The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050139	Komagataeibacter rhaeticus strain ENS 9a1a chromosome, complete genome	3597563	424887	490624	3597563	transposase	Enterobacteria_phage(40.0%)	55	NA	NA
WP_012813092.1|424887_425202_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_112209847.1|426899_427088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112209845.1|427168_427726_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_112210156.1|428191_428674_-	Hsp20 family protein	NA	A0A218MMV3	uncultured_virus	36.1	1.9e-18
WP_112209841.1|428709_428991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102324447.1|428989_429253_+	BcpO-related WXXGXW repeat protein	NA	NA	NA	NA	NA
WP_010511782.1|429773_430022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010511780.1|430130_430394_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_006559873.1|430386_430731_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	4.5e-19
WP_166498090.1|431005_431428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166498091.1|431455_433672_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_166498092.1|433908_434664_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_166498093.1|435005_435647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166498094.1|435676_437413_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_166498095.1|437409_447276_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_083824506.1|447573_448008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083824534.1|449497_449689_-	hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	1.2e-08
WP_166498096.1|452197_453991_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_166498097.1|454246_454618_+	DUF3742 family protein	NA	NA	NA	NA	NA
WP_166498098.1|454619_456143_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_166498099.1|456139_456511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166498100.1|456507_457920_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_166498101.1|457931_458882_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_166498102.1|458878_459322_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_166498103.1|459462_460032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166498104.1|460570_460978_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_166498105.1|460978_461212_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_166498106.1|461326_462073_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_166498107.1|462082_464959_-	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_166498108.1|464958_465399_-	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_166498182.1|465379_466831_-	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_166498109.1|466820_467735_-	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_166498110.1|467731_468424_-	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_166498111.1|468420_468852_-	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_166498112.1|468867_469236_-	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_166498113.1|469259_469499_-	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_166498114.1|469495_469861_-	raqprd family integrative conjugative element protein	NA	NA	NA	NA	NA
WP_166498115.1|470188_470458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166498116.1|470481_470880_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_166498117.1|470876_471134_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_166498118.1|471235_471955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166498119.1|472249_472858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166498120.1|473016_473517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626675.1|473889_474165_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_003618982.1|475373_475775_+	VOC family protein	NA	NA	NA	NA	NA
WP_166498121.1|475799_476627_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_039906093.1|477069_478260_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_166498183.1|478687_480253_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_166498122.1|480249_481089_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.3	1.0e-35
WP_166498123.1|483453_484233_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.1	1.8e-34
WP_007396201.1|485095_486175_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_083819175.1|486543_488271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130732960.1|488335_488605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083824464.1|488792_489761_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_039999222.1|489814_490624_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP050139	Komagataeibacter rhaeticus strain ENS 9a1a chromosome, complete genome	3597563	3313020	3355100	3597563	integrase,transposase	Acinetobacter_phage(22.22%)	42	3300913:3300972	3354360:3354519
3300913:3300972	attL	CGCTGGATCGTGGAGCGCAGCTTTGCATGGCTCGGACGCTGCCGTCGCCTCACGAAGGAT	NA	NA	NA	NA
WP_039998313.1|3313020_3314052_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166498166.1|3314129_3318872_+	DEAD/DEAH box helicase	NA	A0A1V0SLK7	Klosneuvirus	24.5	5.3e-25
WP_007396369.1|3319149_3319704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039998314.1|3319704_3320319_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_034931780.1|3320607_3321381_-	aromatic-ring-hydroxylating dioxygenase	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	27.0	9.6e-09
WP_112209798.1|3321370_3322510_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081749560.1|3323905_3324175_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_061276673.1|3324171_3324447_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_166498167.1|3325351_3326293_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.2	1.3e-12
WP_035366892.1|3326619_3327219_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_061507197.1|3327217_3327433_+	DUF2945 domain-containing protein	NA	NA	NA	NA	NA
WP_003631413.1|3327456_3327636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025439978.1|3329073_3330267_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	22.3	7.6e-13
WP_112209709.1|3330727_3331231_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	46.0	1.1e-21
WP_112209721.1|3331260_3331776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158551941.1|3331681_3331999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112209708.1|3332348_3332771_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_112209707.1|3332767_3333025_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_112209706.1|3333207_3333462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061275760.1|3333538_3333955_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	38.9	7.2e-19
WP_019087453.1|3333965_3334145_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	59.3	7.3e-13
WP_166498168.1|3334344_3335531_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_112209712.1|3335877_3336300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112209711.1|3337364_3338315_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_083824336.1|3338311_3338629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062247395.1|3338628_3339282_-	ParA family protein	NA	B0ZSI1	Halomonas_phage	28.4	4.3e-10
WP_007396268.1|3339437_3339857_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_039998284.1|3339860_3340115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112209710.1|3340203_3340839_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_110096515.1|3340835_3341132_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_007396290.1|3341528_3343103_+	Fic family protein	NA	NA	NA	NA	NA
WP_007396156.1|3344673_3346113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007396158.1|3346332_3346467_-	resolvase	NA	NA	NA	NA	NA
WP_034933542.1|3346467_3346707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019087483.1|3347124_3347724_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007396161.1|3347713_3348958_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_112209677.1|3349542_3351279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039998494.1|3351280_3351598_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_146750195.1|3352427_3352748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112209689.1|3352773_3353253_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_083824501.1|3353385_3354069_-	hypothetical protein	NA	A0A1I9KF49	Aeromonas_phage	29.4	1.0e-09
WP_039998273.1|3354269_3355100_-|transposase	IS5-like element IS1032 family transposase	transposase	NA	NA	NA	NA
3354360:3354519	attR	ATCCTTCGTGAGGCGACGGCAGCGTCCGAGCCATGCAAAGCTGCGCTCCACGATCCAGCGTTTGGGCAGGACGACGAAGCCTTCGGCCCGATCGCTACGCTTGACGATCTCGATCGTCCATCGGCCGAGTTCAGCCAGCGCACCACGCAACTTCTCGCCG	NA	NA	NA	NA
