The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039524	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 chromosome, complete genome	5439115	446334	479592	5439115	head,protease,terminase,capsid,tRNA,portal,integrase,tail	uncultured_Caudovirales_phage(75.0%)	34	463942:463959	479937:479954
WP_002919147.1|446334_447282_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|447296_447806_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|447934_449059_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|449030_449504_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|449529_450072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|450076_450649_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|450652_451471_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|451467_451725_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|451700_452255_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|458050_458272_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|458565_461676_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|461688_462828_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|463206_463857_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
463942:463959	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|464132_465359_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|465451_466393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|466574_466859_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|466869_467649_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_157263200.1|468151_468370_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|468362_468551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218267.1|468627_468756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|468854_469223_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|469219_469585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166706569.1|469584_471720_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|472062_472398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|472446_472959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|473222_474389_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|474440_475001_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|475002_476244_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|476240_476576_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|476572_476872_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|476871_477315_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|477307_477460_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|477590_477947_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|477930_479592_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
479937:479954	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP039524	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 chromosome, complete genome	5439115	1236913	1283148	5439115	head,coat,terminase,lysis,plate,capsid,tRNA,portal,integrase,tail	Salmonella_phage(83.72%)	61	1235207:1235253	1271774:1271820
1235207:1235253	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1236913_1237939_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1237941_1238571_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1238693_1238936_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1238968_1239478_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1239485_1239686_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1239649_1239988_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1240055_1240289_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1240288_1240516_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1240512_1241364_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1241360_1243745_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1243907_1244096_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1244107_1244341_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1244436_1245120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1245106_1246186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1246185_1247187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1247708_1247978_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1248034_1249078_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1249077_1250841_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1250981_1251815_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1251831_1252884_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1252887_1253541_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1253636_1254101_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1254100_1254304_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1254307_1254523_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1254503_1255013_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1255017_1255401_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1255397_1255826_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1255800_1255959_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1255921_1256344_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1256336_1256783_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1256805_1257672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1257766_1258339_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1258335_1258698_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1258684_1259593_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1259585_1260257_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1260258_1262208_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1262217_1263336_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1263387_1264461_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1264609_1265782_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1265791_1266307_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1266359_1266659_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1266673_1266793_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1267019_1269416_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1269412_1269898_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1269894_1270989_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1271055_1271274_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1271301_1271679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1272282_1272765_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1271774:1271820	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1272875_1273352_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1273341_1273632_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1273698_1274040_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145681.1|1274021_1274162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914159.1|1274187_1275849_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1275935_1276814_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1276938_1277529_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1277648_1278935_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1278954_1279746_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1279909_1281274_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1281533_1281782_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1281800_1282349_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1282380_1283148_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP039524	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 chromosome, complete genome	5439115	1387864	1453475	5439115	protease,terminase,transposase,holin,integrase,tail	Salmonella_phage(37.25%)	69	1388859:1388876	1456223:1456240
WP_004151980.1|1387864_1389331_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
1388859:1388876	attL	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
WP_004151979.1|1389398_1390976_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_166706577.1|1391168_1392419_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	1.8e-206
WP_004200579.1|1392435_1392627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032447888.1|1392623_1393217_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	2.5e-110
WP_166706578.1|1393213_1393924_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	51.9	1.0e-57
WP_009485474.1|1393920_1394079_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.8	8.7e-18
WP_009485475.1|1394071_1394365_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004144294.1|1394474_1394723_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_166706579.1|1394773_1395796_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_166706580.1|1395805_1396705_-	endonuclease	NA	Q858E0	Salmonella_phage	90.6	5.5e-157
WP_032415349.1|1396701_1397001_-	hypothetical protein	NA	T1SA88	Salmonella_phage	52.0	1.8e-19
WP_004164037.1|1396997_1397147_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004144290.1|1397367_1397949_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_023285447.1|1398103_1398337_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
WP_166706581.1|1398684_1399851_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	70.7	5.8e-159
WP_166706582.1|1399840_1400605_+	DNA replication domain protein	NA	G9L6A8	Escherichia_phage	88.9	8.2e-61
WP_166706583.1|1400730_1401075_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.3e-53
WP_166706584.1|1401267_1401822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166706585.1|1401818_1402181_+	hypothetical protein	NA	Q5G8U7	Enterobacteria_phage	84.5	8.9e-58
WP_166706586.1|1402904_1403285_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	95.0	7.4e-63
WP_166706566.1|1403281_1403737_+	hypothetical protein	NA	A0A2H4P783	Pseudomonas_phage	46.7	2.1e-08
WP_159225351.1|1403729_1403969_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.9e-09
WP_032418540.1|1404381_1404639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096813144.1|1404716_1405301_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.9e-90
WP_166706587.1|1405297_1406767_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	93.9	4.4e-281
WP_023339255.1|1406815_1407091_-	DUF2829 domain-containing protein	NA	A0A0A0P251	Enterobacteria_phage	84.7	6.6e-37
WP_166706588.1|1407898_1408105_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	86.8	3.7e-08
WP_117026835.1|1408119_1409802_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	8.7e-265
WP_004141364.1|1409798_1410098_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	68.4	3.1e-32
WP_004141362.1|1410094_1410418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166706589.1|1410429_1411119_+	peptidase	NA	G9L6C4	Escherichia_phage	83.2	3.9e-70
WP_048982556.1|1411133_1412120_+	phage protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.9e-179
WP_109217337.1|1412173_1412611_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	6.3e-66
WP_166706590.1|1412621_1412963_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	69.9	2.2e-34
WP_004152441.1|1413013_1413337_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_071182164.1|1413336_1413942_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.5	1.4e-87
WP_166706591.1|1413941_1416419_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.6	0.0e+00
WP_004200538.1|1416418_1416883_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.0	1.3e-69
WP_166706592.1|1416882_1417422_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	71.0	5.8e-61
WP_166706593.1|1417432_1419949_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	77.2	0.0e+00
WP_117282500.1|1419945_1421748_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	74.0	4.1e-236
WP_166706594.1|1421752_1424227_+	hypothetical protein	NA	T1S9I6	Salmonella_phage	93.1	0.0e+00
WP_166706595.1|1424425_1424722_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	93.8	1.7e-46
WP_071561468.1|1424756_1424909_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	85.7	1.9e-14
WP_004200532.1|1425007_1425304_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.1	2.4e-24
WP_166706596.1|1428240_1428822_-	sugar transferase	NA	NA	NA	NA	NA
WP_004146394.1|1429065_1429470_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_023339240.1|1429456_1429762_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_166706597.1|1429751_1430381_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	5.3e-90
WP_166706598.1|1430377_1430878_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	87.5	1.0e-67
WP_004152009.1|1431064_1432933_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004162150.1|1432916_1434095_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_002913847.1|1434388_1435621_-	MFS transporter	NA	NA	NA	NA	NA
WP_004221278.1|1435694_1436606_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004174861.1|1436702_1436876_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_002913841.1|1437246_1439475_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913839.1|1439528_1441061_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913838.1|1441064_1443125_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004152007.1|1443305_1443947_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913836.1|1443943_1444981_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_002913833.1|1445244_1446138_+	ROK family protein	NA	NA	NA	NA	NA
WP_002913829.1|1446147_1447581_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913827.1|1447798_1448425_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913824.1|1448520_1449807_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_020947395.1|1449905_1450607_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913812.1|1450603_1451515_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_002913810.1|1451642_1452002_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913807.1|1452011_1453475_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
1456223:1456240	attR	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
>prophage 4
NZ_CP039524	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 chromosome, complete genome	5439115	1761772	1768677	5439115	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_166706600.1|1761772_1762636_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	2.2e-09
WP_039819854.1|1762646_1763420_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	6.6e-26
WP_004151134.1|1763660_1764557_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_039819857.1|1764799_1766161_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	1.1e-206
WP_004175198.1|1766479_1767202_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1767198_1768677_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
NZ_CP039524	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 chromosome, complete genome	5439115	1813117	1826434	5439115	transposase	Enterobacteria_phage(22.22%)	13	NA	NA
WP_000043543.1|1813117_1814524_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1814750_1816166_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1816187_1817558_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1817712_1818777_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_039819507.1|1818790_1819660_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.3e-110
WP_004175259.1|1819691_1820582_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1820596_1821151_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_039819510.1|1821330_1822497_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_166706650.1|1822889_1823897_+	acyltransferase	NA	NA	NA	NA	NA
WP_077255456.1|1824111_1824216_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004144151.1|1824907_1825030_-	small membrane protein	NA	NA	NA	NA	NA
WP_045327201.1|1825166_1825361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039819511.1|1825429_1826434_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 6
NZ_CP039524	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 chromosome, complete genome	5439115	2822218	2833106	5439115		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2822218_2825326_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2825380_2826646_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2826676_2827765_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2827851_2828112_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2828409_2829270_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2829290_2830052_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2830313_2831216_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_048260141.1|2831227_2832493_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	3.9e-233
WP_002210516.1|2832485_2833106_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP039524	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 chromosome, complete genome	5439115	3062178	3099779	5439115	terminase,integrase	uncultured_Caudovirales_phage(32.61%)	58	3090892:3090906	3096901:3096915
WP_004152575.1|3062178_3062952_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3062948_3064145_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3064144_3064498_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3064499_3065153_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004225248.1|3065206_3065557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3065809_3065995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199300.1|3066047_3066281_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.6	5.8e-18
WP_004152569.1|3066389_3067412_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|3067414_3067642_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004225238.1|3067717_3068131_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004152566.1|3068316_3070320_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3070309_3070462_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3070497_3070923_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3070926_3071367_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3071377_3072523_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3072526_3072967_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3073061_3073448_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3073447_3073954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3073950_3074370_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3074338_3074620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3074659_3075601_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3075612_3076107_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3076110_3077313_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3077364_3077913_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3077968_3079420_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3079657_3081058_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3081008_3081497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3081862_3082183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3082417_3082807_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3082803_3083334_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3083336_3083585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|3083602_3083731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152168.1|3083768_3083924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3083990_3084773_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3084769_3085246_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3085242_3086205_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3086206_3087865_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3088441_3088663_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3088760_3089429_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3089599_3089914_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3089906_3090095_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004218017.1|3090468_3090630_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152157.1|3090622_3090877_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
3090892:3090906	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004146412.1|3090944_3091067_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152156.1|3091063_3091489_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3091485_3091680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3091676_3092504_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3092608_3093127_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3093132_3093843_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3093832_3094057_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004218013.1|3094152_3094266_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_014343018.1|3094508_3094742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3094814_3094961_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3094920_3095163_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3095143_3096325_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3096521_3097070_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3096901:3096915	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3097268_3098801_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3099017_3099779_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
NZ_CP039524	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 chromosome, complete genome	5439115	3522203	3615154	5439115	head,integrase,protease,lysis,plate,capsid,tRNA,portal,terminase,tail	Salmonella_phage(57.63%)	96	3577729:3577747	3615229:3615247
WP_002898139.1|3522203_3523496_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3523586_3524930_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3524938_3525550_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3525672_3529926_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3530061_3530556_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|3530839_3530971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|3531088_3532057_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3532171_3533938_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3533938_3535660_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3535704_3536406_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3536759_3536978_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3537098_3539378_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3539408_3539726_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3540051_3540273_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3540349_3542290_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3542286_3543402_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3543548_3545207_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3545626_3546322_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3546437_3547337_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3547480_3549133_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3549143_3550112_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3550323_3550758_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3550909_3552628_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3552666_3553668_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_166706627.1|3553678_3555121_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3555208_3556222_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3556218_3557049_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3557080_3558220_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3559097_3559613_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3559839_3560568_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3560588_3561320_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3561326_3562043_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3562042_3562711_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3562894_3563626_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3563668_3565141_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3565137_3565854_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3565932_3567060_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3567101_3567590_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3567647_3568493_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3568489_3569443_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3569453_3570587_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3570750_3571863_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3572211_3572691_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3572779_3573682_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3574503_3574791_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3574993_3575257_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3575263_3575647_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3575913_3577599_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_004226292.1|3577590_3577713_-	hypothetical protein	NA	NA	NA	NA	NA
3577729:3577747	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3577818_3578037_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3578128_3579229_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3579225_3579711_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|3579707_3582101_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3582327_3582447_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3582461_3582761_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3582813_3583329_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3583338_3584511_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3584649_3585726_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_004232615.1|3585755_3585917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3585955_3586687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3586690_3589642_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3589643_3590243_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3590235_3591144_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3591130_3591493_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3591489_3592062_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004226282.1|3592176_3592341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3592845_3593292_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3593284_3593716_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3593678_3593825_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3593811_3594240_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3594236_3594620_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3594624_3595134_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3595114_3595330_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3595333_3595537_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3595536_3596001_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3596096_3596747_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3596750_3597809_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3597825_3598659_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3598801_3600568_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3600567_3601593_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_166706628.1|3601654_3603397_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3603672_3604350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3604464_3604698_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3604708_3604897_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3605050_3607465_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3607461_3608319_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3608315_3608543_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3608542_3608776_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3608843_3609185_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3609148_3609349_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3609356_3609866_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3609898_3610120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3610265_3611144_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3611155_3612100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|3612198_3613686_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3614173_3615154_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3615229:3615247	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 9
NZ_CP039524	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 chromosome, complete genome	5439115	4054878	4099510	5439115	terminase,tRNA,holin,lysis	Salmonella_phage(25.0%)	68	NA	NA
WP_166706631.1|4054878_4055196_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	2.4e-22
WP_096834082.1|4055195_4055435_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	54.4	4.5e-18
WP_108714581.1|4055502_4056249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108714582.1|4056263_4058213_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	51.7	5.6e-21
WP_071067353.1|4058234_4059008_-	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	49.7	3.9e-26
WP_038435209.1|4059007_4059781_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	50.6	3.1e-68
WP_108714583.1|4059777_4060977_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	75.3	7.6e-162
WP_004152573.1|4060976_4061330_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_166706632.1|4061329_4062085_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	66.0	1.2e-83
WP_166706633.1|4062307_4062664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166706634.1|4062710_4063055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166706635.1|4063051_4064080_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.5	2.1e-99
WP_074422741.1|4064082_4064310_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.3	1.2e-20
WP_166706651.1|4064385_4064799_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.1	1.1e-30
WP_117032178.1|4064984_4066988_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	64.2	6.8e-248
WP_117032179.1|4066977_4067130_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	86.0	2.9e-18
WP_117032180.1|4067165_4067594_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	64.9	4.0e-41
WP_048289807.1|4067597_4068041_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	81.8	5.6e-62
WP_166706636.1|4068051_4069197_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.4	9.7e-167
WP_004152176.1|4069200_4069641_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_023312779.1|4069735_4070122_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
WP_021312707.1|4070121_4070628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166706637.1|4070624_4071044_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	1.5e-40
WP_000725700.1|4071012_4071294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058343144.1|4071333_4072275_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	2.3e-137
WP_040217290.1|4072286_4072781_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_108714591.1|4072784_4073987_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.4	2.5e-112
WP_025714258.1|4073996_4074191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428680.1|4074236_4074785_-	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
WP_086540480.1|4074840_4076292_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	2.9e-192
WP_021312714.1|4076529_4077930_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	9.4e-188
WP_103857316.1|4077880_4078642_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	73.9	9.1e-12
WP_103857315.1|4078850_4079318_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	72.9	1.4e-55
WP_102017400.1|4079314_4079809_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	93.9	5.6e-87
WP_019704119.1|4079786_4080011_-|holin	holin	holin	M9NZI9	Enterobacteria_phage	91.9	4.0e-32
WP_041937860.1|4080649_4081429_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	76.7	6.3e-101
WP_014342901.1|4081425_4081548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041937861.1|4081544_4081724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342900.1|4081720_4082359_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.3	1.4e-74
WP_004151287.1|4082351_4082522_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|4082521_4082977_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_014342899.1|4083477_4084431_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	42.8	2.5e-51
WP_041937862.1|4084427_4084946_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	2.3e-91
WP_014342898.1|4084945_4085620_-	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	63.0	7.8e-07
WP_014342897.1|4085612_4085744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064766632.1|4085857_4086370_-	hypothetical protein	NA	K7PKY4	Enterobacterial_phage	38.3	3.4e-18
WP_058343166.1|4086366_4086666_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	55.8	1.1e-18
WP_058343155.1|4086670_4088044_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	64.2	5.2e-167
WP_040220032.1|4088040_4089126_-	DNA replication protein	NA	E5AGE9	Erwinia_phage	45.6	1.2e-84
WP_004151298.1|4089118_4089265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038435002.1|4089299_4089584_-	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	56.2	1.3e-19
WP_001548452.1|4089663_4089855_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	55.4	2.4e-09
WP_032420811.1|4089959_4090670_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	71.4	2.9e-92
WP_065799714.1|4090997_4091921_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	95.1	6.0e-175
WP_065799713.1|4091957_4092161_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	68.7	1.0e-18
WP_004219883.1|4092471_4092597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|4092589_4092796_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_041937865.1|4092873_4093071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020958161.1|4093067_4093226_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	57.8	1.0e-05
WP_009483856.1|4093222_4093876_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	62.3	4.0e-64
WP_009483857.1|4093859_4094150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020958162.1|4094146_4094452_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020958163.1|4094448_4094976_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.9e-56
WP_065799712.1|4094972_4095191_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	58.0	2.1e-14
WP_071531921.1|4095192_4095528_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143017.1|4096998_4097865_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|4097866_4098079_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4098124_4099510_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 10
NZ_CP039524	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 chromosome, complete genome	5439115	4310179	4322070	5439115	transposase	Enterobacteria_phage(66.67%)	14	NA	NA
WP_002889940.1|4310179_4311433_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_085955172.1|4312431_4313639_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004152029.1|4314314_4315265_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4315264_4315690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802988.1|4316036_4316186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4316258_4316825_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4316842_4317088_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4317084_4317822_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_004903606.1|4318121_4318259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889915.1|4318363_4318630_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|4318632_4319184_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4319180_4319408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4319404_4319725_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4319736_4322070_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 11
NZ_CP039524	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 chromosome, complete genome	5439115	4790306	4796131	5439115		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4790306_4792640_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4792654_4792975_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4792971_4793199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|4793195_4793738_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4793740_4794007_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4794567_4795305_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4795301_4795547_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4795564_4796131_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NZ_CP039525	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence	88581	19311	26370	88581	integrase	Escherichia_phage(50.0%)	7	16158:16170	20211:20223
16158:16170	attL	AATTAATGTGATT	NA	NA	NA	NA
WP_004197635.1|19311_20106_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_077253981.1|20593_20773_-	Par-like protein	NA	NA	NA	NA	NA
20211:20223	attR	AATCACATTAATT	NA	NA	NA	NA
WP_004197649.1|20892_21519_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004098982.1|22175_23051_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197646.1|23462_24734_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
WP_001568036.1|24733_25165_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_001568038.1|25398_26370_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
>prophage 1
NZ_CP039526	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence	396373	7833	20138	396373		Salmonella_phage(30.77%)	19	NA	NA
WP_004026417.1|7833_8154_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
WP_004026416.1|8233_8548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197205.1|8668_8920_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026415.1|9085_9304_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_016947066.1|9396_9894_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	55.9	6.3e-22
WP_004026413.1|9890_10079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101992385.1|10780_11425_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	38.3	6.3e-06
WP_004197228.1|11841_12228_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_004197183.1|12507_12723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026408.1|12926_13142_+	hypothetical protein	NA	J9Q804	Salmonella_phage	51.4	6.1e-14
WP_016947068.1|13478_13961_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
WP_099743439.1|14044_14647_+	DUF551 domain-containing protein	NA	A0A1V0E5M5	Salmonella_phage	31.1	2.1e-19
WP_016947069.1|14646_14832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026399.1|15101_15374_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	50.0	2.5e-12
WP_004026395.1|16141_16591_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
WP_004026394.1|16660_17269_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
WP_014386579.1|17556_18012_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_004026392.1|18072_18237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065953872.1|18896_20138_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
>prophage 2
NZ_CP039526	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence	396373	32621	71104	396373	transposase	Shigella_phage(37.5%)	29	NA	NA
WP_078207741.1|32621_33803_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_015065592.1|33945_35478_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_000589001.1|35552_36893_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_085929673.1|37634_38803_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
WP_000534858.1|39554_39794_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|39793_40081_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_004181898.1|40152_40311_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_004181901.1|42085_42463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181903.1|43152_44220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181904.1|44375_44723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181905.1|44801_45035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181906.1|45577_45934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181907.1|45987_46761_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	48.0	5.1e-10
WP_004181908.1|46763_47900_-	S49 family peptidase	NA	G0YPK2	Erwinia_phage	32.0	4.4e-10
WP_004181910.1|47908_48583_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_004181912.1|48595_49693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032438003.1|49695_51822_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_085929673.1|51970_53139_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
WP_004196318.1|56025_56814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026319.1|56813_57278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528223.1|58217_58631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032438005.1|58823_59348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196331.1|59364_59907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196361.1|60272_61310_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_004181920.1|61353_62709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196345.1|62710_66679_+	traG-like region family protein	NA	NA	NA	NA	NA
WP_004181922.1|66729_67035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196338.1|67923_68280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085929673.1|69936_71104_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
>prophage 3
NZ_CP039526	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence	396373	143798	203851	396373	integrase,protease,transposase	Caulobacter_phage(16.67%)	55	142235:142262	176731:176758
142235:142262	attL	AGATCCGAAAAAAGGTAGTTCCGGATCT	NA	NA	NA	NA
WP_004213560.1|143798_144578_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_004213558.1|144722_145652_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_077250517.1|145964_146123_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
WP_004225014.1|146237_147206_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
WP_004213252.1|147905_148733_+	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	2.2e-11
WP_004213250.1|148754_149711_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032412871.1|149716_150715_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004213424.1|151377_152085_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004902162.1|152547_153747_-	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
WP_165452889.1|153946_154231_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_004213915.1|154467_154785_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_004145290.1|155334_155844_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
WP_004213918.1|156704_156899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302795.1|157596_158796_-	MFS transporter	NA	NA	NA	NA	NA
WP_004213920.1|158952_160677_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_004213921.1|160677_161625_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004213922.1|161624_163358_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_004213923.1|163361_164639_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_004213924.1|164720_166922_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_004213925.1|167588_167849_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
WP_004213927.1|167890_168451_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004902152.1|168488_168917_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_004213932.1|169000_169276_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_011251327.1|169338_169830_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_004213934.1|169878_170799_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_165452888.1|171809_172445_-	response regulator	NA	NA	NA	NA	NA
WP_004213072.1|173588_174032_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004213073.1|174028_174259_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004213075.1|174866_176000_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_004213076.1|176015_176309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213077.1|176298_176505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213078.1|176856_177147_+	hypothetical protein	NA	NA	NA	NA	NA
176731:176758	attR	AGATCCGAAAAAAGGTAGTTCCGGATCT	NA	NA	NA	NA
WP_004225022.1|177136_178036_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_004215174.1|178084_180310_-	exclusion suppressor FxsA	NA	NA	NA	NA	NA
WP_004215173.1|180311_181214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004225020.1|181297_181480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004215188.1|181498_181960_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004215186.1|182075_183023_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004225018.1|183358_184354_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|184559_185573_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004210220.1|185685_186213_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_077250518.1|186226_189184_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
WP_004144375.1|190025_190886_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_004026615.1|192617_193265_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_024198108.1|193600_194842_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
WP_004026611.1|194926_195502_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
WP_004026609.1|195588_196167_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|196205_197246_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|197269_197725_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_004026603.1|197747_198899_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004026602.1|198895_199480_-	tellurium resistance family protein	NA	K4JRX3	Caulobacter_phage	29.9	1.8e-12
WP_004026600.1|199791_200850_+	ATP-grasp domain protein	NA	NA	NA	NA	NA
WP_004026599.1|200861_202004_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	6.3e-33
WP_004026598.1|201996_202770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026596.1|202771_203851_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
>prophage 4
NZ_CP039526	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence	396373	223162	320368	396373	integrase,transposase	Escherichia_phage(32.26%)	96	277664:277678	301702:301716
WP_001067858.1|223162_223867_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004896925.1|224751_225294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567369.1|225629_226262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|226290_227694_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_000155092.1|227935_228820_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|228875_230351_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_002001451.1|230749_231934_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|231982_232168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252464.1|232387_232669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359986.1|232649_233423_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_000050481.1|234821_236363_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|236767_237607_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_052238321.1|237600_237936_-	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_025999322.1|237828_238194_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_004193231.1|238197_239073_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004236386.1|239183_240323_+	class C beta-lactamase DHA-1	NA	NA	NA	NA	NA
WP_004193241.1|241673_241904_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_004193243.1|241912_242272_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_004193245.1|242271_242496_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_003020532.1|242550_243219_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_017900991.1|243374_244364_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_017900990.1|244446_245091_+	quinolone resistance pentapeptide repeat protein QnrB4	NA	NA	NA	NA	NA
WP_004193260.1|245186_246095_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	53.0	4.3e-77
WP_004193262.1|246271_246850_-	2-oxo-tetronate isomerase	NA	B5TK85	Pseudomonas_phage	34.0	2.0e-19
WP_004193264.1|246797_247244_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_004193267.1|247253_247757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193269.1|247888_248281_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_119062600.1|248581_250225_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_001067855.1|251022_251727_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|253116_253785_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|253820_254057_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|254053_254416_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|254433_256128_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001447540.1|256179_256602_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|256637_256913_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|256926_257277_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|257348_257783_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427614.1|257861_258866_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|259391_260252_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_014342213.1|260805_260931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|261072_262443_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342212.1|262441_262591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|263743_263971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|263994_264186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|264667_265210_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|265222_266083_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|266315_267020_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376623.1|268073_268574_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|268701_269541_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|269534_269882_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|270045_270837_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_071523897.1|270842_271088_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|271244_271742_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|271886_272900_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|273704_274409_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004176269.1|274545_275406_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|275426_276188_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|276449_277352_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
277664:277678	attL	CTGCTGGCCGAGCTG	NA	NA	NA	NA
WP_001067855.1|278998_279703_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_021532377.1|279753_280314_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|280316_283283_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000427614.1|283361_284366_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000656305.1|284676_285054_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|285254_285914_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_071779647.1|286900_289789_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
WP_001067855.1|289888_290593_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_166706657.1|290657_293525_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000427619.1|293603_294608_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_101992395.1|295523_296408_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	42.8	7.5e-50
WP_166706655.1|296961_297321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386530.1|297539_298607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946352.1|298692_298947_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_014386529.1|299123_300260_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004026552.1|300325_300643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946351.1|300787_301117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181760.1|301113_301872_-	hypothetical protein	NA	NA	NA	NA	NA
301702:301716	attR	CAGCTCGGCCAGCAG	NA	NA	NA	NA
WP_014386528.1|301868_302828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409750.1|302870_303278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|303287_303752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181763.1|303799_304042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181765.1|304629_304848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181766.1|304992_305532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181767.1|305600_306845_-	topoisomerase	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
WP_004181768.1|306955_307186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110214255.1|307257_309132_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026538.1|309195_310272_-	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_004181771.1|310369_311422_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_004181772.1|311449_312271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181774.1|312332_312686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101992392.1|312830_313817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181776.1|314150_315950_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	23.1	1.8e-26
WP_004181777.1|316240_316489_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004181778.1|316478_316763_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	4.7e-22
WP_040209639.1|316916_318143_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	76.9	1.7e-153
WP_077257669.1|318716_319145_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.6	1.6e-34
WP_040209642.1|319180_320368_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.0	3.5e-143
>prophage 5
NZ_CP039526	Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence	396373	371797	381413	396373	transposase	Shigella_phage(25.0%)	13	NA	NA
WP_101850616.1|371797_372376_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
WP_004181824.1|372366_372681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048995652.1|372805_373216_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	60.0	1.0e-41
WP_004196726.1|373400_373760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166706656.1|373990_374434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085929673.1|374408_375577_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
WP_004026466.1|375940_376201_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_004026465.1|376233_376668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026464.1|376664_377408_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
WP_075043065.1|377564_378950_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
WP_004026461.1|379039_380242_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
WP_004181828.1|380819_381068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181829.1|381095_381413_+	DUF3846 domain-containing protein	NA	A0A2H4P7A4	Pseudomonas_phage	46.5	6.0e-10
