The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050133	Streptococcus cristatus ATCC 51100 chromosome, complete genome	2031205	144052	154362	2031205		Streptococcus_phage(50.0%)	11	NA	NA
WP_045500228.1|144052_146248_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.7	5.4e-283
WP_005592063.1|146249_146387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045500230.1|146446_146944_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_045500232.1|146953_147460_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_045500233.1|147469_148015_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015605938.1|147980_148580_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.4	1.8e-55
WP_045500241.1|148910_150368_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	61.8	3.0e-144
WP_045500243.1|150371_151103_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_005591513.1|151131_151827_+	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	55.0	2.9e-57
WP_045500246.1|151835_152534_+	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	56.5	1.9e-64
WP_045500248.1|152553_154362_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	27.5	1.9e-23
>prophage 2
NZ_CP050133	Streptococcus cristatus ATCC 51100 chromosome, complete genome	2031205	476412	486212	2031205		Streptococcus_phage(88.89%)	12	NA	NA
WP_045500831.1|476412_477792_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	35.6	1.4e-31
WP_045500833.1|477800_478352_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_045500835.1|478364_478676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045500837.1|478759_479452_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_045500839.1|479504_480392_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	55.3	3.8e-86
WP_045500841.1|480572_481211_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	72.1	3.1e-82
WP_045500843.1|481207_482110_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	56.5	8.1e-84
WP_005591852.1|482119_482437_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.0	7.6e-29
WP_045500845.1|482439_483306_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	72.9	3.0e-112
WP_045500847.1|483444_484536_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	79.6	9.9e-169
WP_045500849.1|484548_485724_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	80.0	2.4e-176
WP_045500851.1|485858_486212_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	56.4	1.5e-33
>prophage 3
NZ_CP050133	Streptococcus cristatus ATCC 51100 chromosome, complete genome	2031205	956606	966208	2031205		Streptococcus_phage(42.86%)	11	NA	NA
WP_045497159.1|956606_957524_+	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	29.4	2.8e-23
WP_045497162.1|957670_958237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045497164.1|958241_959219_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005590207.1|959518_959902_+	RidA family protein	NA	NA	NA	NA	NA
WP_045497166.1|959969_960860_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	3.0e-06
WP_045497168.1|960856_961834_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	82.2	6.2e-154
WP_045497171.1|961830_962742_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	72.6	3.9e-118
WP_045497174.1|962775_963744_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	75.0	1.4e-49
WP_045497178.1|963854_965171_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	43.0	3.9e-95
WP_045497181.1|965364_965721_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_005592027.1|965830_966208_+	BlaI/MecI/CopY family transcriptional regulator	NA	X5JAW5	Clostridium_phage	35.0	1.6e-12
>prophage 4
NZ_CP050133	Streptococcus cristatus ATCC 51100 chromosome, complete genome	2031205	1292983	1300249	2031205		Streptococcus_phage(66.67%)	9	NA	NA
WP_045499432.1|1292983_1293613_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.2	1.4e-29
WP_045499429.1|1293621_1294263_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_045499426.1|1294707_1295004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166492637.1|1294992_1295145_-	hypothetical protein	NA	Q7Y4L9	Streptococcus_phage	75.6	2.4e-09
WP_045499423.1|1295202_1295892_+	DUF4145 domain-containing protein	NA	A0A1S5S8U0	Streptococcus_phage	92.6	1.2e-119
WP_045499420.1|1296161_1296935_+	helix-turn-helix domain-containing protein	NA	A0A141E0Q5	Streptococcus_phage	65.7	9.7e-78
WP_045499417.1|1297101_1298052_+	Abi family protein	NA	A0A1S5S8T0	Streptococcus_phage	97.5	6.0e-178
WP_005590628.1|1299456_1299804_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_045499415.1|1299922_1300249_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	38.9	3.6e-10
>prophage 5
NZ_CP050133	Streptococcus cristatus ATCC 51100 chromosome, complete genome	2031205	1499806	1510175	2031205	protease	Tupanvirus(16.67%)	8	NA	NA
WP_045498980.1|1499806_1501348_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	1.8e-54
WP_045498977.1|1501603_1502260_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	73.6	5.0e-83
WP_045498974.1|1502537_1503392_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	36.7	3.7e-38
WP_005592360.1|1503531_1503762_-	DUF1797 family protein	NA	NA	NA	NA	NA
WP_045498971.1|1504003_1506277_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.6	3.3e-126
WP_045498968.1|1507094_1508405_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_045498965.1|1508405_1509095_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	2.6e-34
WP_008809655.1|1509266_1510175_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.5	1.3e-44
>prophage 6
NZ_CP050133	Streptococcus cristatus ATCC 51100 chromosome, complete genome	2031205	1568957	1581675	2031205	integrase	Streptococcus_phage(75.0%)	15	1568844:1568875	1582671:1582702
1568844:1568875	attL	AAATTTCTTCAAATGTCATGGTTTTCTCCTTT	NA	NA	NA	NA
WP_045498801.1|1568957_1570103_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	50.5	4.2e-101
WP_045498799.1|1570225_1571692_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_045498797.1|1571962_1572781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045498796.1|1572827_1573406_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	33.0	1.4e-09
WP_045498795.1|1573569_1573767_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I5U5	Streptococcus_phage	72.3	4.9e-18
WP_045498793.1|1573779_1574409_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	42.3	3.0e-16
WP_045498786.1|1575592_1575925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045498782.1|1575917_1576199_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	72.2	1.6e-30
WP_045498779.1|1576333_1577194_+	phage protein	NA	A0A1X9I6L2	Streptococcus_phage	71.8	1.8e-117
WP_045498776.1|1577213_1578716_+	DNA primase	NA	Q9AZI5	Lactococcus_phage	36.1	3.6e-60
WP_166492639.1|1579052_1579229_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	64.9	5.5e-13
WP_045498773.1|1579240_1579699_+	hypothetical protein	NA	A0A1X9I5V5	Streptococcus_phage	53.0	3.1e-39
WP_045498769.1|1580554_1580908_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SEX8	Streptococcus_phage	87.2	1.7e-53
WP_045498766.1|1580891_1581107_-	AbrB family transcriptional regulator	NA	A0A1S5SET9	Streptococcus_phage	85.9	1.8e-26
WP_045498763.1|1581240_1581675_+	DUF1492 domain-containing protein	NA	A0A1S5S8W3	Streptococcus_phage	29.2	9.2e-09
1582671:1582702	attR	AAATTTCTTCAAATGTCATGGTTTTCTCCTTT	NA	NA	NA	NA
