The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050120	Deinococcus radiodurans strain BND-54 chromosome 1, complete sequence	2648637	2468380	2477580	2648637	protease	Paramecium_bursaria_Chlorella_virus(16.67%)	9	NA	NA
WP_027480280.1|2468380_2470201_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	40.5	2.2e-112
WP_027480281.1|2470780_2470987_+	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_027480282.1|2470983_2472084_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	22.7	5.2e-08
WP_010886944.1|2472166_2472784_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	24.5	5.0e-08
WP_010886943.1|2472783_2473407_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	31.3	9.7e-20
WP_010886942.1|2473482_2474955_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_010886941.1|2474998_2475295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010886940.1|2475291_2476140_+	phosphoprotein phosphatase	NA	A0A2H4PRN7	Proteus_phage	25.0	2.0e-07
WP_010886939.1|2476191_2477580_+	nicotinate phosphoribosyltransferase	NA	A0A1B0V392	Roseobacter_phage	51.1	5.0e-125
>prophage 1
NZ_CP050122	Deinococcus radiodurans strain BND-54 plasmid pMP1, complete sequence	177347	7861	82110	177347	transposase,integrase	Bacillus_phage(38.89%)	53	8981:9018	82271:82308
WP_010884022.1|7861_8845_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
8981:9018	attL	AACAGTCGGCCCCATCAAGCTTGATGGGGCCGACTGTT	NA	NA	NA	NA
WP_010884035.1|9209_9923_+	DUF2259 domain-containing protein	NA	NA	NA	NA	NA
WP_063653102.1|10330_11515_-|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_027480400.1|13013_13580_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_162177815.1|13793_16103_-	glycerophosphodiester phosphodiesterase	NA	A0A2P1N091	Streptomyces_phage	36.0	3.2e-07
WP_010884021.1|16161_16425_-	thioredoxin	NA	NA	NA	NA	NA
WP_027480401.1|16417_17413_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A142F1R6	Bacillus_phage	50.8	7.3e-86
WP_027480402.1|17469_19557_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	47.8	1.1e-189
WP_010883964.1|19541_19967_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S5MA49	Bacillus_phage	33.3	5.1e-12
WP_162177816.1|20123_20606_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010883962.1|21039_22074_-|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	33.3	1.3e-08
WP_063653103.1|22231_23407_-|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_010884020.1|23632_24616_+|transposase	IS4-like element ISDra1 family transposase	transposase	NA	NA	NA	NA
WP_081816080.1|25039_25921_+	hypothetical protein	NA	A0A1V0SK86	Klosneuvirus	27.6	6.6e-30
WP_010884034.1|26113_26746_+	RNA ligase family protein	NA	A0A248SJ81	Salicola_phage	49.0	5.5e-55
WP_010884064.1|26742_27600_+	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	38.4	7.6e-39
WP_010884033.1|27575_28817_+	AAA family ATPase	NA	D5GVP0	Campylobacter_virus	31.4	7.2e-06
WP_034351235.1|28900_29689_-	alpha/beta fold hydrolase	NA	A0A218MNI3	uncultured_virus	40.8	4.9e-61
WP_010884031.1|29858_30197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165439381.1|30236_30629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162150140.1|32282_33314_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.0	1.2e-14
WP_010883959.1|33496_34222_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	24.6	1.4e-06
WP_010883958.1|34421_35081_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.0	2.8e-25
WP_010883957.1|35077_36433_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.0	4.0e-10
WP_010884029.1|36586_38002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010883956.1|38348_39446_-	sensor histidine kinase KdpD	NA	NA	NA	NA	NA
WP_051618915.1|39451_40042_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_010883954.1|40234_41941_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_010884066.1|41943_42159_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_034351346.1|44714_46262_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_166466121.1|46254_46884_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_162177797.1|46918_47671_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010883950.1|47906_49094_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_027480350.1|49112_49883_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010884014.1|50705_51524_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.4	2.5e-15
WP_027480352.1|51783_54264_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A2D2W2B1	Stenotrophomonas_phage	40.5	3.2e-05
WP_010884013.1|54265_55213_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_010884012.1|55351_57148_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_162177800.1|57162_57537_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_010884060.1|57627_57879_+	PqqD family protein	NA	NA	NA	NA	NA
WP_010884063.1|57875_58739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884010.1|58774_61009_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	29.7	4.9e-21
WP_010884059.1|61026_63687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884009.1|64399_67603_-	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_166466122.1|67592_67757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162177798.1|69288_72675_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_010884056.1|73023_73350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166466123.1|73354_76252_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_027480358.1|76293_76620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027480359.1|76824_77301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063653036.1|77439_78672_-|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	28.1	1.7e-36
WP_010884019.1|80083_81067_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_149358002.1|81594_82110_-|transposase	transposase	transposase	NA	NA	NA	NA
82271:82308	attR	AACAGTCGGCCCCATCAAGCTTGATGGGGCCGACTGTT	NA	NA	NA	NA
