The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050150	Hafnia alvei strain A23BA chromosome, complete genome	4687005	820634	830781	4687005		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_025801558.1|820634_821396_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.8	2.9e-66
WP_166492795.1|821389_822022_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.5	1.5e-36
WP_166492796.1|822429_823410_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.2	1.6e-05
WP_025801555.1|823462_824449_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.0	1.0e-31
WP_166492797.1|824523_827082_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	5.8e-26
WP_166492798.1|827346_830781_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	54.5	1.8e-99
>prophage 2
NZ_CP050150	Hafnia alvei strain A23BA chromosome, complete genome	4687005	1010586	1048299	4687005	portal,holin,head,terminase,capsid,tail,protease	Enterobacteria_phage(19.44%)	45	NA	NA
WP_166492841.1|1010586_1012095_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	4.2e-08
WP_166492842.1|1012539_1013721_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	69.0	3.0e-155
WP_130934786.1|1013941_1014559_-	3'-5' exoribonuclease	NA	A0A0H4IPM9	Stenotrophomonas_phage	32.3	3.1e-18
WP_130934785.1|1014551_1014875_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	58.8	5.4e-30
WP_166492843.1|1014867_1015272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166493783.1|1015268_1015730_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	55.0	7.6e-38
WP_072309948.1|1016784_1017156_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	79.2	7.7e-49
WP_166492844.1|1017610_1018249_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	43.3	6.9e-37
WP_166492845.1|1018353_1018557_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	54.4	3.9e-10
WP_046360424.1|1018581_1019124_+	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	31.5	1.3e-15
WP_166492846.1|1019120_1019300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166493784.1|1020411_1020963_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	52.8	1.6e-26
WP_166492847.1|1020965_1021235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166492848.1|1021231_1021879_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	64.4	2.2e-75
WP_166492849.1|1021869_1022880_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	44.6	1.6e-80
WP_166492850.1|1022900_1023596_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	41.2	3.2e-40
WP_166492851.1|1023726_1024500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130975663.1|1024646_1025015_+	hypothetical protein	NA	A0A1S5NRL1	Burkholderia_phage	47.2	5.6e-15
WP_095661683.1|1025011_1025290_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	39.8	1.5e-09
WP_166492852.1|1025289_1025904_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	85.4	1.2e-91
WP_166492853.1|1025900_1026110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166492854.1|1026106_1026634_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_166492855.1|1026712_1027156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166492856.1|1027274_1027625_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	74.1	3.3e-49
WP_130986803.1|1027832_1028306_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	77.1	1.2e-67
WP_166492857.1|1028306_1030043_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	88.4	3.4e-304
WP_166492858.1|1030250_1031489_+|portal	phage portal protein	portal	U5P411	Shigella_phage	73.1	2.4e-179
WP_025797691.1|1031463_1032126_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	78.9	8.3e-94
WP_166492859.1|1032130_1033348_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	70.8	1.3e-161
WP_149226282.1|1033386_1033698_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	44.6	1.0e-14
WP_166492860.1|1033694_1034039_+|head	phage head closure protein	head	Q7Y406	Yersinia_phage	60.7	2.6e-30
WP_130998371.1|1034019_1034409_+	hypothetical protein	NA	Q7Y405	Yersinia_phage	46.8	1.4e-29
WP_166492861.1|1034405_1034813_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	66.9	6.5e-41
WP_130986786.1|1034848_1035307_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	78.5	2.4e-60
WP_130986784.1|1035282_1035567_+	immunoglobulin domain-containing protein	NA	Q7Y402	Yersinia_phage	52.1	1.1e-15
WP_166492862.1|1035620_1035983_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	53.0	4.8e-27
WP_166492863.1|1036221_1039560_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	67.9	0.0e+00
WP_166492864.1|1039559_1039898_+|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	70.5	2.0e-43
WP_166492865.1|1039894_1040644_+|tail	phage minor tail protein L	tail	K7P7D8	Enterobacteria_phage	70.2	1.4e-100
WP_166492866.1|1040645_1041359_+	peptidase P60	NA	Q9MCU3	Escherichia_phage	76.7	2.8e-111
WP_166492867.1|1041401_1041764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166492868.1|1041818_1042454_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	51.2	9.5e-47
WP_166492869.1|1042504_1046008_+|tail	phage tail protein	tail	F1C571	Cronobacter_phage	51.8	0.0e+00
WP_166492870.1|1046307_1046961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166493785.1|1047315_1048299_+|tail	tail fiber domain-containing protein	tail	A0A2I6PD00	Escherichia_phage	53.6	1.6e-48
>prophage 3
NZ_CP050150	Hafnia alvei strain A23BA chromosome, complete genome	4687005	1554753	1629155	4687005	plate,portal,head,terminase,integrase,capsid,tail,lysis,protease	Salmonella_phage(47.92%)	86	1554664:1554683	1590340:1590359
1554664:1554683	attL	CAGGCAATAAAAAACCCGGT	NA	NA	NA	NA
WP_166492976.1|1554753_1555812_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	57.1	5.7e-113
WP_166492977.1|1555897_1556941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166492978.1|1557004_1557187_-	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	52.6	1.9e-08
WP_166492979.1|1557204_1557774_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	41.2	1.5e-38
WP_166492980.1|1557918_1558140_+	regulator	NA	NA	NA	NA	NA
WP_166492981.1|1558186_1558702_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	52.9	3.2e-45
WP_166492982.1|1558709_1558907_+	DUF2724 domain-containing protein	NA	A0A218M4I1	Erwinia_phage	46.8	1.9e-09
WP_166492983.1|1558870_1559212_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.4	8.2e-29
WP_166492984.1|1559279_1559504_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	53.2	3.0e-11
WP_166492985.1|1559503_1559731_+	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	58.3	2.1e-17
WP_166492986.1|1559727_1559982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131019524.1|1560015_1560288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166492987.1|1560379_1562839_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	54.7	2.3e-234
WP_130994163.1|1563000_1563198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166492988.1|1564035_1564506_+	GNAT family N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	40.0	7.1e-23
WP_166492989.1|1564506_1565088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060855053.1|1565065_1565437_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	48.4	1.1e-29
WP_166492990.1|1565446_1565983_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_166492991.1|1566006_1566426_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_166492992.1|1566436_1567213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166492993.1|1567698_1568070_-	hypothetical protein	NA	B2ZY70	Ralstonia_phage	54.0	4.1e-18
WP_166492994.1|1568088_1569150_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	81.3	8.5e-157
WP_166492995.1|1569153_1570926_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	84.4	1.1e-302
WP_166492996.1|1571068_1571896_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	55.6	4.1e-74
WP_166492997.1|1571911_1573177_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	78.1	8.5e-156
WP_130994154.1|1573180_1573840_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	55.7	9.5e-58
WP_130994153.1|1573935_1574400_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	51.9	2.4e-39
WP_166492998.1|1574399_1574603_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	73.1	3.6e-24
WP_046358755.1|1574606_1574822_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	38.0	4.5e-09
WP_166492999.1|1574802_1575315_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	70.1	6.0e-60
WP_166493000.1|1575314_1575740_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	46.8	4.3e-27
WP_166493001.1|1575835_1576264_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	56.5	5.4e-38
WP_166493002.1|1576260_1576710_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	49.6	6.5e-26
WP_166493003.1|1577071_1577560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166493004.1|1577644_1578535_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_166493005.1|1578672_1579266_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	53.1	2.4e-52
WP_130984900.1|1579262_1579610_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	58.2	2.0e-30
WP_166493006.1|1579609_1580518_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	67.9	5.1e-110
WP_130987020.1|1580510_1581050_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	68.6	9.8e-69
WP_166493007.1|1582788_1583328_+|tail	tail fiber assembly protein	tail	A0A0F7LBP0	Escherichia_phage	62.1	5.0e-57
WP_131000482.1|1583429_1584602_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	80.5	1.3e-182
WP_166493008.1|1584620_1585136_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	70.8	4.4e-66
WP_130987030.1|1585190_1585544_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	63.9	7.4e-25
WP_070715247.1|1585558_1585678_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	74.4	1.3e-10
WP_166493009.1|1585670_1588349_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	45.5	9.8e-186
WP_166493010.1|1588348_1588813_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	65.1	9.7e-49
WP_166493011.1|1588809_1589910_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	65.0	2.3e-125
WP_046358737.1|1589979_1590195_+	late control protein B	NA	Q53ZE7	Salmonella_virus	65.3	6.3e-19
WP_043492486.1|1590518_1592207_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
1590340:1590359	attR	CAGGCAATAAAAAACCCGGT	NA	NA	NA	NA
WP_025800909.1|1592538_1592931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004095905.1|1593004_1593268_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	4.5e-27
WP_025800910.1|1593423_1593729_+	YbjC family protein	NA	NA	NA	NA	NA
WP_025800911.1|1593712_1594435_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_096387014.1|1594450_1595338_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D8KN85	Synechococcus_phage	36.7	3.6e-36
WP_043492247.1|1595334_1595529_-	DUF4250 domain-containing protein	NA	NA	NA	NA	NA
WP_166493012.1|1595671_1596163_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_166493013.1|1596563_1597670_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_043492254.1|1597823_1598957_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	35.9	5.0e-30
WP_040045868.1|1598967_1599930_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_025800918.1|1599929_1600775_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_046449883.1|1600933_1601425_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_166493014.1|1601532_1602666_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.4	5.7e-26
WP_166493015.1|1602653_1603142_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.5	1.7e-27
WP_043492268.1|1603286_1604018_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025800923.1|1604247_1604916_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_025800924.1|1604915_1605632_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_025800925.1|1605880_1606612_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_043492272.1|1606681_1607410_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	2.4e-30
WP_043492275.1|1607620_1608538_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043492278.1|1608674_1609289_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_080737089.1|1609344_1609683_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	33.0	2.9e-10
WP_166493016.1|1609845_1611246_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_025800931.1|1611289_1611610_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_043492286.1|1611657_1612518_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	32.8	1.3e-11
WP_025800933.1|1612511_1613531_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025800934.1|1613818_1615264_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_166493017.1|1615352_1616405_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_046358727.1|1616641_1618363_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_166493018.1|1618621_1619626_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_025800938.1|1619689_1621342_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_025800939.1|1621555_1622455_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_043492300.1|1622678_1624349_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_111329263.1|1624410_1625361_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_025800942.1|1625721_1625943_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	1.5e-15
WP_004095820.1|1626528_1626852_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	3.7e-15
WP_025800943.1|1626878_1629155_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	8.7e-167
>prophage 4
NZ_CP050150	Hafnia alvei strain A23BA chromosome, complete genome	4687005	1641349	1652910	4687005	tRNA	Escherichia_phage(62.5%)	10	NA	NA
WP_130992402.1|1641349_1642693_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.3	1.3e-80
WP_025800951.1|1642801_1644094_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	3.1e-92
WP_130992403.1|1644577_1647022_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	5.1e-213
WP_025800953.1|1647032_1647653_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
WP_166493022.1|1647654_1648515_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.3	9.6e-26
WP_166493023.1|1648628_1649243_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.2	1.9e-28
WP_166493024.1|1649242_1649830_+	4Fe-4S binding protein	NA	A0A077SLP0	Escherichia_phage	37.4	4.2e-25
WP_043492326.1|1649946_1651086_+	MFS transporter	NA	NA	NA	NA	NA
WP_043492328.1|1651161_1651617_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_025800959.1|1652169_1652910_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 5
NZ_CP050150	Hafnia alvei strain A23BA chromosome, complete genome	4687005	1723209	1800200	4687005	plate,protease	uncultured_Caudovirales_phage(40.0%)	57	NA	NA
WP_043492591.1|1723209_1724787_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_025801009.1|1725163_1725622_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_025801010.1|1725757_1726813_-	porin OmpA	NA	NA	NA	NA	NA
WP_025801011.1|1727170_1727680_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_025801012.1|1727901_1728525_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_046361000.1|1728611_1730747_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_025801014.1|1730758_1731205_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_166493039.1|1731415_1733470_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.1	9.4e-19
WP_043492573.1|1733514_1733973_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_096387134.1|1734077_1734587_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_096387137.1|1734788_1735205_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_025801019.1|1735261_1735582_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_166493040.1|1735739_1736933_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_043492578.1|1737041_1737320_+	acylphosphatase	NA	NA	NA	NA	NA
WP_025801022.1|1737320_1737650_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_008813056.1|1737835_1738498_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.1	8.1e-41
WP_166493801.1|1738967_1739285_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_166493041.1|1739653_1749379_+	DUF4573 domain-containing protein	NA	NA	NA	NA	NA
WP_043492603.1|1749541_1750537_-	glutaminase A	NA	NA	NA	NA	NA
WP_025802699.1|1752222_1752540_-	DUF4387 domain-containing protein	NA	NA	NA	NA	NA
WP_166493042.1|1752536_1753910_-	DUF1446 domain-containing protein	NA	NA	NA	NA	NA
WP_025802703.1|1753911_1755156_-	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_025802707.1|1755155_1756601_-	methylaspartate mutase subunit E	NA	NA	NA	NA	NA
WP_096387146.1|1756615_1758007_-	glutamate mutase	NA	NA	NA	NA	NA
WP_111329293.1|1758003_1758450_-	methylaspartate mutase subunit S	NA	NA	NA	NA	NA
WP_166493043.1|1759052_1759913_-	GHMP kinase	NA	NA	NA	NA	NA
WP_043492618.1|1759999_1760782_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_166493044.1|1761533_1763069_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_025802718.1|1763094_1763853_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_166493045.1|1763875_1764940_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025802722.1|1764972_1765896_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166493046.1|1766058_1767705_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_166493047.1|1767721_1768312_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_043492645.1|1768876_1769521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025802730.1|1770490_1770991_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_038502127.1|1771016_1772570_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_166493048.1|1772588_1773938_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_040045958.1|1773934_1774594_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_166493049.1|1774606_1776316_+	OmpA family protein	NA	NA	NA	NA	NA
WP_025802740.1|1776403_1776895_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_166493050.1|1777102_1779838_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	1.7e-92
WP_166493051.1|1779831_1782342_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	35.4	9.4e-21
WP_096387183.1|1782545_1783349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166493052.1|1783403_1784207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166493053.1|1784261_1785065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096387186.1|1785122_1785899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166493054.1|1785954_1786710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096387192.1|1786753_1787527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166493055.1|1787681_1789667_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	29.8	1.2e-50
WP_096387198.1|1789672_1789933_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_166493056.1|1789932_1791381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166493057.1|1791403_1794748_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_115348616.1|1794747_1796340_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_040045971.1|1796417_1798181_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_166493058.1|1798144_1799230_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_166493059.1|1799210_1799759_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_040045974.1|1799762_1800200_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 6
NZ_CP050150	Hafnia alvei strain A23BA chromosome, complete genome	4687005	2168819	2182720	4687005	tRNA	Tupanvirus(22.22%)	14	NA	NA
WP_025801264.1|2168819_2170757_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	1.6e-129
WP_025801265.1|2170752_2171295_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	8.8e-17
WP_025801266.1|2171393_2171591_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004089950.1|2171633_2171990_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_121626058.1|2172120_2172165_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_166493140.1|2172457_2173441_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	1.7e-34
WP_130995045.1|2173455_2175843_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.9	6.6e-08
WP_004089944.1|2175847_2176144_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_025801269.1|2176227_2176425_+	protein DsrB	NA	NA	NA	NA	NA
WP_166493813.1|2176483_2177509_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_166493814.1|2177511_2178297_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	W5SAS9	Pithovirus	26.6	1.6e-06
WP_025801272.1|2178580_2179729_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	C7U074	Ostreococcus_tauri_virus	27.8	1.2e-23
WP_046449407.1|2179721_2180738_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.9	1.5e-38
WP_166493141.1|2180737_2182720_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	9.6e-21
>prophage 7
NZ_CP050150	Hafnia alvei strain A23BA chromosome, complete genome	4687005	2549289	2606609	4687005	plate,portal,head,terminase,tRNA,capsid,integrase,tail,lysis	Enterobacteria_phage(25.0%)	67	2564415:2564429	2588623:2588637
WP_072309757.1|2549289_2550558_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	67.7	1.1e-166
WP_072309758.1|2550557_2550977_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	58.8	2.2e-39
WP_072309760.1|2551847_2552393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157743844.1|2552411_2552927_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	40.6	1.9e-29
WP_096387768.1|2552934_2554599_-	hypothetical protein	NA	S4TP62	Salmonella_phage	26.7	8.1e-29
WP_096387770.1|2554591_2555143_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.0	8.3e-31
WP_096387772.1|2555135_2556050_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	45.7	4.5e-66
WP_096387774.1|2556033_2556384_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	52.3	2.1e-24
WP_096387776.1|2556417_2557542_-	late control protein D	NA	R9TNM7	Vibrio_phage	34.1	2.2e-38
WP_096387778.1|2557544_2557760_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.9	2.8e-11
WP_096387780.1|2557734_2558211_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	36.3	1.7e-16
WP_096387782.1|2560328_2560625_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_046360401.1|2560679_2561186_-|tail	tail protein	tail	A0A1B2LRS4	Wolbachia_phage	32.7	2.9e-14
WP_166493271.1|2561185_2562649_-|tail	phage tail protein	tail	K4HZC3	Acidithiobacillus_phage	37.1	5.5e-74
WP_096387786.1|2562685_2563300_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	37.9	7.9e-14
WP_096387788.1|2563292_2563832_-	hypothetical protein	NA	R9TNK0	Vibrio_phage	29.0	6.9e-14
WP_166493272.1|2563840_2564500_-	hypothetical protein	NA	R9TR34	Vibrio_phage	35.2	3.3e-18
2564415:2564429	attL	GCACCGACGCCATTG	NA	NA	NA	NA
WP_096387790.1|2564501_2564876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096387792.1|2564883_2565267_-	hypothetical protein	NA	K7P7M3	Enterobacteria_phage	32.6	3.4e-07
WP_096387794.1|2565304_2566342_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	68.2	3.2e-132
WP_096387795.1|2566417_2566744_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	60.4	2.1e-29
WP_096387796.1|2566754_2568047_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	58.2	5.2e-124
WP_096387798.1|2568033_2569629_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	73.2	1.3e-225
WP_072307257.1|2569625_2569832_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	53.8	8.4e-13
WP_096387800.1|2569833_2571750_-|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	74.0	6.6e-293
WP_096387802.1|2571721_2572222_-	DNA-packaging protein	NA	O64316	Escherichia_phage	73.2	3.7e-62
WP_072307254.1|2572434_2572872_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046459177.1|2573401_2573650_+	DUF883 family protein	NA	NA	NA	NA	NA
WP_096388758.1|2574303_2574750_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	39.9	3.5e-19
WP_166493273.1|2574770_2575298_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	68.0	6.9e-67
WP_096387806.1|2575297_2575567_-|lysis	lysis protein	lysis	Q7Y3V4	Yersinia_phage	45.3	1.2e-14
WP_072308778.1|2576104_2576398_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_155403083.1|2576495_2576654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072308777.1|2576756_2576990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096387808.1|2577224_2577920_-	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	40.8	4.2e-40
WP_096387810.1|2577940_2578939_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	45.3	5.6e-78
WP_096387812.1|2578935_2579583_-	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	71.4	9.9e-92
WP_130992435.1|2579585_2579858_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096387816.1|2579860_2580727_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	73.1	5.3e-32
WP_072308768.1|2580723_2580903_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_096387818.1|2581083_2581617_-	DNA-binding protein	NA	A0A0P0ZE62	Stx2-converting_phage	34.8	6.2e-15
WP_096387820.1|2581656_2581869_-	helix-turn-helix transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	69.1	2.1e-22
WP_096387822.1|2581978_2582632_+	LexA family transcriptional regulator	NA	K7PH71	Enterobacterial_phage	69.8	1.2e-81
WP_096387824.1|2582997_2583342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096387826.1|2583334_2583943_+	3'-5' exoribonuclease	NA	A0A0H4IPM9	Stenotrophomonas_phage	31.4	9.8e-17
WP_096387828.1|2584014_2584266_+	excisionase	NA	NA	NA	NA	NA
WP_096387830.1|2584240_2585374_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	74.5	3.9e-160
WP_025797012.1|2585485_2586739_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	5.7e-19
WP_111329605.1|2586980_2587607_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_025797016.1|2587679_2588132_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_025797017.1|2588411_2589032_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
2588623:2588637	attR	GCACCGACGCCATTG	NA	NA	NA	NA
WP_166493274.1|2589033_2591049_+	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
WP_096387840.1|2591059_2592010_+	respiratory chain complex I subunit 1 family protein	NA	NA	NA	NA	NA
WP_130992436.1|2592025_2593465_+	hydrogenase 4 subunit D	NA	NA	NA	NA	NA
WP_025797022.1|2593476_2594127_+	hydrogenase 4 membrane subunit	NA	NA	NA	NA	NA
WP_046449176.1|2594131_2595718_+	hydrogenase 4 subunit F	NA	NA	NA	NA	NA
WP_166493275.1|2595719_2597459_+	hydrogenase large subunit	NA	NA	NA	NA	NA
WP_025797025.1|2597469_2598021_+	hydrogenase 4 subunit H	NA	NA	NA	NA	NA
WP_043493569.1|2598017_2598794_+	NADH-quinone oxidoreductase subunit B family protein	NA	NA	NA	NA	NA
WP_166493276.1|2598793_2599225_+	HycH family protein	NA	NA	NA	NA	NA
WP_166493822.1|2599299_2601237_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_043493574.1|2601598_2602456_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_111329613.1|2602644_2603370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025797035.1|2603468_2604053_+	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_043493578.1|2604111_2604675_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_040046565.1|2604671_2605355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043493582.1|2605505_2606609_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP050150	Hafnia alvei strain A23BA chromosome, complete genome	4687005	3215172	3258656	4687005	tail,integrase,head,holin	Salmonella_phage(31.91%)	61	3214106:3214120	3258734:3258748
3214106:3214120	attL	ATGCAATGGTTAGCC	NA	NA	NA	NA
WP_166493428.1|3215172_3215733_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	61.8	2.4e-57
WP_166493429.1|3215740_3217504_-	hypothetical protein	NA	Q8W611	Enterobacteria_phage	43.0	5.0e-37
WP_166493430.1|3217527_3218085_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	45.0	6.0e-37
WP_166493431.1|3218094_3219444_-	hypothetical protein	NA	U5N099	Enterobacteria_phage	45.9	1.4e-92
WP_166493432.1|3219445_3220021_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	38.9	1.4e-33
WP_166493433.1|3220017_3221208_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	49.5	2.5e-104
WP_166493434.1|3221200_3221548_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	63.7	8.3e-37
WP_166493435.1|3221547_3222297_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	72.5	4.8e-98
WP_166493436.1|3222342_3222588_-	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	46.2	1.8e-06
WP_166493437.1|3222686_3223754_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	65.3	4.9e-128
WP_166493438.1|3223790_3224096_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	51.0	1.2e-20
WP_166493439.1|3224086_3224668_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	65.9	1.4e-60
WP_166493440.1|3224667_3226698_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	53.6	1.3e-193
WP_166493441.1|3226687_3226864_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	71.4	1.9e-13
WP_166493442.1|3226884_3227301_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	62.2	1.3e-39
WP_166493443.1|3227304_3227745_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	81.5	1.7e-63
WP_166493444.1|3227756_3229238_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	53.3	3.7e-142
WP_166493445.1|3229241_3229805_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	52.0	3.7e-50
WP_166493446.1|3229779_3230169_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	67.2	1.6e-41
WP_166493447.1|3230168_3230666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166493448.1|3230662_3231070_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	56.7	5.3e-35
WP_166493449.1|3231038_3231368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166493450.1|3231417_3232365_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	57.9	6.3e-103
WP_166493451.1|3232375_3232879_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	49.4	2.6e-31
WP_166493452.1|3232889_3234164_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	42.8	1.4e-76
WP_166493832.1|3234212_3234761_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	57.5	8.8e-49
WP_166493453.1|3234822_3236286_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	54.3	4.3e-151
WP_166493454.1|3236287_3237904_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	84.5	7.8e-279
WP_166493833.1|3238102_3238771_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.4	6.9e-88
WP_166493834.1|3239127_3239343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166493455.1|3239362_3240241_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	52.6	1.7e-78
WP_166493456.1|3240233_3241028_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	43.4	1.6e-51
WP_166493457.1|3241300_3241483_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_166493458.1|3241746_3242289_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	81.0	2.0e-85
WP_166493459.1|3242275_3242572_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	36.8	4.2e-05
WP_166493835.1|3242572_3242968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166493460.1|3243815_3244760_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	43.0	1.8e-65
WP_166493461.1|3244781_3245231_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	45.2	2.6e-22
WP_166493462.1|3245267_3245654_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	84.0	1.3e-51
WP_166493463.1|3245653_3245992_-	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	69.2	1.6e-29
WP_166493464.1|3245991_3246600_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	55.7	1.8e-58
WP_166493465.1|3246894_3247134_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	51.9	9.5e-16
WP_166493466.1|3247215_3247959_-	hypothetical protein	NA	A0A248SL55	Klebsiella_phage	37.6	5.6e-22
WP_166493467.1|3248882_3249140_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	41.9	1.1e-12
WP_166493468.1|3249239_3249665_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166493469.1|3249978_3250512_-	hypothetical protein	NA	A4KWR7	Enterobacteria_phage	34.9	2.5e-24
WP_166493470.1|3250795_3251092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166493471.1|3251096_3251402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166493472.1|3251488_3251680_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_166493473.1|3251676_3251955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166493474.1|3252464_3252656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166493475.1|3252652_3253186_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	79.7	2.7e-50
WP_166493476.1|3253203_3253359_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_166493477.1|3253558_3253927_+	hypothetical protein	NA	A0A088CD28	Shigella_phage	37.3	4.1e-10
WP_166493478.1|3253932_3255789_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	5.4e-82
WP_166493479.1|3255785_3256289_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	69.1	5.2e-56
WP_166493480.1|3256333_3256792_+	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	42.7	8.7e-18
WP_166493481.1|3256803_3257088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166493482.1|3257081_3257270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166493483.1|3257389_3257650_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	48.6	7.6e-11
WP_166493484.1|3257588_3258656_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	52.5	1.5e-105
3258734:3258748	attR	ATGCAATGGTTAGCC	NA	NA	NA	NA
>prophage 1
NZ_CP050151	Hafnia alvei strain A23BA plasmid pA23BA, complete sequence	85042	66869	74533	85042	transposase	Yersinia_phage(33.33%)	7	NA	NA
WP_166493906.1|66869_67295_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.2	1.9e-30
WP_166493907.1|67296_68556_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	56.8	1.2e-141
WP_166493908.1|68563_68899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166493930.1|69844_70810_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	57.5	1.4e-89
WP_166493909.1|70806_71973_-	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.0	3.9e-195
WP_072308040.1|72525_73227_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	30.9	1.5e-24
WP_166493910.1|73579_74533_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.1	2.5e-75
