963_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_021560209.1|4242023_4242767_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
WP_001079419.1|4242777_4243179_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_023140704.1|4243175_4243754_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|4243765_4244041_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_023140705.1|4244033_4244357_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	8.5e-52
WP_023277783.1|4244443_4246471_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.4	0.0e+00
WP_052249886.1|4246454_4247924_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	3.1e-282
WP_001072975.1|4247923_4248136_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_025670557.1|4248132_4250235_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_000349509.1|4250234_4250726_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_021512737.1|4251401_4251554_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	4.7e-21
WP_001341210.1|4251541_4252009_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|4252005_4252503_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|4252502_4252718_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|4252785_4253838_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|4253988_4254192_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001446998.1|4254460_4255402_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_001208502.1|4255423_4255873_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_085949407.1|4255908_4256277_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_039023166.1|4256291_4257281_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	7.5e-192
WP_024227971.1|4257288_4258098_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.4e-148
WP_000767113.1|4258117_4258507_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210170.1|4258503_4258830_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001377816.1|4258826_4259480_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
WP_001393497.1|4259479_4259974_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_039023167.1|4259970_4260957_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	87.8	1.4e-134
WP_001250272.1|4260946_4261126_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_032198019.1|4261301_4261853_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	3.8e-100
WP_032198020.1|4261845_4262106_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
WP_001020632.1|4262203_4262896_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|4263598_4263961_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|4264026_4264851_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|4264978_4265515_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|4265505_4265868_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206737.1|4265867_4266173_+	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
WP_039023168.1|4266399_4267563_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.2	1.7e-227
WP_000893278.1|4267767_4269021_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
4267575:4267623	attR	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4269032_4270136_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_039023169.1|4270423_4271479_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|4271517_4271919_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|4271976_4273221_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4273312_4273771_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|4274031_4275489_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001352051.1|4275545_4276103_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|4276014_4276281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|4276586_4277039_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|4277048_4277447_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|4277449_4277743_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|4277794_4278850_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207552.1|4278920_4279706_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|4279650_4281390_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|4281613_4282111_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP050382	Escherichia coli strain 52148 chromosome, complete genome	4859628	4290369	4363212	4859628	transposase,tRNA,plate,protease	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_000420818.1|4290369_4291506_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|4291936_4292329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039023185.1|4292306_4296539_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|4296614_4298756_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001297813.1|4298795_4298933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142958.1|4298965_4299484_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|4300178_4300679_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4300713_4300938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|4300988_4302464_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|4302470_4302884_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|4302887_4304738_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4304701_4305784_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113709.1|4305808_4307089_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4307085_4307610_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|4307612_4308944_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|4308948_4309710_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|4309718_4312484_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|4312480_4313224_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|4313228_4314641_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|4314749_4318184_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|4318194_4319547_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|4319570_4320053_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908066.1|4320096_4321011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236653.1|4321020_4321500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|4321636_4322422_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|4322958_4323690_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|4323754_4324222_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|4324218_4324941_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|4324974_4325730_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4325801_4327160_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001230983.1|4327834_4328635_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|4328875_4329790_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|4329786_4330590_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140187.1|4336349_4336925_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|4337112_4338144_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|4338136_4338790_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|4338829_4339645_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4339762_4340167_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|4340163_4340871_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|4340982_4342701_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|4342754_4343579_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|4343778_4344489_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|4344502_4344925_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|4344921_4345467_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4345632_4345833_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4345819_4346080_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|4346128_4347427_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901099.1|4347491_4347881_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|4347937_4350079_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4350177_4351137_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|4351149_4354632_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|4354668_4355265_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139654.1|4355261_4356410_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|4356409_4357198_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4357201_4357657_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|4357761_4358787_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4358790_4359276_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4359397_4361830_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|4361859_4363212_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 1
NZ_CP050384	Escherichia coli strain 52148 plasmid p52148_NDM_5, complete sequence	121872	0	3804	121872	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_001067855.1|1519_2224_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012783960.1|2214_3804_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
>prophage 2
NZ_CP050384	Escherichia coli strain 52148 plasmid p52148_NDM_5, complete sequence	121872	8297	11895	121872	transposase	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000509965.1|8297_8903_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001553819.1|8997_11895_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 3
NZ_CP050384	Escherichia coli strain 52148 plasmid p52148_NDM_5, complete sequence	121872	19756	22833	121872	transposase	Acidithiobacillus_phage(66.67%)	3	NA	NA
WP_052273601.1|19756_20503_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	2.7e-08
WP_001016257.1|20530_21277_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_002431311.1|21291_22833_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
>prophage 4
NZ_CP050384	Escherichia coli strain 52148 plasmid p52148_NDM_5, complete sequence	121872	46908	47130	121872		Vibrio_virus(100.0%)	1	NA	NA
WP_001278692.1|46908_47130_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	39.4	4.4e-07
>prophage 5
NZ_CP050384	Escherichia coli strain 52148 plasmid p52148_NDM_5, complete sequence	121872	55181	113605	121872	integrase,transposase	Macacine_betaherpesvirus(33.33%)	53	81198:81213	92281:92296
WP_001234465.1|55181_56003_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.8	1.7e-43
WP_000107242.1|56121_56409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302184.1|57307_57466_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_085947770.1|57565_58935_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000912556.1|60345_60969_-	potassium channel family protein	NA	NA	NA	NA	NA
WP_001037799.1|62084_63479_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_000813680.1|63673_65104_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	24.5	1.2e-28
WP_001083369.1|65103_66381_-	MFS transporter	NA	NA	NA	NA	NA
WP_000253905.1|66443_68570_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_000053332.1|68665_69676_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.1	6.2e-16
WP_152924612.1|70682_71910_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.8e-174
WP_089634947.1|71895_72465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029702196.1|73825_74389_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	40.0	3.0e-20
WP_039023242.1|74436_75798_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|75849_76080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071781657.1|76596_76845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027495.1|77116_77308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271685.1|77304_77727_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001666994.1|77773_78076_-	antirestriction protein	NA	NA	NA	NA	NA
WP_113441034.1|78164_78407_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_061355072.1|78370_78595_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_001006251.1|78612_79383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001546462.1|79427_79862_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|79875_80097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032181561.1|80097_80781_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
WP_064766247.1|81165_82068_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
81198:81213	attL	TCCACGCAGGTCCGGT	NA	NA	NA	NA
WP_000817031.1|82805_83777_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|83776_84943_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|85530_86286_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016970.1|87007_87814_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159871.1|87814_88120_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813630.1|88121_88340_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001261286.1|88899_89130_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034044.1|89126_89543_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001128474.1|89617_91183_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361402.1|91167_92190_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000449408.1|94439_94598_+	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
92281:92296	attR	ACCGGACCTGCGTGGA	NA	NA	NA	NA
WP_000949452.1|94587_95094_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|95276_96092_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|96438_98325_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|98365_98893_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|98996_100376_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|100378_101662_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729219.1|101651_102782_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|102786_103482_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|103468_103954_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|103978_104464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|107977_108682_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023063803.1|108803_109718_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|109714_110953_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|110952_111537_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|112029_112794_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|112900_113605_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 6
NZ_CP050384	Escherichia coli strain 52148 plasmid p52148_NDM_5, complete sequence	121872	119288	120128	121872		Pandoravirus(100.0%)	1	NA	NA
WP_000259031.1|119288_120128_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
