The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050175	Streptococcus pneumoniae strain PZ900701590 chromosome, complete genome	2143685	44689	56000	2143685		Synechococcus_phage(33.33%)	7	NA	NA
WP_033707870.1|44689_46843_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.2	5.5e-46
WP_033707869.1|46855_48205_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000043314.1|48374_49082_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D8KNF0	Synechococcus_phage	39.2	1.8e-41
WP_166735646.1|49138_52864_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.9	9.6e-38
WP_000220633.1|52956_54399_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.7e-55
WP_166735647.1|54435_55458_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.9	2.1e-64
WP_000717506.1|55454_56000_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	7.4e-24
>prophage 2
NZ_CP050175	Streptococcus pneumoniae strain PZ900701590 chromosome, complete genome	2143685	107320	131982	2143685	bacteriocin,tRNA	Planktothrix_phage(50.0%)	28	NA	NA
WP_001230166.1|107320_107608_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000724268.1|107659_109768_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000571330.1|109764_110406_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	4.3e-23
WP_001038474.1|110612_111419_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000031929.1|111435_111663_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_000252931.1|111693_111855_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_001268152.1|112040_112904_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000424429.1|113540_113912_+|bacteriocin	SPH_0218 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000909533.1|113919_114132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424479.1|114547_114910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356083.1|114890_115136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001819309.1|115292_116351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001820522.1|116665_117643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424474.1|118113_118488_+|bacteriocin	SPH_0224 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000511669.1|118494_118677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000619762.1|118695_119598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424436.1|119653_120007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050231638.1|120003_120732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770312.1|121864_122104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001810010.1|122088_122367_+	hypothetical protein	NA	M1Q0Z8	Streptococcus_phage	50.5	1.1e-20
WP_166735651.1|122652_124491_+	pneumococcal surface protein A	NA	NA	NA	NA	NA
WP_050218383.1|124890_126012_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000193621.1|126152_126608_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_050218384.1|126617_128531_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000331980.1|128910_130590_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000639577.1|130591_130825_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_000974047.1|131642_131795_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibB	bacteriocin	NA	NA	NA	NA
WP_000180805.1|131796_131982_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibA	bacteriocin	NA	NA	NA	NA
>prophage 3
NZ_CP050175	Streptococcus pneumoniae strain PZ900701590 chromosome, complete genome	2143685	318602	376647	2143685	transposase,holin,protease	Streptococcus_phage(25.0%)	50	NA	NA
WP_033707917.1|318602_320708_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.7	3.4e-117
WP_000032550.1|321003_321486_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000743611.1|321580_323065_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_033705611.1|323217_324825_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_001022231.1|324983_325157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705610.1|325893_327339_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	59.6	2.6e-132
WP_033705609.1|327340_328072_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_033705608.1|328080_328773_+	capsular biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	56.8	1.8e-62
WP_001142528.1|328782_329457_+	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	63.4	8.5e-78
WP_000286441.1|329803_330403_+	sugar transferase	NA	NA	NA	NA	NA
WP_001813070.1|330407_331634_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000866355.1|331630_332800_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000977706.1|332837_334049_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_000761414.1|334023_335100_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_033705606.1|335101_336280_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_033705605.1|336321_337509_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000091999.1|337505_339050_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_000611245.1|339042_340266_+	nucleotide sugar dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	28.0	9.8e-24
WP_000725279.1|340294_341392_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.5	5.7e-31
WP_033705604.1|341395_342451_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	33.0	2.6e-33
WP_000594467.1|342550_343780_+	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_033705603.1|343780_344965_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	51.3	1.2e-103
WP_001811052.1|345327_345486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705371.1|346796_347120_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000941204.1|347100_347286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705368.1|348424_350407_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166735663.1|350707_355996_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_033705365.1|356162_358322_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_000248787.1|358318_358915_-	Holliday junction resolvase RecU	NA	A0A1L2JY30	Aeribacillus_phage	33.9	8.7e-18
WP_000179549.1|358980_359508_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_000146522.1|359577_359907_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_033705364.1|360392_361550_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_000039303.1|361561_362956_+	mid-cell-anchored protein MapZ	NA	NA	NA	NA	NA
WP_000158781.1|363031_364456_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.6	1.6e-41
WP_033705362.1|364467_365157_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033705361.1|365254_366271_+|holin	choline-binding protein CbpC	holin	NA	NA	NA	NA
WP_000163323.1|366392_367271_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_000373457.1|367252_368206_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_033705360.1|368192_369200_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_000210623.1|369183_370194_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001224637.1|370271_370970_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_000743677.1|370966_371962_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000698434.1|371975_372608_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_078102538.1|372771_373086_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_001823720.1|373104_373377_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_000754501.1|373526_373766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705358.1|373846_374668_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_023396156.1|374686_375709_+|holin	choline-binding protein CbpF	holin	NA	NA	NA	NA
WP_033705326.1|375836_376325_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	51.6	5.6e-39
WP_166735642.1|376338_376647_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	51.9	1.4e-14
>prophage 4
NZ_CP050175	Streptococcus pneumoniae strain PZ900701590 chromosome, complete genome	2143685	459224	506743	2143685	bacteriocin,tRNA,protease	Bacillus_phage(22.22%)	46	NA	NA
WP_000181374.1|459224_459728_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_000185835.1|460180_460744_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_033707959.1|460733_461384_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000867292.1|461410_461827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000418402.1|462163_462751_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_033705412.1|463140_464748_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.8	1.7e-140
WP_033705411.1|465306_466938_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_078376001.1|467230_472210_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_001096742.1|472299_473496_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000119905.1|473631_474159_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_000659547.1|474235_474592_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166735666.1|474628_475975_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_001808898.1|476070_476190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410533.1|476154_476304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166735740.1|476734_478054_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000651177.1|478110_478908_+	tyrosine-type DNA invertase PsrA	NA	A0A0H4TI16	Erysipelothrix_phage	28.7	1.3e-21
WP_015545687.1|478918_479521_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_166735667.1|479468_481037_-	restriction endonuclease subunit S	NA	A0A1V0SLK8	Klosneuvirus	25.6	1.0e-12
WP_033707995.1|481036_482500_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_000229090.1|482512_484846_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	27.9	5.8e-25
WP_001088689.1|485453_485963_+	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_000255779.1|486126_487161_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_000046031.1|487187_487712_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_000034662.1|488191_490015_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.2	1.3e-133
WP_000343113.1|490025_490430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066295.1|490773_491910_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	31.3	2.4e-24
WP_001808905.1|492243_492438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777753.1|492599_492887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278301.1|492896_493307_-	HIT family protein	NA	B5LJ12	Mycobacterium_phage	31.6	3.4e-05
WP_000889921.1|493374_494106_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	5.3e-25
WP_000653771.1|494102_495152_+	multidrug ABC transporter permease	NA	NA	NA	NA	NA
WP_000132572.1|495319_495649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682133.1|495925_496264_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001219122.1|496268_497006_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000275285.1|497018_498359_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000358814.1|498403_498559_-	quorum-sensing system pheromone BlpC	NA	NA	NA	NA	NA
WP_033705510.1|498615_499977_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_078142245.1|499987_501631_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.2	4.1e-41
WP_000205166.1|501557_502145_-	peptidase C39	NA	NA	NA	NA	NA
WP_033705509.1|502483_502738_+|bacteriocin	two-peptide bacteriocin subunit BlpM	bacteriocin	NA	NA	NA	NA
WP_001099490.1|502753_502957_+|bacteriocin	two-peptide bacteriocin subunit BlpN	bacteriocin	NA	NA	NA	NA
WP_001809846.1|503200_503350_+|bacteriocin	bacteriocin-like peptide BlpO	bacteriocin	NA	NA	NA	NA
WP_000346296.1|503453_503573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705507.1|504040_504412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705506.1|505788_506022_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_033705505.1|506053_506743_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP050175	Streptococcus pneumoniae strain PZ900701590 chromosome, complete genome	2143685	816059	883321	2143685	protease,transposase,integrase,tRNA,bacteriocin	Streptococcus_phage(55.0%)	59	826384:826412	829662:829690
WP_000530084.1|816059_817316_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	97.1	5.9e-234
WP_033705332.1|817487_817922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705331.1|818059_819202_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_033705330.1|819210_820425_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_166735681.1|820559_821384_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033705329.1|822157_823324_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001825037.1|825337_825880_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_033705328.1|825876_826995_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
826384:826412	attL	AAATCCCGATTTAACGAGATGTTTGGGGA	NA	NA	NA	NA
WP_000260605.1|827054_827291_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_000158366.1|827287_827701_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_033705544.1|828727_829657_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.6	1.8e-33
WP_001821324.1|829622_830198_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
829662:829690	attR	AAATCCCGATTTAACGAGATGTTTGGGGA	NA	NA	NA	NA
WP_000526318.1|830227_833578_+	DEAD/DEAH box helicase family protein	NA	A0A2H4P9W3	Gordonia_phage	24.8	2.4e-11
WP_000530084.1|834207_835464_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	97.1	5.9e-234
WP_001042995.1|835588_836059_-	arginine repressor	NA	NA	NA	NA	NA
WP_001212037.1|836075_838349_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_000561503.1|838695_841797_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	32.6	4.4e-113
WP_000820852.1|841879_842887_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001042809.1|842945_844451_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_061543377.1|845567_845822_-	phage repressor protein	NA	B3GVX0	Streptococcus_phage	60.0	2.2e-18
WP_000749599.1|846257_847130_+	DUF4300 family protein	NA	NA	NA	NA	NA
WP_000420571.1|847762_848074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166735682.1|848077_848794_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000617845.1|848923_849739_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000123614.1|849735_850641_-	permease	NA	NA	NA	NA	NA
WP_076742442.1|850982_851348_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001809527.1|851344_852349_+	DUF1919 domain-containing protein	NA	NA	NA	NA	NA
WP_000359137.1|852450_854580_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_000778576.1|854566_855016_+	SprT family protein	NA	NA	NA	NA	NA
WP_001085044.1|855074_855347_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_000680766.1|855700_855892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705394.1|856319_857078_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	7.7e-27
WP_000489404.1|857079_859068_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_166735741.1|859110_859755_-	VIT family protein	NA	NA	NA	NA	NA
WP_001153814.1|859780_860656_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.3	8.0e-28
WP_000661011.1|861362_862838_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001270407.1|863605_863743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705392.1|863773_864634_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000088777.1|864630_865890_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001863222.1|865889_867017_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_033705391.1|867013_868099_+	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	47.5	2.0e-89
WP_001246755.1|868108_868984_+	N-carbamoylputrescine amidase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	50.0	1.1e-77
WP_000593576.1|869164_869974_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000602452.1|870245_870467_+|bacteriocin	SP_0924 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000745369.1|870520_871192_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001809535.1|871243_871441_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001025729.1|871433_872342_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.7	5.2e-06
WP_000745389.1|872338_872800_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000403193.1|872789_873677_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_033705390.1|873679_875563_+	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	23.7	1.5e-10
WP_001844793.1|875642_876773_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.4	1.1e-114
WP_033705388.1|876782_878045_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	65.0	4.5e-141
WP_000689716.1|878048_878846_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	49.8	8.0e-59
WP_166735683.1|879065_879704_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	67.2	7.0e-74
WP_000806706.1|879700_880591_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	51.4	1.4e-72
WP_000358228.1|880630_880948_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.0	2.9e-28
WP_001166880.1|880950_881820_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	76.1	2.7e-116
WP_001261456.1|882046_882565_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000345254.1|882673_883321_+	replication initiator protein A	NA	A0A2P0VK56	Streptococcus_phage	33.7	7.0e-13
>prophage 6
NZ_CP050175	Streptococcus pneumoniae strain PZ900701590 chromosome, complete genome	2143685	1071498	1096122	2143685	integrase	Streptococcus_phage(90.0%)	24	1079714:1079730	1097113:1097129
WP_033705457.1|1071498_1074312_+	CHAP domain-containing protein	NA	Q4Z9D9	Staphylococcus_phage	40.4	1.2e-08
WP_000026229.1|1074353_1074563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420682.1|1074878_1075193_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_000985015.1|1075208_1075595_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000813488.1|1075623_1077009_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000879507.1|1077011_1077164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001841741.1|1077186_1078605_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	99.0	6.3e-232
WP_001814874.1|1078653_1078737_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001038795.1|1078861_1079599_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	3.1e-134
1079714:1079730	attL	TACGGGGAATTTGTATC	NA	NA	NA	NA
WP_001009056.1|1081282_1081504_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000342539.1|1081620_1082118_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_000506270.1|1082092_1082599_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000331160.1|1082582_1085030_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
WP_166735693.1|1085032_1087210_+	YtxH domain-containing protein	NA	A0A1S5SF30	Streptococcus_phage	99.9	0.0e+00
WP_033705455.1|1087206_1088208_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	95.8	7.7e-184
WP_033705454.1|1088222_1089137_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	92.4	9.5e-157
WP_001814923.1|1089381_1089498_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691743.1|1089513_1091433_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	97.8	0.0e+00
WP_000336323.1|1091551_1091719_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_001227347.1|1091778_1092132_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_000804885.1|1093509_1093932_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_000857133.1|1093928_1094159_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000814511.1|1094619_1094823_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
WP_001291561.1|1094904_1096122_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
1097113:1097129	attR	TACGGGGAATTTGTATC	NA	NA	NA	NA
>prophage 7
NZ_CP050175	Streptococcus pneumoniae strain PZ900701590 chromosome, complete genome	2143685	1109967	1119474	2143685	integrase	Streptococcus_phage(77.78%)	12	1108370:1108385	1123598:1123613
1108370:1108385	attL	AGAGGTTGAAAACGAT	NA	NA	NA	NA
WP_000579623.1|1109967_1110444_+	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	31.9	8.8e-05
WP_000405354.1|1110443_1111214_+	toxin PezT	NA	NA	NA	NA	NA
WP_000492698.1|1111469_1112153_+	helix-turn-helix transcriptional regulator	NA	E8ZDN4	Streptococcus_phage	52.7	8.3e-65
WP_000118332.1|1112155_1113571_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	72.6	1.5e-201
WP_000981955.1|1113567_1113933_+	hypothetical protein	NA	A0A1B0RXA8	Streptococcus_phage	45.5	3.0e-21
WP_001080184.1|1113922_1114213_+	hypothetical protein	NA	Q6DMX6	Streptococcus_phage	52.7	3.1e-21
WP_000827835.1|1114507_1114864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401236.1|1114868_1115234_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_000237134.1|1115220_1117050_+	relaxase/mobilization nuclease domain-containing protein	NA	A0A1B0RXG0	Streptococcus_phage	37.5	3.6e-06
WP_000919632.1|1117153_1117381_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	46.9	1.0e-06
WP_001022845.1|1117647_1117881_+	hypothetical protein	NA	W6LM55	Streptococcus_phage	50.7	4.6e-15
WP_000291923.1|1117965_1119474_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	27.6	8.4e-25
1123598:1123613	attR	AGAGGTTGAAAACGAT	NA	NA	NA	NA
>prophage 8
NZ_CP050175	Streptococcus pneumoniae strain PZ900701590 chromosome, complete genome	2143685	1170765	1237140	2143685	holin,protease,transposase,tRNA,bacteriocin	Bacillus_phage(17.65%)	60	NA	NA
WP_000530084.1|1170765_1172022_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	97.1	5.9e-234
WP_033705352.1|1172071_1172374_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_166735696.1|1172634_1173513_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_001002635.1|1173522_1174797_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_000200428.1|1174892_1175486_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_001231016.1|1175486_1176008_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_000128188.1|1176029_1176152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000625732.1|1176299_1177097_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_000078847.1|1177340_1178084_-	sortase	NA	NA	NA	NA	NA
WP_033705351.1|1178083_1180552_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.5	2.1e-105
WP_000204727.1|1180745_1181732_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001143843.1|1182029_1185284_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000150984.1|1185448_1187335_-	type II restriction endonuclease	NA	A0A1V0SF91	Hokovirus	23.7	1.1e-10
WP_001812387.1|1187409_1187664_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000208080.1|1187665_1187908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289493.1|1187998_1188808_-	MBL fold metallo-hydrolase	NA	A0A0C5AFC1	Paenibacillus_phage	39.0	1.8e-34
WP_000886210.1|1188809_1190159_-	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	34.6	1.8e-34
WP_000722076.1|1190151_1190856_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	2.8e-39
WP_000886147.1|1190910_1192086_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000845290.1|1192414_1194085_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_000699488.1|1194314_1195004_+	phosphopantothenate--cysteine ligase	NA	NA	NA	NA	NA
WP_001284128.1|1195015_1195567_+	phosphopantothenoylcysteine decarboxylase	NA	A0A068EHP1	Penguinpox_virus	37.6	3.1e-25
WP_000747408.1|1195550_1196114_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_001097389.1|1196395_1196923_+	membrane protein	NA	NA	NA	NA	NA
WP_000159185.1|1196934_1197450_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000085593.1|1197446_1197914_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000216012.1|1197986_1198475_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000639842.1|1198440_1199004_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000607027.1|1199013_1201002_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_033705350.1|1201078_1202032_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_033705349.1|1202204_1204370_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_001096313.1|1204369_1205110_+	amino acid ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.3	2.8e-18
WP_166735697.1|1205258_1206746_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	32.8	1.9e-69
WP_000522311.1|1206791_1208081_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_000763458.1|1208084_1208903_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000153023.1|1208902_1209697_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_166735698.1|1209693_1213233_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_000661498.1|1213223_1213922_-	ribonuclease III	NA	J2YAN1	Acanthamoeba_polyphaga_lentillevirus	33.8	3.9e-25
WP_000931178.1|1214239_1215226_-	GMP reductase	NA	G3MBI2	Bacillus_virus	72.2	1.1e-137
WP_001813445.1|1215400_1216717_-	McrC family protein	NA	NA	NA	NA	NA
WP_033707845.1|1216703_1218635_-	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	33.7	1.8e-16
WP_001810980.1|1218798_1218960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000199865.1|1219220_1219364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001811821.1|1219582_1219942_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_000762426.1|1219945_1220215_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_001010962.1|1221260_1222355_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_000461588.1|1222373_1223030_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000638789.1|1223073_1223706_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001220357.1|1223798_1224158_-	YbaN family protein	NA	NA	NA	NA	NA
WP_000179635.1|1224378_1226466_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.6	3.0e-105
WP_001812710.1|1226632_1227676_-	TIGR00341 family protein	NA	NA	NA	NA	NA
WP_000705325.1|1228559_1229408_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.5	1.9e-34
WP_033707849.1|1229503_1230193_-|holin	CTP--phosphocholine cytidylyltransferase	holin	A0A127AW70	Bacillus_phage	45.0	3.4e-05
WP_000837609.1|1230204_1231083_-	DMT family transporter	NA	NA	NA	NA	NA
WP_033705343.1|1231072_1231942_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_000609885.1|1231958_1232981_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_033705342.1|1232985_1233693_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000835915.1|1234028_1235516_+	type IV teichoic acid flippase TacF	NA	NA	NA	NA	NA
WP_000811874.1|1235525_1236329_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	27.1	5.3e-10
WP_001199652.1|1236330_1237140_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	30.3	9.1e-10
>prophage 9
NZ_CP050175	Streptococcus pneumoniae strain PZ900701590 chromosome, complete genome	2143685	1378789	1436079	2143685	tRNA,transposase,holin	Streptococcus_phage(29.41%)	59	NA	NA
WP_166735708.1|1378789_1380046_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	97.1	2.9e-233
WP_000065723.1|1380131_1381694_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	1.4e-19
WP_000936200.1|1381835_1382534_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000071672.1|1382576_1383473_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000872215.1|1383481_1384417_-	serine hydrolase	NA	NA	NA	NA	NA
WP_001102211.1|1384413_1385139_-	proteinase	NA	NA	NA	NA	NA
WP_033705433.1|1385222_1385858_-|holin	1-alkyl-2-acetylglycerophosphocholine esterase	holin	A0A2K9L661	Tupanvirus	28.7	6.7e-08
WP_000972916.1|1385859_1386687_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_166735709.1|1388286_1388898_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.7	6.4e-16
WP_000855753.1|1388942_1389671_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000272306.1|1389709_1390621_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.8	4.5e-90
WP_000926599.1|1390686_1390911_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_000590970.1|1390988_1391732_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	4.7e-29
WP_001103449.1|1391731_1392532_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000889093.1|1392689_1393046_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	57.3	1.2e-33
WP_001170347.1|1393039_1393570_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.3	1.4e-46
WP_000405859.1|1393569_1394064_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	52.8	8.5e-43
WP_000858735.1|1394198_1394645_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_001097986.1|1394641_1395289_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000689945.1|1395309_1395891_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_000138517.1|1395891_1396767_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_000036784.1|1396918_1398298_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000175413.1|1398591_1399515_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_000915924.1|1399574_1400180_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	54.2	7.7e-54
WP_000673694.1|1400198_1401443_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	52.7	1.7e-55
WP_166735710.1|1401665_1401923_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_000164783.1|1401964_1404001_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000038749.1|1404212_1405130_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_012677106.1|1405323_1405650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001846081.1|1405616_1405901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166735711.1|1406173_1407016_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	1.0e-51
WP_001173907.1|1407129_1408467_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001850008.1|1408755_1409133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000915893.1|1409347_1410325_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_033705429.1|1410321_1411404_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.1	1.8e-37
WP_001040724.1|1413760_1414957_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	29.6	7.3e-32
WP_000348122.1|1415867_1416737_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_000248996.1|1416959_1417481_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_000935666.1|1418653_1418908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033705262.1|1419265_1419799_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_001808732.1|1419785_1420001_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001815446.1|1419967_1420111_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033705263.1|1420344_1422063_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	83.0	4.4e-272
WP_000434644.1|1422173_1422521_+	thioredoxin	NA	NA	NA	NA	NA
WP_000759187.1|1422799_1423636_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891770.1|1423648_1424278_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	1.5e-28
WP_000120830.1|1424287_1424929_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_166735712.1|1425074_1426304_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_166735713.1|1426315_1427461_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_033705265.1|1427604_1428618_+	lactonase family protein	NA	NA	NA	NA	NA
WP_000068050.1|1428662_1429082_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_166735714.1|1429092_1430499_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_000301210.1|1430584_1431463_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_000996636.1|1431478_1432984_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_000359036.1|1432998_1433535_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_166735715.1|1433534_1434029_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_000392851.1|1434042_1434759_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_001054562.1|1434793_1434994_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_166735716.1|1435068_1436079_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	36.1	7.8e-35
>prophage 10
NZ_CP050175	Streptococcus pneumoniae strain PZ900701590 chromosome, complete genome	2143685	1492214	1498968	2143685	protease	Streptococcus_phage(50.0%)	9	NA	NA
WP_033708093.1|1492214_1493183_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	99.2	1.1e-65
WP_000011306.1|1493216_1494128_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	99.7	1.5e-154
WP_033708095.1|1494124_1495102_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	99.7	3.4e-184
WP_033708096.1|1495098_1495989_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	3.9e-06
WP_001140412.1|1496040_1496421_-	RidA family protein	NA	NA	NA	NA	NA
WP_000422599.1|1496431_1497019_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_000106346.1|1497027_1498260_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.0	4.2e-131
WP_000442275.1|1498291_1498462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162486.1|1498461_1498968_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	43.1	2.3e-27
>prophage 11
NZ_CP050175	Streptococcus pneumoniae strain PZ900701590 chromosome, complete genome	2143685	1750284	1757616	2143685		uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_000167833.1|1750284_1750986_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	36.1	4.6e-34
WP_000777248.1|1751408_1752368_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.8	4.0e-57
WP_001193674.1|1752357_1753314_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000764303.1|1753310_1754063_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.1	5.6e-14
WP_000858245.1|1754158_1755124_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000821640.1|1755348_1755591_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	59.4	1.3e-17
WP_001222228.1|1755590_1756313_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000105310.1|1756299_1756869_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.9	5.0e-15
WP_000351912.1|1756887_1757616_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	22.3	6.9e-09
>prophage 12
NZ_CP050175	Streptococcus pneumoniae strain PZ900701590 chromosome, complete genome	2143685	1948603	2011495	2143685	tRNA,transposase,integrase,protease	Bacillus_phage(31.25%)	50	1942475:1942491	1950956:1950972
1942475:1942491	attL	CGAGGTGATATTATGTT	NA	NA	NA	NA
WP_166735733.1|1948603_1949164_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_166735743.1|1949124_1949736_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	41.2	1.6e-27
WP_033705234.1|1949776_1950202_+	GTP pyrophosphokinase	NA	A0A141E1X8	Streptococcus_phage	64.3	1.1e-38
WP_033705235.1|1950339_1950960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000530084.1|1951202_1952459_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	97.1	5.9e-234
1950956:1950972	attR	AACATAATATCACCTCG	NA	NA	NA	NA
WP_000355909.1|1958916_1959351_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_001862475.1|1959364_1960825_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000018260.1|1960948_1962298_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000400702.1|1962284_1962464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000124750.1|1962467_1963157_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_000859859.1|1963295_1965062_-	multidrug efflux ABC transporter subunit PatB	NA	W8CYL7	Bacillus_phage	25.6	4.1e-39
WP_050091342.1|1965841_1967536_-	multidrug efflux ABC transporter subunit PatA	NA	G9BWD6	Planktothrix_phage	30.7	2.6e-14
WP_061468547.1|1967682_1970217_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.6	1.1e-34
WP_001231473.1|1970267_1970714_-	arginine repressor	NA	NA	NA	NA	NA
WP_001092701.1|1970849_1972541_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.2	3.5e-80
WP_000356601.1|1973389_1973866_+	cupin	NA	A0A291ATU0	Pandoravirus	34.6	1.0e-16
WP_000166475.1|1973949_1974657_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	1.4e-38
WP_000833277.1|1974657_1975989_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.9	1.9e-33
WP_000669493.1|1976155_1977031_+	phosphate-binding protein	NA	NA	NA	NA	NA
WP_000595180.1|1977148_1978012_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_000049768.1|1978004_1978820_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000536449.1|1978821_1979574_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.4	3.9e-15
WP_001245781.1|1979588_1980239_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000183464.1|1980306_1980723_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001206584.1|1980845_1981286_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000415108.1|1981497_1982514_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000202229.1|1982535_1983435_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.3	3.1e-75
WP_000658498.1|1983501_1984179_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_000834308.1|1984162_1984702_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_000885102.1|1984713_1985844_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_000127466.1|1985911_1986610_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_001812545.1|1986839_1987751_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001180961.1|1987815_1990281_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_000546881.1|1990422_1991679_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2C9CYK4	Yersinia_phage	41.5	2.5e-75
WP_033705118.1|1991756_1993820_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	26.2	2.2e-52
WP_000910909.1|1993821_1994100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095515.1|1994251_1995100_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001037911.1|1995700_1996273_+	membrane protein	NA	NA	NA	NA	NA
WP_000950158.1|1997317_1999576_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	37.5	5.7e-09
WP_000747289.1|1999601_2001119_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_000095484.1|2001668_2002940_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000414968.1|2003050_2004343_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_001065636.1|2004344_2005187_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000938227.1|2005439_2006240_+	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_001145439.1|2006249_2007236_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000695830.1|2007376_2007568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033705116.1|2007571_2008513_-	YitT family protein	NA	NA	NA	NA	NA
WP_000830876.1|2008490_2010254_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SJ84	Klosneuvirus	26.4	5.0e-13
WP_000832180.1|2010605_2010836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000771214.1|2010853_2011495_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 13
NZ_CP050175	Streptococcus pneumoniae strain PZ900701590 chromosome, complete genome	2143685	2121341	2130095	2143685		Bacillus_phage(33.33%)	9	NA	NA
WP_000510412.1|2121341_2122181_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	32.6	1.1e-15
WP_033705083.1|2122165_2122993_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	32.8	1.0e-16
WP_000712132.1|2122989_2123535_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001227957.1|2123545_2124367_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000170195.1|2124408_2125692_-	insulinase family protein	NA	A0A1E1EST3	Acanthamoeba_castellanii_mimivirus	30.0	1.1e-17
WP_000424263.1|2125688_2126939_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	42.3	3.5e-93
WP_000455903.1|2127097_2127466_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	57.3	7.0e-18
WP_000266660.1|2127468_2128566_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000073428.1|2128616_2130095_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	2.2e-94
