The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022853	Nitrosomonadales bacterium skT11	3826324	2788	12025	3826324	tRNA	Bacillus_virus(33.33%)	7	NA	NA
WP_173058524.1|2788_5179_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.2	8.1e-115
WP_173058527.1|5281_7555_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.9	2.6e-102
WP_173068757.1|7606_8065_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_173058530.1|8084_9194_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.3	1.0e-27
WP_173058533.1|9190_10465_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	47.2	8.4e-10
WP_173058536.1|10595_11099_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.4	4.8e-17
WP_173058539.1|11098_12025_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.1	5.7e-08
>prophage 2
NZ_AP022853	Nitrosomonadales bacterium skT11	3826324	485867	493964	3826324		uncultured_virus(33.33%)	7	NA	NA
WP_173059789.1|485867_487160_+	dissimilatory-type sulfite reductase subunit alpha	NA	A0A060BKJ3	Podovirus	58.2	1.4e-145
WP_173059792.1|487408_487699_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	45.7	4.0e-16
WP_173059795.1|487735_489379_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.2	6.9e-174
WP_173059798.1|489528_489741_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_173059801.1|489754_490201_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	49.2	1.1e-20
WP_173059804.1|490285_492010_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	5.9e-67
WP_173059807.1|492077_493964_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.7	2.5e-34
>prophage 3
NZ_AP022853	Nitrosomonadales bacterium skT11	3826324	1327621	1389081	3826324	plate,tRNA,tail,transposase,head	Pseudomonas_phage(26.92%)	64	NA	NA
WP_173062101.1|1327621_1328407_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_173062104.1|1328529_1329150_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_173062107.1|1329142_1330336_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_173062110.1|1330344_1331145_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_173062113.1|1331252_1332125_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_173062116.1|1332117_1333386_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_173062118.1|1333386_1334073_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_173062121.1|1334094_1334586_+	CvpA family protein	NA	NA	NA	NA	NA
WP_173062124.1|1334601_1336122_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.1	3.5e-87
WP_173062127.1|1336310_1337480_+	O-succinylhomoserine sulfhydrylase	NA	NA	NA	NA	NA
WP_173062130.1|1337694_1338450_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_173062133.1|1338532_1340158_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	79.2	9.7e-11
WP_173062136.1|1340204_1341320_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_173062139.1|1341341_1342637_-	NAD(P)-binding domain-containing protein	NA	G3MA85	Bacillus_virus	23.6	2.6e-06
WP_173062142.1|1342778_1343666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062145.1|1343640_1345461_+	cytochrome C	NA	NA	NA	NA	NA
WP_173062148.1|1345647_1350696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062151.1|1350805_1353136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062154.1|1353225_1354089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062157.1|1355726_1356125_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_173062160.1|1356121_1356439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062163.1|1356589_1357330_-	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	37.0	1.7e-26
WP_173062167.1|1357512_1357890_+	helix-turn-helix domain-containing protein	NA	A0A2P9JZG5	Alteromonadaceae_phage	56.2	8.5e-11
WP_173062170.1|1357891_1358332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062173.1|1358328_1360389_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	Q38013	Pseudomonas_phage	47.0	4.1e-139
WP_173062176.1|1360444_1361191_+	ATP-binding protein	NA	R9U430	Rhizobium_phage	38.0	2.7e-32
WP_173062180.1|1361191_1361782_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173062183.1|1361759_1362092_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173069036.1|1362236_1362470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062186.1|1362494_1362800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062189.1|1362805_1363267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062192.1|1363307_1363847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062195.1|1363977_1364463_+	M15 family metallopeptidase	NA	A0A0H3V0Q8	Geobacillus_virus	47.2	2.8e-30
WP_173062198.1|1364515_1365088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062202.1|1365084_1365306_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_173062205.1|1365305_1365650_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_173062208.1|1365646_1365940_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173062211.1|1365939_1366440_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	58.4	4.4e-47
WP_173062215.1|1366432_1366663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062218.1|1366655_1368431_+	hypothetical protein	NA	L7P7R5	Pseudomonas_phage	68.6	1.3e-229
WP_173062221.1|1368430_1369996_+	DUF935 domain-containing protein	NA	A0A0A1IVG5	Pseudomonas_phage	44.8	1.3e-113
WP_173062224.1|1369982_1371170_+|head	head morphogenesis protein	head	A0A2P1A4D1	Alteromonadaceae_phage	35.4	3.0e-70
WP_173062227.1|1371570_1372599_+	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	44.3	9.0e-63
WP_173062230.1|1372605_1373016_+	hypothetical protein	NA	A0A0M4TU84	Ralstonia_phage	48.1	1.8e-22
WP_173062233.1|1373046_1374084_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A1B0T6F1	Thiobacimonas_phage	42.8	5.1e-66
WP_173062236.1|1374159_1374525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062238.1|1374528_1375026_+	DUF1320 family protein	NA	A0A1L2BWS4	Bacteriophage	38.5	2.9e-06
WP_173062241.1|1375022_1375547_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_173062246.1|1375546_1376143_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_173062249.1|1376151_1376331_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_173062252.1|1376370_1377849_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	40.1	3.1e-88
WP_173062255.1|1377867_1378218_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_173062258.1|1378217_1378535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062261.1|1378694_1380500_+|tail	phage tail tape measure protein	tail	A0A2H4J9Q8	uncultured_Caudovirales_phage	33.6	2.8e-51
WP_173062265.1|1380499_1381711_+	DNA circularization N-terminal domain-containing protein	NA	Q8W619	Enterobacteria_phage	27.3	1.9e-35
WP_173062266.1|1381834_1382941_+	hypothetical protein	NA	M4M9L5	Vibrio_phage	40.1	4.8e-62
WP_173062267.1|1382940_1383519_+|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	41.5	5.5e-25
WP_173062269.1|1383519_1383981_+	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	44.9	5.1e-26
WP_173062272.1|1383980_1385039_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	40.2	4.8e-59
WP_173062275.1|1385029_1385632_+	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	29.0	1.8e-18
WP_173062278.1|1385635_1386451_+	hypothetical protein	NA	A0A068CE15	Rhizobium_phage	46.0	6.8e-13
WP_173062281.1|1386460_1386856_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_173062283.1|1386871_1388086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173062286.1|1388283_1389081_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	66.4	7.6e-102
>prophage 4
NZ_AP022853	Nitrosomonadales bacterium skT11	3826324	1651874	1661203	3826324		Only_Syngen_Nebraska_virus(16.67%)	8	NA	NA
WP_173063059.1|1651874_1653506_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	56.3	7.6e-165
WP_173063062.1|1653506_1654349_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.5	1.8e-48
WP_173063065.1|1654459_1655746_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	64.9	7.9e-149
WP_173063068.1|1655767_1656118_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_173069090.1|1656119_1656578_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_173063071.1|1656588_1656945_-	thioredoxin family protein	NA	F2Y373	Organic_Lake_phycodnavirus	36.1	7.0e-07
WP_173063074.1|1657117_1657321_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	77.3	1.2e-22
WP_173063077.1|1658254_1661203_+	transketolase	NA	A0A0P0YMZ3	Yellowstone_lake_phycodnavirus	30.9	6.5e-13
>prophage 5
NZ_AP022853	Nitrosomonadales bacterium skT11	3826324	1960161	2000135	3826324	terminase,protease,integrase,tail,head	Bordetella_phage(56.25%)	42	1959971:1960016	2001916:2001961
1959971:1960016	attL	CCTGCAAAGCCGTTTAGACCGGTTCGATTCCGGTCCCCGCCTCCAA	NA	NA	NA	NA
WP_173063906.1|1960161_1961274_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	32.1	4.3e-26
WP_173063909.1|1961437_1961653_-	DUF3310 domain-containing protein	NA	Q774Z7	Bordetella_phage	72.5	1.4e-23
WP_173063912.1|1961649_1963023_-	DEAD/DEAH box helicase	NA	Q774Z8	Bordetella_phage	65.9	3.5e-179
WP_173063915.1|1963019_1963997_-	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	57.0	8.2e-98
WP_173063918.1|1964091_1964361_-	VRR-NUC domain-containing protein	NA	Q775A2	Bordetella_phage	75.6	2.8e-32
WP_173063921.1|1964443_1964638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173063924.1|1964687_1965116_-	CMP deaminase	NA	M1HE52	Paramecium_bursaria_Chlorella_virus	52.8	7.1e-30
WP_173063927.1|1965112_1965295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173063930.1|1965296_1967375_-	DNA polymerase I	NA	Q775A3	Bordetella_phage	62.5	1.2e-252
WP_173063933.1|1967582_1968140_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	55.4	2.0e-48
WP_173063936.1|1968136_1968316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173063939.1|1968312_1969599_-	DUF2800 domain-containing protein	NA	Q775A7	Bordetella_phage	48.9	3.4e-99
WP_173063942.1|1969601_1970303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173063945.1|1970306_1970720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173063948.1|1970731_1971070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173069130.1|1971248_1971533_-	hypothetical protein	NA	Q775B6	Bordetella_phage	59.8	3.1e-29
WP_173069133.1|1971607_1972159_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	28.8	2.4e-06
WP_173063952.1|1972391_1972613_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	41.1	2.7e-09
WP_173063955.1|1972609_1973974_+	helicase	NA	F8TUJ9	EBPR_podovirus	48.9	1.5e-121
WP_173063957.1|1973977_1974964_+	site-specific DNA-methyltransferase	NA	F4YCV3	Synechococcus_phage	52.1	6.8e-84
WP_173063960.1|1974960_1975209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173063963.1|1975205_1977230_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	36.8	5.2e-30
WP_173069136.1|1977402_1977666_+	hypothetical protein	NA	Q775B7	Bordetella_phage	66.7	7.0e-20
WP_173063966.1|1977680_1978139_+|terminase	terminase	terminase	A0A0B5A1T2	Achromobacter_phage	46.2	4.5e-14
WP_173063969.1|1978119_1979634_+|terminase	terminase	terminase	Q775B9	Bordetella_phage	63.8	5.4e-197
WP_173063972.1|1979676_1980138_+	GNAT family N-acetyltransferase	NA	Q775C0	Bordetella_phage	54.7	9.4e-36
WP_173063975.1|1980134_1980596_+	hypothetical protein	NA	Q775C1	Bordetella_phage	63.4	1.3e-45
WP_173063978.1|1980598_1980913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173063981.1|1980916_1982584_+|head,tail	phage head-tail adapter protein	head,tail	T1S9Z7	Salmonella_phage	47.0	2.4e-142
WP_173063984.1|1982628_1982976_+	endopeptidase	NA	Q775C5	Bordetella_phage	79.1	8.8e-47
WP_173069139.1|1982950_1983595_+|protease	protease	protease	Q775C6	Bordetella_phage	62.7	1.0e-48
WP_173063986.1|1983608_1984628_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	49.8	1.1e-84
WP_173063989.1|1984648_1985101_+	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	39.7	1.2e-16
WP_173063992.1|1985111_1985318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173063994.1|1985382_1986033_+	hypothetical protein	NA	Q775D0	Bordetella_phage	60.2	1.1e-66
WP_173063997.1|1986035_1988081_+	hypothetical protein	NA	Q775D1	Bordetella_phage	76.4	3.1e-309
WP_173064000.1|1988143_1988713_+	hypothetical protein	NA	Q775D2	Bordetella_phage	41.3	5.9e-32
WP_173064003.1|1988712_1990884_+	transglycosylase SLT domain-containing protein	NA	Q775D3	Bordetella_phage	67.4	2.0e-282
WP_173064006.1|1990880_1997093_+	hypothetical protein	NA	Q775D4	Bordetella_phage	61.0	0.0e+00
WP_173069141.1|1997986_1998352_+	hypothetical protein	NA	M4SS97	Cyanophage	52.4	1.0e-16
WP_173064009.1|1998373_1999624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173064012.1|1999679_2000135_+	hypothetical protein	NA	A0A0S0N2E7	Pseudomonas_phage	28.7	1.1e-15
2001916:2001961	attR	CCTGCAAAGCCGTTTAGACCGGTTCGATTCCGGTCCCCGCCTCCAA	NA	NA	NA	NA
>prophage 6
NZ_AP022853	Nitrosomonadales bacterium skT11	3826324	2125844	2135113	3826324	tRNA	Bacillus_phage(16.67%)	9	NA	NA
WP_173064341.1|2125844_2126915_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	1.4e-13
WP_173064344.1|2127097_2127676_-	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_173064347.1|2127641_2128595_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.0	7.3e-59
WP_173064350.1|2128737_2131029_+	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	48.5	1.4e-84
WP_173064353.1|2131021_2131504_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_173064356.1|2131500_2132103_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_173064359.1|2132095_2133406_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.8	1.9e-78
WP_173064362.1|2133430_2133796_+	GxxExxY protein	NA	H8ZJB0	Ostreococcus_tauri_virus	39.6	7.4e-12
WP_173064365.1|2133832_2135113_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.7	8.8e-100
>prophage 7
NZ_AP022853	Nitrosomonadales bacterium skT11	3826324	2549513	2558140	3826324		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_173069222.1|2549513_2550470_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.8	3.7e-10
WP_173065446.1|2550472_2551132_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.6	9.3e-37
WP_173065449.1|2551128_2551872_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	55.5	4.1e-73
WP_173065452.1|2552010_2554806_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	39.1	2.9e-79
WP_173065455.1|2554844_2555378_-	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	38.7	9.2e-11
WP_173065458.1|2555367_2556126_-	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_173065461.1|2556128_2556677_-	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_173065464.1|2556706_2558140_-	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.8	4.9e-107
>prophage 8
NZ_AP022853	Nitrosomonadales bacterium skT11	3826324	3017531	3026595	3826324	tRNA	Brucella_phage(33.33%)	9	NA	NA
WP_173066546.1|3017531_3018917_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.8	1.4e-47
WP_173066549.1|3019067_3020690_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.0	3.1e-25
WP_173066552.1|3020700_3021465_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_173066555.1|3021584_3024158_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	77.1	1.1e-109
WP_173066558.1|3024213_3024492_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	46.0	1.1e-07
WP_173066562.1|3024503_3024803_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_173066565.1|3025594_3025843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173066568.1|3025993_3026290_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	56.2	1.3e-25
WP_173066571.1|3026295_3026595_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	48.3	1.9e-13
>prophage 9
NZ_AP022853	Nitrosomonadales bacterium skT11	3826324	3200603	3254045	3826324	terminase,capsid,portal,transposase,head	Acidithiobacillus_phage(45.95%)	67	NA	NA
WP_173067040.1|3200603_3202904_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	31.9	3.4e-25
WP_173067042.1|3202903_3204025_+	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_173067045.1|3204026_3204494_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	75.5	3.5e-62
WP_173067048.1|3204490_3204967_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	90.4	3.6e-75
WP_173069338.1|3204963_3205227_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	51.2	8.3e-13
WP_173067051.1|3205323_3205674_-	DUF2793 domain-containing protein	NA	A0A1X9IAR6	Xanthomonas_phage	58.6	3.5e-35
WP_173067054.1|3205673_3207884_-	hypothetical protein	NA	A0A2H4GXZ4	Pseudomonas_phage	46.6	6.7e-172
WP_173067057.1|3207884_3208091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067060.1|3208087_3208327_-	hypothetical protein	NA	A0A2D0W9G1	Bordetella_phage	44.3	1.2e-10
WP_173067063.1|3208337_3209135_-	phage BR0599 family protein	NA	A0A125SA57	Pseudomonas_phage	43.3	8.8e-58
WP_173067066.1|3209131_3210820_-	hypothetical protein	NA	A0A0S0N8V0	Pseudomonas_phage	33.7	1.5e-75
WP_173067069.1|3210826_3211585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067072.1|3211593_3212400_-	hypothetical protein	NA	A0A2D1GMZ0	Marinobacter_phage	33.1	1.2e-30
WP_173067075.1|3212403_3214992_-	hypothetical protein	NA	A0A0U2BXT9	Paracoccus_phage	38.8	4.9e-33
WP_173067078.1|3215006_3215657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173069341.1|3215831_3216209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067081.1|3216232_3216967_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	49.8	6.0e-53
WP_173067084.1|3216973_3217174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067087.1|3217178_3217616_-	hypothetical protein	NA	F4YCS3	Synechococcus_phage	30.6	2.1e-08
WP_173069343.1|3217615_3217894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067090.1|3217899_3218904_-|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	67.4	2.9e-130
WP_173067093.1|3218917_3219298_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	52.4	8.8e-24
WP_173067095.1|3219301_3220579_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	46.0	3.4e-67
WP_173067098.1|3220580_3222083_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	56.0	2.6e-151
WP_173067100.1|3222082_3222304_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	58.3	1.1e-10
WP_173067103.1|3222310_3222907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067106.1|3222910_3223702_-	hypothetical protein	NA	M9MUU1	Rhodococcus_phage	31.9	5.2e-26
WP_173067109.1|3223723_3224089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067112.1|3224114_3226082_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	81.4	0.0e+00
WP_173067114.1|3226081_3226633_-	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	63.9	2.6e-53
WP_173067117.1|3226748_3227018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067120.1|3227107_3227317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067123.1|3227407_3227962_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	66.4	2.0e-32
WP_173067126.1|3227977_3228208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067129.1|3228270_3228483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067132.1|3228586_3228781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067135.1|3228894_3229098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067138.1|3229109_3229283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067141.1|3229223_3230522_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	81.3	9.3e-198
WP_173069346.1|3230518_3231925_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	58.5	4.9e-152
WP_173067144.1|3232247_3232646_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173067147.1|3232638_3232842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067150.1|3232843_3233308_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	69.1	1.2e-54
WP_173067152.1|3233448_3235731_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	73.6	0.0e+00
WP_173067155.1|3235723_3235939_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_173067158.1|3235935_3236673_-	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	75.0	3.6e-106
WP_173067161.1|3236669_3237164_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	76.8	8.7e-72
WP_173067164.1|3237160_3237373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067167.1|3237383_3238004_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	70.2	9.2e-79
WP_173067170.1|3238050_3238854_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	65.9	1.0e-101
WP_173067173.1|3238853_3239603_-	hypothetical protein	NA	K4I1D2	Acidithiobacillus_phage	65.0	1.2e-85
WP_173067176.1|3239599_3239890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173069349.1|3239886_3240348_-	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	58.1	2.8e-40
WP_173067179.1|3240386_3240665_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173069352.1|3240844_3241306_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	43.2	3.3e-17
WP_173067181.1|3241326_3242745_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	56.6	9.3e-135
WP_173067184.1|3242741_3243212_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	51.4	2.4e-31
WP_173069355.1|3243564_3244320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173069358.1|3244441_3245290_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_173067187.1|3245374_3245710_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173067190.1|3245955_3247191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067193.1|3247194_3248148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067196.1|3248274_3248505_+	DUF2188 domain-containing protein	NA	A0A142KA22	Gordonia_phage	41.9	2.9e-06
WP_173067199.1|3249658_3250261_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_173067202.1|3250257_3251130_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_173067205.1|3251494_3252808_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	31.0	6.1e-40
WP_173067208.1|3252989_3254045_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_AP022853	Nitrosomonadales bacterium skT11	3826324	3263810	3312116	3826324	terminase,capsid,portal,tail,head	Acidithiobacillus_phage(37.5%)	57	NA	NA
WP_173067230.1|3263810_3268154_-	ATP phosphoribosyltransferase regulatory subunit	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	25.9	1.7e-49
WP_173067232.1|3268150_3271285_-	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	29.3	6.3e-99
WP_173067235.1|3271305_3271716_-	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	36.7	9.3e-11
WP_173067238.1|3271781_3272828_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	57.6	1.1e-111
WP_173067242.1|3272895_3273096_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.7	2.7e-16
WP_173067245.1|3273325_3273784_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	83.0	3.7e-69
WP_173067248.1|3273780_3274257_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	91.1	1.9e-76
WP_173069361.1|3274253_3274532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067251.1|3274612_3274963_-	DUF2793 domain-containing protein	NA	A0A1X9IAR6	Xanthomonas_phage	62.9	4.9e-37
WP_173067254.1|3274962_3277173_-	hypothetical protein	NA	A0A172PZU5	Pseudomonas_phage	45.1	1.6e-170
WP_173067256.1|3277173_3277380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067260.1|3277376_3277616_-	hypothetical protein	NA	A0A2D0W9G1	Bordetella_phage	44.3	5.4e-11
WP_173067263.1|3277626_3278424_-	phage BR0599 family protein	NA	A0A125SA57	Pseudomonas_phage	42.9	6.8e-58
WP_173067266.1|3278437_3280126_-	hypothetical protein	NA	A0A0S0N8V0	Pseudomonas_phage	34.5	1.4e-76
WP_173067269.1|3280122_3280788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067272.1|3280903_3281710_-	hypothetical protein	NA	A0A2D1GMZ0	Marinobacter_phage	35.7	2.0e-33
WP_173067275.1|3281713_3284311_-|tail	phage tail protein	tail	A0A0F7L9V3	uncultured_marine_virus	37.9	1.0e-30
WP_173069363.1|3284327_3284975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067278.1|3284971_3285157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067281.1|3285153_3285555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067284.1|3285554_3286289_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	49.2	1.6e-53
WP_173067287.1|3286292_3286463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067290.1|3286467_3286911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067293.1|3286970_3287606_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	35.6	1.1e-26
WP_173067295.1|3287602_3287884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067298.1|3287883_3288888_-|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	68.9	3.9e-135
WP_173067301.1|3288900_3289278_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	58.2	2.8e-30
WP_173067304.1|3289281_3290565_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	43.7	7.3e-62
WP_173067307.1|3290566_3292057_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	58.1	9.7e-151
WP_173067310.1|3292058_3292280_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	58.9	1.2e-12
WP_173067313.1|3292279_3292672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067316.1|3292674_3293172_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	50.0	7.7e-28
WP_173067318.1|3293208_3295182_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	82.2	0.0e+00
WP_173067321.1|3295181_3295727_-	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	67.4	1.3e-57
WP_173067324.1|3295840_3296020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067327.1|3296109_3296307_+	hypothetical protein	NA	A0A1X9I6B9	Streptococcus_phage	52.5	4.1e-09
WP_173067330.1|3296388_3296937_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	66.1	1.8e-33
WP_173067333.1|3297058_3297523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067336.1|3297611_3297989_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	75.6	7.9e-49
WP_173067339.1|3298098_3299445_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	84.9	3.9e-207
WP_173067342.1|3299441_3300836_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	59.6	1.1e-159
WP_173067345.1|3301152_3301551_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173067348.1|3301543_3301747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067350.1|3301748_3302213_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	69.8	2.4e-55
WP_173067353.1|3302353_3304636_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	73.4	0.0e+00
WP_173067356.1|3304628_3304844_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_173067358.1|3304840_3305578_-	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	76.3	3.9e-108
WP_173067361.1|3305574_3306069_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	76.2	2.8e-70
WP_173067364.1|3306288_3306909_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	70.7	3.9e-77
WP_173067367.1|3306955_3307759_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	65.9	3.4e-102
WP_173067370.1|3307758_3308508_-	hypothetical protein	NA	K4I1D2	Acidithiobacillus_phage	64.2	1.4e-84
WP_173067373.1|3308504_3308795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173069365.1|3308791_3309253_-	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	57.0	2.2e-40
WP_173067376.1|3309305_3309569_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173067379.1|3309748_3310210_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	42.4	7.4e-17
WP_173067382.1|3310230_3311649_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	57.3	1.2e-134
WP_173067385.1|3311645_3312116_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	52.1	1.4e-31
>prophage 11
NZ_AP022853	Nitrosomonadales bacterium skT11	3826324	3444829	3467174	3826324	terminase,integrase,tail,transposase,head,lysis	Pseudomonas_phage(30.77%)	32	3452437:3452454	3461671:3461688
WP_173067741.1|3444829_3446104_-	hypothetical protein	NA	A0A2H4IYU7	uncultured_Caudovirales_phage	38.8	1.4e-76
WP_173067744.1|3446110_3446407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067747.1|3446403_3446649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067750.1|3446663_3448205_-	DUF935 family protein	NA	J9SVY0	Pseudomonas_phage	37.7	4.5e-82
WP_173067755.1|3448197_3449958_-|terminase	phage terminase large subunit	terminase	A0A076FR23	Pseudomonas_phage	51.0	1.6e-147
WP_173067758.1|3449950_3450445_-	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	39.1	2.3e-08
WP_173067761.1|3450447_3450846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067764.1|3450842_3451394_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_173069385.1|3451390_3451990_-	transglycosylase SLT domain-containing protein	NA	A4JWP4	Burkholderia_virus	46.3	2.2e-37
WP_173067766.1|3452050_3452377_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	54.1	9.3e-22
3452437:3452454	attL	GCGGGAAACGTTTCCAGC	NA	NA	NA	NA
WP_173067769.1|3452465_3453002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173067772.1|3453011_3453641_-	histidine kinase	NA	NA	NA	NA	NA
WP_173067775.1|3453637_3453970_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173067778.1|3454049_3454274_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_173067781.1|3454295_3455642_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_173067784.1|3455645_3457322_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	B5TA80	Burkholderia_phage	36.9	7.0e-89
WP_173067787.1|3457332_3458295_+	AAA family ATPase	NA	B5TA81	Burkholderia_phage	42.7	7.9e-61
WP_173067791.1|3458306_3458582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067794.1|3458578_3458767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067797.1|3458766_3459249_+	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	64.4	5.3e-50
WP_173067800.1|3459241_3459613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067802.1|3459630_3460278_+	DUF3164 family protein	NA	J9STG3	Pseudomonas_phage	60.8	1.0e-64
WP_173067805.1|3460280_3460568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067808.1|3460560_3461040_+	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_173069387.1|3461070_3461496_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_173067811.1|3461743_3462730_+	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	31.8	2.2e-34
3461671:3461688	attR	GCGGGAAACGTTTCCAGC	NA	NA	NA	NA
WP_173067814.1|3462823_3463726_+|head	Mu-like prophage major head subunit gpT family protein	head	H6V827	Pseudomonas_virus	44.9	7.9e-63
WP_173067817.1|3463813_3464260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067820.1|3464259_3464754_+	DUF1320 family protein	NA	NA	NA	NA	NA
WP_173067823.1|3464750_3465230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067825.1|3465226_3466702_+|tail	phage tail protein	tail	S5FKL0	Shigella_phage	27.5	5.5e-37
WP_173067828.1|3466811_3467174_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
>prophage 12
NZ_AP022853	Nitrosomonadales bacterium skT11	3826324	3472279	3482869	3826324	plate,tRNA	Burkholderia_virus(57.14%)	14	NA	NA
WP_173067845.1|3472279_3472855_+|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	42.5	8.1e-13
WP_173067848.1|3472856_3473267_+	phage GP46 family protein	NA	NA	NA	NA	NA
WP_173067851.1|3473263_3474310_+|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_173067854.1|3474306_3474879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173058512.1|3474865_3475930_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	39.7	3.8e-24
WP_173067857.1|3475939_3476494_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_173067860.1|3476497_3476938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067863.1|3477073_3477271_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	58.3	4.9e-10
WP_173058515.1|3477230_3477383_+	hypothetical protein	NA	A4JWM0	Burkholderia_virus	42.9	9.6e-06
WP_173067866.1|3477379_3478507_+	GNAT family N-acetyltransferase	NA	A4JWM1	Burkholderia_virus	74.7	1.1e-165
WP_173067869.1|3478494_3479106_+|tRNA	methionyl-tRNA formyltransferase	tRNA	A4JWM2	Burkholderia_virus	59.1	3.0e-66
WP_173067872.1|3479269_3479806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173067875.1|3479809_3481786_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_173067878.1|3481894_3482869_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	35.7	1.7e-39
>prophage 13
NZ_AP022853	Nitrosomonadales bacterium skT11	3826324	3757248	3766160	3826324		Synechococcus_phage(25.0%)	10	NA	NA
WP_173068606.1|3757248_3758712_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.6	1.5e-55
WP_173068609.1|3758715_3759684_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	52.3	9.0e-89
WP_173068611.1|3759676_3760594_-	GDP-mannose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	29.3	4.9e-36
WP_173068613.1|3760678_3761539_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.0	1.3e-27
WP_173068615.1|3761535_3762084_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.3	2.1e-50
WP_173068617.1|3762083_3762995_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	62.0	6.9e-99
WP_173068619.1|3762991_3763384_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_173068621.1|3763370_3764432_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.6	2.2e-88
WP_173068623.1|3764460_3765246_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_173068625.1|3765245_3766160_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	3.1e-22
