The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	123060	171156	4945802	tRNA,transposase	Moumouvirus(16.67%)	44	NA	NA
WP_011408598.1|123060_124455_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|124456_124714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|124710_125016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|125012_125339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|126065_126728_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|126816_127347_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|129570_130842_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|131013_132381_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|132684_134130_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|134126_134813_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|134785_135805_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|135846_136407_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|136427_137384_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|137551_138328_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|138811_140947_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|140943_141135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|142909_143416_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|143456_143984_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|143980_144472_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|144495_145071_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|145147_146101_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|146189_147062_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011408616.1|147058_147904_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|148016_148715_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|148878_149661_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|149669_150050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|150046_150757_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|152067_152616_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011257031.1|152787_153756_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408623.1|154360_155596_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|156159_156480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|156819_158070_+	porin	NA	NA	NA	NA	NA
WP_011408625.1|158258_159278_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	1.6e-48
WP_011408626.1|159465_160557_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|160669_161644_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|161643_162513_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|162535_163366_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|163494_164205_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259116.1|164337_164745_+	RcnB family protein	NA	NA	NA	NA	NA
WP_011259117.1|165028_165664_+	ribonuclease T	NA	NA	NA	NA	NA
WP_011408631.1|165734_167054_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|167290_168352_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|168402_169587_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181954.1|169836_171156_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	177875	250161	4945802	tRNA,transposase,protease	uncultured_Mediterranean_phage(33.33%)	52	NA	NA
WP_011259125.1|177875_179021_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|179090_180161_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|180347_180779_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408638.1|180902_182399_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259129.1|182743_183451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408645.1|186797_187919_-	phytase	NA	NA	NA	NA	NA
WP_011259142.1|190797_191430_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|191826_192589_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|192869_193901_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|193907_195701_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_011408649.1|195697_195982_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703974.1|196213_196711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|196757_197264_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|197260_197881_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|198121_200026_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_162866905.1|200113_201144_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|201268_202588_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|202821_203979_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|204255_205221_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_166473741.1|205198_206674_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_162013043.1|206709_206916_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011258802.1|208490_209459_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257031.1|210373_211342_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_075245207.1|211609_211843_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|213723_214944_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|215258_216656_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011408657.1|216666_217884_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|217883_218522_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|218592_219453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|219449_220238_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|220248_221454_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|221472_221898_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|222117_222750_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|222774_225147_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|225304_226510_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|226830_228162_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|228158_228509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|228540_228948_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|228944_229271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|229302_230679_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_042465563.1|230915_235082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703232.1|235194_235866_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259179.1|235930_237859_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|238021_240382_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|240665_241634_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|241691_242813_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|244240_244993_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|245073_245292_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011408664.1|245572_247855_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.5	4.3e-174
WP_005914463.1|247998_248319_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|248569_249028_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011408666.1|249024_250161_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	331898	361700	4945802	transposase	Ralstonia_phage(75.0%)	13	NA	NA
WP_115801909.1|331898_333218_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|333367_334336_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_128896930.1|334430_334967_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_042464958.1|334999_340240_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.6e-09
WP_011258802.1|342460_343429_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407175.1|344847_345816_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_125168757.1|347440_347920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|356044_356437_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|356445_356907_+	cytochrome c	NA	NA	NA	NA	NA
WP_041182155.1|357411_357672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408705.1|358460_358637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801893.1|359429_360395_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082323190.1|360401_361700_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	365886	401351	4945802	tRNA,transposase	Streptococcus_phage(33.33%)	32	NA	NA
WP_042465572.1|365886_366843_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	4.0e-41
WP_011259267.1|367645_367909_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_115840191.1|368050_369016_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011259269.1|369353_369464_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_011408713.1|369684_370950_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259272.1|370930_372844_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408714.1|373211_374456_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011408715.1|374620_375775_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011259275.1|375788_376049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408716.1|376048_376414_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408717.1|376413_377709_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_041182650.1|377832_378783_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011408720.1|379395_380739_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011408721.1|380778_381879_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011408722.1|381884_382337_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408723.1|382578_383820_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011259283.1|383891_384917_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_027703614.1|385229_385724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444736.1|385900_387325_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|387822_388260_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|388256_389507_+	MFS transporter	NA	NA	NA	NA	NA
WP_113063337.1|389574_390636_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|390778_391819_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011408727.1|391903_392191_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|392187_393537_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011408729.1|393536_394376_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_094187715.1|395274_396037_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|396063_396327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|396698_397187_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011408734.1|397410_398730_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|398866_399835_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181979.1|400034_401351_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	433182	508270	4945802	tRNA,transposase,protease	Bacillus_virus(20.0%)	59	NA	NA
WP_011259328.1|433182_434061_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|434158_435058_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|435145_435886_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|436045_436621_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|436794_437766_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011408750.1|437799_438741_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|438740_440618_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_011408751.1|440755_442489_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259336.1|442541_443042_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011259337.1|443038_444526_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_011408752.1|444550_445618_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011408753.1|445763_447101_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_011259340.1|447396_448659_-	virulence factor	NA	NA	NA	NA	NA
WP_094187754.1|448875_449623_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|449939_451775_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_011408756.1|452046_453138_+	ribonuclease D	NA	NA	NA	NA	NA
WP_011259345.1|454230_454632_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015463309.1|455495_455675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153296741.1|455818_456016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|456276_456567_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|456554_456833_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_027703931.1|457317_457518_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408397.1|458278_459463_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181928.1|460043_461009_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042465594.1|465573_465918_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|466128_466455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|466487_466928_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|467006_467642_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_011259354.1|468035_468794_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259355.1|468786_470046_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259356.1|470045_470690_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|471219_472206_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011408766.1|474133_475588_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|476011_476998_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|477409_478072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|478126_478612_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|478611_479130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|479224_480103_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|480099_481380_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|481395_482397_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|482548_483913_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|484167_484578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|484733_485564_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|485877_487125_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011408777.1|487270_488764_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|488768_490355_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|490351_491554_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_115892987.1|491997_493449_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408781.1|493682_495068_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011259377.1|495975_497355_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_011408783.1|497354_498671_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011259379.1|498753_500052_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.7e-19
WP_011408784.1|500359_501640_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_011408785.1|501945_502224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259381.1|502213_504562_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_011259382.1|504558_505404_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_069960340.1|505410_507150_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_075242096.1|507292_507475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182012.1|507507_508270_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	520922	606460	4945802	transposase	Ralstonia_phage(46.15%)	53	NA	NA
WP_011408791.1|520922_521906_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.4e-97
WP_011408792.1|522354_527379_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011408793.1|527656_528316_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408794.1|528330_529635_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|529647_532818_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_166473742.1|533793_534759_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408798.1|535465_536461_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059317461.1|536621_539138_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|539134_540091_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_069963855.1|540249_541992_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_012444645.1|542169_543447_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011258188.1|544113_545082_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_069959892.1|545376_547722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182891.1|547739_548471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325293.1|548502_550845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|550869_551598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|551954_552923_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_042465604.1|555153_555897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325294.1|555927_558762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964550.1|558758_559688_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964551.1|559696_562459_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
WP_082325566.1|569258_571748_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182637.1|571787_572177_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_157724569.1|572337_573291_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|573223_573538_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|573765_575085_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259409.1|576189_576606_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011259410.1|576602_577049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259411.1|577291_577927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|578426_579395_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258802.1|579586_580555_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258802.1|581070_582039_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168758.1|582371_582872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465618.1|583180_586282_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|587271_587724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408823.1|587978_589784_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_128415369.1|589785_590133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408824.1|590208_590916_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.1e-51
WP_011408825.1|591067_591460_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011408826.1|591506_591998_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|591994_592348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|592436_593177_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|593183_594158_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259419.1|594159_594942_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|594938_595961_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|596061_596370_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|596366_596732_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011408829.1|596765_598775_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011408830.1|598942_599197_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075242680.1|600875_601565_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	8.3e-12
WP_011408833.1|601880_602642_+	transporter	NA	NA	NA	NA	NA
WP_011408834.1|602655_604998_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
WP_115840174.1|605494_606460_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	705371	717146	4945802	tRNA	Escherichia_phage(22.22%)	12	NA	NA
WP_011259503.1|705371_705671_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|705713_705944_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|706187_706937_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|706941_707637_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_012444559.1|707822_708122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|708509_708914_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|709639_709852_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|709991_712640_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|712741_713230_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|713532_714567_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|714739_715381_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|715469_717146_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 8
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	794437	910539	4945802	transposase,plate	Ralstonia_phage(54.55%)	81	NA	NA
WP_166473745.1|794437_795913_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
WP_011408934.1|795995_798584_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011259580.1|798640_799753_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259581.1|799877_800456_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465046.1|801942_804030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465048.1|805928_809009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|812044_812752_+	response regulator	NA	NA	NA	NA	NA
WP_011408941.1|812748_813741_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|813737_816197_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|816310_817291_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408942.1|817299_818328_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_109181977.1|818494_819292_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181978.1|819354_820152_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408943.1|820212_820539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408944.1|820535_823439_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011408945.1|823435_824158_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011408946.1|824154_824802_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011408947.1|824798_828257_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011408948.1|828260_829577_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|829578_830916_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_069959924.1|830912_832304_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408951.1|832300_832840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|832848_834786_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408952.1|835050_835509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|835895_836390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703476.1|836455_836953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408953.1|837141_839847_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
WP_011408954.1|839879_840890_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_113063332.1|840853_842731_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|842734_843238_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|843225_844059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|844094_844598_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|844697_846212_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|846204_846711_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011257031.1|848069_849038_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964543.1|849173_850490_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115892994.1|850660_851896_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|852081_853050_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_166473746.1|853101_855018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|855042_855780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|855810_858153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|858170_858917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|858945_861780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|862437_864267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408965.1|864280_864880_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_011408966.1|864968_865325_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011259617.1|865321_865744_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|865759_865993_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_011408968.1|866019_866280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182194.1|866628_868419_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_011259619.1|868451_869438_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|869848_873562_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|874087_874851_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|874954_875602_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|875823_876585_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011258802.1|876742_877711_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408974.1|877844_878210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|878268_878700_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|878711_879974_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|879957_881250_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|881619_882390_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011259629.1|883146_884382_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|885681_885939_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|886378_887362_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011257031.1|887677_888646_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408981.1|888774_889737_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|889986_890145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|890176_890356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|890720_891686_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408984.1|892251_892503_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_042465067.1|892561_892753_-	response regulator	NA	NA	NA	NA	NA
WP_011408985.1|892893_893871_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|894679_894874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|896267_896630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|896613_897183_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|897220_898474_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|898679_899057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408991.1|900985_902221_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|903058_904093_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011408994.1|904768_907144_-	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_011408998.1|909354_910539_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.7e-41
>prophage 9
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	1045202	1105473	4945802	tRNA,transposase,protease	Burkholderia_virus(14.29%)	51	NA	NA
WP_094187736.1|1045202_1045966_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259756.1|1046989_1049356_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|1049352_1050027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|1050236_1051175_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|1051297_1052647_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|1052643_1053531_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|1053848_1054655_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|1055100_1056318_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|1056423_1057392_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|1057734_1058403_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|1058399_1059173_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_075241401.1|1059746_1061699_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|1062379_1063405_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|1063489_1064563_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|1064555_1065659_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|1065669_1066596_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|1066676_1067327_+	SCO family protein	NA	NA	NA	NA	NA
WP_011409071.1|1067323_1068172_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|1068722_1070306_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103057205.1|1071728_1072946_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|1072906_1073194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|1073304_1073811_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011259780.1|1073932_1075333_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011409077.1|1075595_1076171_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|1076167_1076602_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|1076629_1076797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259783.1|1077406_1077592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|1077626_1078196_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|1078288_1079140_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|1080527_1082543_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|1082813_1083512_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|1083552_1083960_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|1084397_1085360_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|1086643_1087894_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|1087901_1089146_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|1089373_1089853_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|1089963_1090500_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|1090609_1091359_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|1091566_1092058_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_128896934.1|1092070_1092298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409088.1|1093171_1094491_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_069963877.1|1094634_1096341_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|1096374_1097679_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|1097710_1097971_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|1097972_1098848_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|1100682_1101147_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|1101198_1101387_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069963878.1|1101359_1101680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|1101676_1103044_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|1103189_1103771_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|1104027_1105473_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 10
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	1124573	1174564	4945802	tRNA,integrase,transposase	Ralstonia_phage(33.33%)	38	1148681:1148740	1165351:1166014
WP_011409106.1|1124573_1127216_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|1127288_1127900_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|1128104_1128962_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|1129217_1129667_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_166473747.1|1130023_1131259_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|1131286_1132252_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1132376_1133139_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|1133749_1134043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|1134516_1134750_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|1134783_1135797_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|1135764_1135956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801901.1|1136046_1137366_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|1137453_1138668_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|1138813_1139341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115840178.1|1139337_1140303_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|1140543_1141306_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|1141608_1143741_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258529.1|1144291_1145260_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011407317.1|1145420_1146389_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	5.6e-99
WP_115840192.1|1146533_1147499_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_052285784.1|1147545_1147878_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|1147874_1148638_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1148681:1148740	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
WP_094187763.1|1149509_1150307_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|1150340_1150733_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|1150823_1151216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|1153554_1153974_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|1155690_1157475_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|1157665_1157866_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|1158401_1159196_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|1159497_1160256_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|1160331_1162194_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|1162251_1162593_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|1162852_1163128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|1166174_1166888_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
1165351:1166014	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
WP_012445603.1|1166948_1167371_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|1167502_1168266_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|1171339_1172251_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_115801902.1|1173598_1174564_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	1222021	1265120	4945802	transposase	Ralstonia_phage(50.0%)	32	NA	NA
WP_011407175.1|1222021_1222990_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|1224010_1225045_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|1225428_1226154_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|1226285_1226747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|1230193_1232314_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|1232580_1233426_-	transporter	NA	NA	NA	NA	NA
WP_011257031.1|1234417_1235386_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259903.1|1235710_1237681_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|1238109_1239507_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|1239619_1240438_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011259907.1|1240748_1244000_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.1e-81
WP_075239010.1|1243986_1244169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259908.1|1244181_1245600_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011259909.1|1245609_1246260_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011409164.1|1246261_1246867_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|1247016_1247238_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|1247247_1247673_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_094187731.1|1248164_1248962_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409167.1|1250039_1250819_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|1251033_1251663_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|1251723_1252479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182227.1|1252807_1253584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|1253992_1255567_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|1255815_1256082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409173.1|1256360_1259540_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	1.2e-73
WP_011258802.1|1259605_1260574_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409174.1|1260699_1261374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409175.1|1261373_1262120_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_128896939.1|1262116_1262707_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011258188.1|1262817_1263786_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_113063277.1|1263837_1264149_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011258803.1|1264151_1265120_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 12
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	1695647	1754475	4945802	transposase	Ralstonia_phage(44.44%)	38	NA	NA
WP_165967667.1|1695647_1697459_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|1697416_1697680_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|1697684_1698344_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|1698530_1699895_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|1700110_1700806_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|1701752_1702376_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011260283.1|1702520_1703318_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|1703411_1704062_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|1704153_1704969_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260285.1|1704988_1705756_+	endonuclease	NA	NA	NA	NA	NA
WP_011409419.1|1707684_1708674_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_041182588.1|1708796_1711370_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|1711562_1712325_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1712398_1713367_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407175.1|1713987_1714956_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011409421.1|1715260_1715527_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|1716458_1717257_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|1718903_1720136_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|1720175_1721138_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|1721313_1722270_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258188.1|1722481_1723450_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187715.1|1723785_1724548_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|1727958_1728924_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|1729385_1729616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|1730240_1732283_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|1732284_1734183_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|1734184_1735438_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011260298.1|1735434_1736040_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011409430.1|1736459_1737614_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|1737616_1738645_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409431.1|1738641_1739718_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|1739758_1741036_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|1741080_1741848_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409433.1|1742062_1743229_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011260306.1|1745772_1748670_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_011409436.1|1748820_1751511_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409437.1|1751792_1752749_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
WP_011409439.1|1753239_1754475_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	1817900	1899957	4945802	transposase,protease	Erwinia_phage(18.18%)	56	NA	NA
WP_011260359.1|1817900_1819268_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260360.1|1819378_1819930_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011409475.1|1820445_1821363_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	2.2e-12
WP_011409476.1|1821562_1822234_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_011260363.1|1822230_1823085_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011409477.1|1823074_1823311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409478.1|1823368_1823767_-	YbaN family protein	NA	NA	NA	NA	NA
WP_027703683.1|1824139_1826275_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_011409479.1|1826398_1827583_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011409480.1|1827908_1828340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|1828422_1830516_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409482.1|1830583_1830895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260370.1|1831282_1831852_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_011260371.1|1831960_1832926_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260372.1|1833484_1834285_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011409484.1|1834835_1835750_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011409485.1|1835780_1836518_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011260375.1|1836548_1837601_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011260376.1|1837605_1838274_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260377.1|1838425_1840363_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_094187780.1|1841089_1841852_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260378.1|1842166_1843816_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409489.1|1845206_1846694_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
WP_011260380.1|1846901_1848350_+	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
WP_011409492.1|1849584_1852209_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_011260383.1|1852464_1855335_+	insulinase family protein	NA	NA	NA	NA	NA
WP_011409493.1|1855882_1856812_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011409494.1|1856850_1857855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187782.1|1858097_1858861_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|1859908_1860694_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011260388.1|1860947_1862621_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|1863164_1863611_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|1863941_1864226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260390.1|1864820_1865732_-	magnesium transporter	NA	NA	NA	NA	NA
WP_011409498.1|1865977_1866973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260392.1|1867066_1868443_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_011260393.1|1869609_1871310_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_011409499.1|1871718_1873491_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_011409500.1|1873766_1874642_-	DMT family transporter	NA	NA	NA	NA	NA
WP_042465760.1|1874839_1875718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080493954.1|1875917_1876313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260398.1|1877757_1878849_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_011409507.1|1880757_1883082_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409508.1|1883277_1885224_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|1885598_1885790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|1886180_1887764_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|1888111_1888708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409513.1|1890056_1890905_-	amino acid lyase	NA	NA	NA	NA	NA
WP_011409514.1|1890939_1892415_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|1893005_1893935_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|1894169_1894661_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|1894657_1895329_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|1895723_1896053_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012444032.1|1896261_1897188_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_115892996.1|1897976_1898775_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|1898922_1899957_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 14
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	1920850	1962558	4945802	tRNA,transposase	Ralstonia_phage(50.0%)	37	NA	NA
WP_109182021.1|1920850_1921816_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|1922348_1922729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409536.1|1922931_1923816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409537.1|1923905_1925201_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_011409538.1|1925330_1925855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|1926280_1927546_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|1927542_1928520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|1928623_1929427_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|1929602_1930412_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|1930419_1931218_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465763.1|1931260_1931878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|1932002_1932578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181902.1|1932789_1934109_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1934258_1935227_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409546.1|1935352_1936105_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|1936142_1936583_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|1936789_1937131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|1937356_1937734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|1937944_1938142_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011409548.1|1938448_1939195_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409549.1|1939287_1940094_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|1940317_1941730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260454.1|1941726_1942824_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187763.1|1942978_1943777_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|1943830_1944629_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|1944848_1945811_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182024.1|1946258_1947022_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|1947303_1948080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|1948076_1949393_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408623.1|1949909_1951145_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|1951738_1952020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|1952580_1953015_-	membrane protein	NA	NA	NA	NA	NA
WP_011409559.1|1953189_1954368_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069960023.1|1955363_1956326_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|1958659_1960831_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|1961058_1961415_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|1961493_1962558_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
>prophage 15
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	1985508	2044022	4945802	tRNA,transposase	Acinetobacter_phage(30.0%)	44	NA	NA
WP_094187805.1|1985508_1986487_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_003483093.1|1987544_1988015_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|1988357_1988573_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|1988653_1989271_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|1989819_1990212_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|1990215_1990644_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011260492.1|1990829_1991483_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|1991763_1992078_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|1992237_1993032_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|1993169_1993862_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011409579.1|1994182_1994899_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|1994891_1995689_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|1995825_1996863_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|1996980_1997610_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|1997761_1998343_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_094187806.1|1999770_2000872_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409585.1|2001476_2003708_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011409586.1|2003897_2005610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260506.1|2005758_2007135_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
WP_094187753.1|2009341_2010140_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964474.1|2011124_2012093_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_069960033.1|2012259_2013231_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_011409594.1|2013423_2014608_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|2015075_2015891_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_011409596.1|2016649_2017966_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|2018225_2019470_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|2019562_2022811_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|2022944_2026085_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|2026374_2027742_-	VOC family protein	NA	NA	NA	NA	NA
WP_041182775.1|2028486_2029452_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069964616.1|2029870_2030836_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|2031298_2031769_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|2031797_2032220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|2032295_2032730_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|2032839_2033355_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|2033370_2034396_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|2034718_2035315_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_011260532.1|2035672_2037400_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|2037449_2038892_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|2038876_2040223_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|2040413_2041163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|2041264_2041876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|2041980_2043204_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|2043545_2044022_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 16
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	2056889	2114827	4945802	transposase	Leptospira_phage(28.57%)	36	NA	NA
WP_011260549.1|2056889_2058266_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|2058276_2058810_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|2059238_2060498_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|2060636_2061944_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|2064028_2065063_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|2065413_2065959_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|2065984_2066251_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|2066425_2068264_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011409614.1|2071487_2072630_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
WP_011260560.1|2073756_2074656_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011260561.1|2075603_2078405_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011409617.1|2078481_2078772_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_113101711.1|2079129_2080232_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	6.7e-40
WP_075240612.1|2080337_2080928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128896947.1|2081068_2081974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409622.1|2082163_2084851_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_011409626.1|2088172_2092102_+	avirulence protein	NA	NA	NA	NA	NA
WP_011409629.1|2093790_2094303_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
WP_075244060.1|2094299_2094527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013372.1|2094811_2095159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409630.1|2095376_2097383_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_012443890.1|2097379_2097811_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011260579.1|2097807_2098227_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_075242263.1|2098712_2099471_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011409633.1|2099681_2100272_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_011409634.1|2100405_2101353_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_011409635.1|2101395_2102265_+	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_011409636.1|2102261_2102762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409640.1|2105860_2106421_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	2.1e-13
WP_011409641.1|2106516_2109342_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011260589.1|2109503_2110022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409642.1|2110021_2110942_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011260591.1|2111370_2111994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443879.1|2112003_2112195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465296.1|2112291_2112912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182033.1|2113861_2114827_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	2200914	2381531	4945802	tRNA,transposase,tail	Arthrobacter_phage(12.5%)	118	NA	NA
WP_011409690.1|2200914_2202303_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260667.1|2207088_2209173_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|2209272_2211300_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|2211542_2213153_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|2213163_2214327_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|2214455_2215076_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012443812.1|2215406_2215595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260672.1|2215637_2215973_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|2217597_2217909_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|2219027_2219546_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011409700.1|2219817_2221536_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|2221626_2222013_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|2222074_2223400_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260681.1|2223514_2224828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260682.1|2224926_2225652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|2225868_2226531_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|2226609_2227704_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409705.1|2229208_2231968_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409706.1|2232220_2233810_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|2233809_2236047_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|2236335_2237244_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|2237333_2239148_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_103057247.1|2239533_2247990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182038.1|2248457_2249255_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409712.1|2249799_2250552_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011260693.1|2250611_2251511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260694.1|2251662_2252418_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_011409714.1|2252414_2253050_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|2253065_2253293_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011409715.1|2253365_2254268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409716.1|2254422_2255388_+	ferrochelatase	NA	NA	NA	NA	NA
WP_075242173.1|2255485_2256241_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409718.1|2256321_2256780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409719.1|2257050_2257836_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409720.1|2258462_2259368_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	4.1e-43
WP_011260702.1|2259431_2260349_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011259480.1|2260952_2262290_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|2262515_2263583_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409722.1|2263758_2265954_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|2265950_2267915_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|2267926_2269186_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|2269185_2270886_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011260708.1|2270888_2273603_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|2273825_2275298_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|2276275_2277331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|2277558_2278977_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|2279017_2279995_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_042465333.1|2281411_2282713_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409727.1|2283174_2286108_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|2286206_2287694_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|2287725_2288760_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_094187716.1|2289176_2289974_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010374782.1|2290850_2291027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182039.1|2291280_2292237_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182040.1|2292964_2293727_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|2293744_2294845_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|2294910_2296032_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011409734.1|2296041_2297118_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|2297210_2297891_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182062.1|2297923_2298722_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|2298850_2300170_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|2300272_2301229_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|2302695_2303154_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|2303255_2303684_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_011409739.1|2303930_2304794_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|2307970_2308237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|2308398_2308647_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409743.1|2308855_2309614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|2309610_2310306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|2310404_2310737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465811.1|2311208_2311631_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|2311758_2312004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|2312339_2312672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703652.1|2313121_2314516_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|2315453_2315744_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_011260747.1|2315761_2316043_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_011409750.1|2316137_2318390_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.7	8.7e-10
WP_082325367.1|2318577_2322645_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_011409752.1|2322641_2326055_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_075244278.1|2326171_2326393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|2332968_2333514_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|2333582_2334110_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|2334168_2334705_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_109182045.1|2334792_2335758_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704180.1|2336040_2336673_-	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
WP_012443745.1|2336743_2337346_-	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	7.7e-14
WP_011409760.1|2337844_2339272_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_011260761.1|2339264_2340320_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_012443742.1|2340590_2342033_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	2.0e-31
WP_011260763.1|2342055_2342394_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_011260764.1|2342671_2344081_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011260765.1|2344302_2345100_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_011260766.1|2345236_2346043_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_011409764.1|2347196_2347808_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011409765.1|2348002_2350075_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011260769.1|2350488_2351478_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409766.1|2351537_2352341_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011260771.1|2352460_2352889_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_011260772.1|2353152_2355168_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_011260773.1|2355164_2355737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409767.1|2355740_2356217_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409768.1|2356232_2356865_-	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	36.6	1.6e-09
WP_011260776.1|2357217_2358135_-	AEC family transporter	NA	NA	NA	NA	NA
WP_011260779.1|2359226_2362934_+	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_011260780.1|2363076_2363697_+	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	41.9	1.9e-07
WP_011260781.1|2363693_2364971_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011260782.1|2365015_2366002_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_011409772.1|2365998_2367282_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_011260784.1|2367353_2368535_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_042465359.1|2368821_2370294_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011409774.1|2370290_2371028_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	1.5e-19
WP_011409775.1|2371076_2371409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260788.1|2371461_2372667_-	aminotransferase	NA	NA	NA	NA	NA
WP_011409777.1|2372826_2373672_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.7	3.7e-06
WP_011409779.1|2375365_2376403_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011409781.1|2378279_2378747_-	type III effector HopPtoH like protein	NA	NA	NA	NA	NA
WP_011258529.1|2378895_2379864_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_162866909.1|2380411_2381531_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	1.2e-41
>prophage 18
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	2418283	2545955	4945802	tRNA,transposase,protease	Acidithiobacillus_phage(14.29%)	94	NA	NA
WP_166473748.1|2418283_2419519_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260831.1|2420390_2421446_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_011260832.1|2421438_2422110_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_011260833.1|2422207_2423515_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409807.1|2423531_2424950_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011409808.1|2425521_2426916_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_011260838.1|2427263_2429450_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.7	2.2e-111
WP_012446438.1|2429625_2429850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182049.1|2430430_2431396_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409811.1|2431571_2432987_-	amino acid permease	NA	NA	NA	NA	NA
WP_011409813.1|2434257_2435802_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_041182970.1|2436207_2436570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409815.1|2436947_2437493_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_115892998.1|2439153_2440473_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260845.1|2440745_2441873_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011409820.1|2442728_2444069_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011409821.1|2444285_2444978_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409822.1|2445094_2445415_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_011260850.1|2445414_2446407_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
WP_011409823.1|2446713_2448237_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
WP_011409824.1|2448341_2449577_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_011260853.1|2449737_2450394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409825.1|2450544_2452356_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409826.1|2452503_2452854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409361.1|2453032_2454352_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465377.1|2455764_2456946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409829.1|2457043_2460475_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011409830.1|2460622_2461321_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_011409831.1|2461304_2462777_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_011409832.1|2462773_2463361_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_011409833.1|2463360_2464557_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041182832.1|2464630_2465233_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	2.0e-46
WP_069960057.1|2465408_2465852_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103057218.1|2466203_2466731_+	TolC family protein	NA	NA	NA	NA	NA
WP_011409837.1|2466727_2467294_+	FUSC family protein	NA	NA	NA	NA	NA
WP_011409838.1|2467569_2468931_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
WP_011409839.1|2469044_2469347_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_011409840.1|2469716_2470931_+	phospholipase	NA	NA	NA	NA	NA
WP_011409842.1|2471180_2471387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409843.1|2471373_2472486_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_115892999.1|2474450_2475827_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_166473749.1|2475885_2477346_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.7e-79
WP_129593153.1|2477875_2478643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409848.1|2478624_2479332_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	34.6	2.0e-08
WP_041182345.1|2479345_2479687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757268.1|2479667_2480177_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	4.8e-09
WP_027704109.1|2480173_2480584_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_005921785.1|2481920_2482142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446478.1|2483035_2483221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260879.1|2484253_2485423_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	4.5e-42
WP_041182532.1|2485448_2486759_-	MFS transporter	NA	NA	NA	NA	NA
WP_011260881.1|2487135_2488470_-	peptidase M19	NA	NA	NA	NA	NA
WP_010364861.1|2488671_2488992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409854.1|2489110_2490277_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_011260885.1|2490539_2491496_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	29.9	8.4e-31
WP_011260886.1|2491870_2492656_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409856.1|2492785_2493886_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_113063157.1|2496611_2497469_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011409860.1|2497627_2498968_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_011409861.1|2499132_2501835_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011409862.1|2501913_2503650_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_011409863.1|2503675_2504113_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_002805908.1|2504151_2504292_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_011407161.1|2504534_2505863_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_011257008.1|2506140_2507241_+	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	37.9	2.5e-55
WP_011257009.1|2508492_2509599_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_011407163.1|2509714_2512159_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.7	1.3e-112
WP_011407164.1|2512226_2513063_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|2513249_2514056_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|2514332_2515526_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|2515679_2516351_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|2516435_2517197_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|2517243_2517666_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|2517669_2518083_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011407166.1|2518378_2519146_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|2519156_2519426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|2519500_2520961_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|2521607_2522618_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|2522889_2524092_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|2524233_2526372_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|2526582_2526876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|2526907_2527405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407171.1|2527651_2528632_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	9.1e-89
WP_011257025.1|2528679_2529846_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_011257026.1|2529992_2530559_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|2532033_2533242_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|2533869_2534892_-	sugar kinase	NA	NA	NA	NA	NA
WP_011407175.1|2535714_2536683_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407176.1|2537170_2538307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129215536.1|2538303_2539011_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_012443646.1|2539612_2540989_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_012443643.1|2544001_2544244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|2544185_2544509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|2544974_2545955_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
>prophage 19
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	2553855	2617549	4945802	transposase	Ralstonia_phage(60.0%)	51	NA	NA
WP_011407913.1|2553855_2555070_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|2555590_2556388_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|2558103_2559069_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|2559065_2559344_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_166473750.1|2559487_2560807_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407197.1|2560924_2561971_+	methylamine utilization protein	NA	NA	NA	NA	NA
WP_011407198.1|2562111_2562609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703730.1|2562772_2563405_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011257110.1|2563421_2565584_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011407199.1|2565698_2565884_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257109.1|2565906_2568510_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_094187819.1|2568506_2570396_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011257107.1|2570452_2572210_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_011407200.1|2572212_2574447_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_027703733.1|2574443_2576027_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_011257104.1|2576500_2578129_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011257103.1|2578125_2579490_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257102.1|2579682_2580624_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011407202.1|2580864_2582589_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_109181945.1|2582595_2583359_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407204.1|2583418_2583679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182843.1|2583697_2586256_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011257097.1|2586440_2586782_+	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_011257094.1|2588998_2590552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257093.1|2591015_2591579_-	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	38.5	4.4e-11
WP_011257092.1|2591954_2592374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257091.1|2593112_2594930_-	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_011257090.1|2595012_2595843_-	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_011257089.1|2595839_2596349_-	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_011257088.1|2596341_2597670_-	type III secretion system ATPase SctN	NA	NA	NA	NA	NA
WP_011257087.1|2597659_2598361_-	type III secretion system stator protein SctL	NA	NA	NA	NA	NA
WP_011257086.1|2598345_2598975_-	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_011257085.1|2598982_2599744_-	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_011407211.1|2599745_2600138_-	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_011257083.1|2600171_2600627_-	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_011407212.1|2600841_2601921_+	type III secretion system export apparatus subunit SctU	NA	NA	NA	NA	NA
WP_033013638.1|2601929_2603852_+	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_042464327.1|2603851_2604493_+	type III secretion system protein SctP	NA	NA	NA	NA	NA
WP_042464329.1|2604585_2605539_+	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_011407215.1|2605525_2606170_+	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_011257077.1|2606174_2606435_+	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_011257076.1|2606431_2607259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257075.1|2607255_2608194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257074.1|2608203_2608446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257073.1|2608526_2608808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257072.1|2608862_2609333_+	protein HpaB	NA	NA	NA	NA	NA
WP_011257071.1|2609747_2611733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407217.1|2611729_2612176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258529.1|2613876_2614845_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011407218.1|2615057_2616377_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407219.1|2616565_2617549_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
>prophage 20
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	2630258	2713761	4945802	transposase	Acidithiobacillus_phage(22.22%)	52	NA	NA
WP_011407229.1|2630258_2631209_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
WP_125168735.1|2631322_2631532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|2631599_2631860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|2631912_2632194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162866901.1|2632359_2633391_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407232.1|2633531_2634479_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|2634733_2635045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257044.1|2636219_2636396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|2636511_2636982_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|2637151_2637844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|2637935_2638334_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|2639135_2640092_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_044756192.1|2640066_2640537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407238.1|2640728_2641976_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011407239.1|2643199_2643889_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	1.3e-36
WP_011257145.1|2643901_2645059_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_011257146.1|2645071_2646382_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_027703668.1|2648257_2648509_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_162866907.1|2648961_2649390_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011407243.1|2649386_2649617_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011407244.1|2649683_2650346_-	hemolysin III	NA	NA	NA	NA	NA
WP_011407245.1|2650523_2653019_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.5e-07
WP_042464339.1|2653015_2654842_+	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407248.1|2655330_2657475_-	avirulence protein	NA	NA	NA	NA	NA
WP_011407249.1|2657665_2658823_-	ROK family protein	NA	NA	NA	NA	NA
WP_042464342.1|2658995_2661584_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257157.1|2661594_2662380_+	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_042465397.1|2662693_2663884_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_011407253.1|2664983_2665289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464345.1|2665541_2666795_-	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.2	1.9e-38
WP_011257161.1|2666851_2667232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257162.1|2667433_2671906_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_011257163.1|2672100_2673582_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_109182058.1|2674819_2675785_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187801.1|2677220_2678019_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082325201.1|2678257_2679640_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	4.7e-75
WP_027703863.1|2681041_2682100_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_103057315.1|2682243_2682339_-	xylosidase	NA	NA	NA	NA	NA
WP_011407264.1|2682314_2682842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464354.1|2683664_2685848_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011407267.1|2685859_2689210_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011407268.1|2689206_2692323_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011407278.1|2699467_2700787_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257184.1|2700943_2702464_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|2702480_2702759_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257186.1|2702948_2703287_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_011407279.1|2703899_2705885_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011257188.1|2706804_2707617_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|2707809_2708421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257190.1|2708837_2709695_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_011257191.1|2709932_2711819_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_011407283.1|2712384_2713761_+|transposase	IS5-like element ISXoo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	7.8e-78
>prophage 21
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	2725539	2889480	4945802	tRNA,holin,transposase	Bacillus_phage(16.67%)	110	NA	NA
WP_011257198.1|2725539_2727444_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|2727704_2727884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407290.1|2728017_2728485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|2728642_2729602_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011407291.1|2729586_2730204_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|2730246_2730666_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_011257201.1|2730918_2731824_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.2	4.4e-37
WP_011257202.1|2732072_2732957_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|2733020_2733803_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|2733847_2734609_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|2734772_2735102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|2735420_2736512_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|2736580_2738179_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|2738343_2739588_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|2740039_2740669_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|2740875_2742852_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|2744238_2744904_-	YceH family protein	NA	NA	NA	NA	NA
WP_011257214.1|2745183_2746194_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|2746190_2746922_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|2747275_2748805_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|2748914_2751947_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257218.1|2752245_2755284_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|2755448_2756501_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|2756669_2756915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|2756913_2757879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|2757878_2760539_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_008573820.1|2762357_2762561_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011257226.1|2766200_2766845_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_011257227.1|2766985_2767876_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_011407307.1|2768003_2768486_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257232.1|2771521_2772055_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_113063239.1|2774870_2775929_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
WP_011257237.1|2776236_2777310_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|2778072_2779125_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257239.1|2779772_2780903_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011407314.1|2781157_2781472_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011257241.1|2782219_2782609_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|2782816_2783023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|2783254_2784223_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257243.1|2784476_2786639_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|2787186_2788491_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|2788550_2789153_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|2789149_2791054_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|2800396_2801212_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_041182297.1|2801558_2802521_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115892982.1|2802625_2803388_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|2805187_2806246_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|2806256_2806547_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|2806536_2807199_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|2807195_2807747_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|2807758_2808508_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|2808507_2809302_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|2809686_2809974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|2809992_2810550_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|2810567_2811533_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407336.1|2812377_2813334_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
WP_109182012.1|2813405_2814168_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|2814207_2815006_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|2815137_2816352_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|2816411_2817242_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407798.1|2817404_2818640_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|2820038_2820467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|2820477_2820927_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257273.1|2820907_2821135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|2821442_2823197_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|2824125_2824888_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|2824941_2825526_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|2825683_2827066_+	MFS transporter	NA	NA	NA	NA	NA
WP_011407350.1|2827068_2829468_+	NdvB protein	NA	NA	NA	NA	NA
WP_011407351.1|2829571_2832214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|2832961_2836411_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|2836603_2837188_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|2837664_2838441_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407355.1|2838621_2839923_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011257283.1|2839925_2840285_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|2840721_2842203_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|2842395_2843361_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|2844187_2846350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464365.1|2846476_2848645_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011407359.1|2849282_2849912_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011407360.1|2849914_2850346_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011407361.1|2850402_2850981_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|2851076_2851829_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011257292.1|2852053_2852443_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|2852556_2854230_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_011257294.1|2854226_2854871_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_011257296.1|2855105_2856209_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_011407366.1|2858555_2858840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182066.1|2859191_2859990_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|2860049_2860813_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|2864766_2865732_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|2866792_2867899_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465421.1|2869692_2870631_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011407377.1|2870749_2871499_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	5.6e-54
WP_012446343.1|2871501_2872293_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257314.1|2872310_2873306_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_075242284.1|2873342_2874170_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011407379.1|2874254_2875256_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011407380.1|2875321_2875594_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_042465424.1|2876079_2876667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257320.1|2876663_2876864_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407383.1|2876924_2878526_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024712051.1|2878557_2879304_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_011407385.1|2879300_2880494_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407386.1|2880903_2881926_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_041181930.1|2882065_2883631_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011257326.1|2883641_2884655_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407388.1|2884644_2885346_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407389.1|2885529_2888544_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_109181945.1|2888717_2889480_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	3070976	3120458	4945802	tRNA,integrase,transposase	Sinorhizobium_phage(14.29%)	41	3079124:3079140	3117246:3117262
WP_109181928.1|3070976_3071942_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_166473752.1|3072409_3073729_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257475.1|3074258_3074774_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011407490.1|3075176_3077399_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257477.1|3077864_3078890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443959.1|3078873_3079476_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
3079124:3079140	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_069959708.1|3079806_3080751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407493.1|3081269_3082646_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407494.1|3082730_3084632_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_011257482.1|3084817_3085033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|3085139_3085916_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407496.1|3086077_3086752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407497.1|3086748_3087522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257486.1|3087745_3088309_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011257487.1|3088319_3090812_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257488.1|3090994_3092269_-	RDD family protein	NA	NA	NA	NA	NA
WP_011257490.1|3093060_3093534_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_011257491.1|3093576_3094719_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011407499.1|3094790_3095927_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257493.1|3096059_3096572_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011257494.1|3096965_3097889_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011407500.1|3097888_3099202_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257496.1|3099252_3100974_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011257497.1|3101138_3102416_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257498.1|3102613_3103438_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407501.1|3103441_3104497_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257500.1|3104662_3106129_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_042465436.1|3106125_3106629_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257502.1|3106738_3107872_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_011407503.1|3108114_3108636_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407504.1|3108835_3109750_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|3109850_3110291_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407505.1|3110399_3112274_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011407506.1|3112466_3112787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407507.1|3113415_3114603_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.0e-110
WP_011257520.1|3114823_3115030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|3115026_3115299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407508.1|3115295_3115541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407512.1|3117476_3118712_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
3117246:3117262	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
WP_011407513.1|3118780_3119170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3119492_3120458_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	3267903	3304222	4945802	tRNA,transposase	Enterobacteria_phage(36.36%)	32	NA	NA
WP_109182077.1|3267903_3269223_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|3269538_3270723_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|3271252_3272566_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|3272555_3273374_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257674.1|3273596_3274538_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|3274537_3275284_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|3275509_3276565_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|3276620_3277508_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|3277504_3278062_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|3278058_3278967_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|3279083_3280487_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|3280533_3281880_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|3282013_3282745_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|3282744_3283374_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011407618.1|3283431_3285519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446093.1|3285515_3287165_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011257686.1|3287280_3287889_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_011257687.1|3288439_3289084_-	ABC transporter	NA	NA	NA	NA	NA
WP_011257688.1|3289080_3290007_-	MCE family protein	NA	NA	NA	NA	NA
WP_011257689.1|3290009_3290852_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_011407620.1|3290937_3292050_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257691.1|3292219_3293479_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407621.1|3293540_3294002_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257693.1|3294144_3295839_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|3295950_3296355_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|3296486_3297260_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|3297270_3297738_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011407624.1|3297734_3298217_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|3298775_3300095_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|3300252_3301572_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|3301784_3302753_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182081.1|3302902_3304222_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	3368512	3412569	4945802	transposase,protease	Ralstonia_phage(25.0%)	39	NA	NA
WP_115892985.1|3368512_3369478_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|3369868_3370444_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|3370556_3371066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|3371164_3371359_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|3371448_3372426_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|3372655_3373096_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|3373373_3374318_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|3374400_3375144_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|3375348_3375588_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|3375729_3376965_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|3377135_3378491_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|3378551_3379625_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_011257759.1|3379621_3380581_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|3380577_3380931_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_011407663.1|3381454_3381928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|3382948_3383275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|3383510_3385109_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|3385254_3386151_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|3386226_3387381_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_011257765.1|3387561_3390153_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_012446043.1|3390236_3390404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407669.1|3390475_3390613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407670.1|3390885_3392085_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011407671.1|3392534_3393503_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_011407672.1|3393744_3395961_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407673.1|3396039_3397038_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_103057250.1|3397147_3397330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464512.1|3398309_3401297_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041181973.1|3401471_3402419_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|3402921_3403458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407677.1|3403528_3404848_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407678.1|3405192_3406155_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
WP_011257778.1|3406288_3406849_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|3406891_3407374_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|3407536_3408013_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|3408423_3409323_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|3409562_3409949_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|3410578_3411706_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|3411705_3412569_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 25
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	3417869	3581216	4945802	integrase,transposase,protease	Ralstonia_phage(22.22%)	116	3509396:3509414	3578327:3578345
WP_011257788.1|3417869_3418652_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407683.1|3418762_3420139_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.7e-77
WP_011257791.1|3420382_3421018_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103057263.1|3421645_3422179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257793.1|3422304_3422502_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011407685.1|3422511_3423624_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|3423604_3424939_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257796.1|3425172_3426093_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257797.1|3426169_3427486_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257798.1|3427758_3429138_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011407686.1|3429158_3429815_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257800.1|3429943_3430597_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407687.1|3430867_3431329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703665.1|3432388_3433273_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|3433393_3434842_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|3434909_3435557_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257808.1|3436373_3437447_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011407690.1|3437777_3439340_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011407691.1|3439336_3440461_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|3440536_3440794_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|3440777_3442499_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|3442542_3443544_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|3444820_3446698_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011407694.1|3447123_3449475_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_011407695.1|3449585_3450479_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407696.1|3450527_3453494_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011257817.1|3454108_3455257_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|3455370_3455907_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|3456103_3456586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|3458853_3459819_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|3459815_3459989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|3460273_3460765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|3462444_3463701_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|3463860_3464424_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|3464790_3466149_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|3466148_3466745_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|3466891_3467776_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|3469757_3470372_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|3470454_3471441_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|3471556_3472051_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|3472295_3474125_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|3474143_3474614_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|3475536_3476664_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|3476764_3478147_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|3478394_3480518_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|3481046_3481565_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_115801872.1|3482271_3483373_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011257570.1|3483888_3485124_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407710.1|3485737_3486628_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|3486717_3486858_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|3490417_3491653_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|3492635_3493955_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182121.1|3496684_3497650_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|3497951_3499529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|3499596_3500360_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959738.1|3501729_3502914_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|3503028_3503997_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|3504257_3504719_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|3505267_3505510_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|3505503_3506267_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|3506299_3507031_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|3508850_3509603_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3509396:3509414	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
WP_109181948.1|3509604_3510570_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|3510833_3511841_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|3511984_3512746_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012445939.1|3516063_3517356_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|3517448_3518075_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|3518199_3519486_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|3519629_3522101_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|3522314_3522587_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|3523418_3525389_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011407729.1|3526094_3527273_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|3527269_3528037_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|3528049_3528706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|3528733_3529186_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|3529194_3529929_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257891.1|3530364_3531069_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011407730.1|3531894_3532524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|3533416_3533617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757079.1|3534012_3536736_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.3	9.7e-72
WP_069960070.1|3536803_3538954_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_113091283.1|3540966_3543171_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	4.5e-19
WP_113186658.1|3543167_3544862_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|3544858_3545122_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_109182093.1|3545183_3547391_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_011407737.1|3547387_3549067_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|3549063_3549327_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_011257899.1|3549388_3549946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182094.1|3550028_3550994_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|3551092_3551779_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|3551889_3552294_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|3552504_3553554_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|3553574_3554324_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|3554323_3555073_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|3555072_3556104_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|3556121_3556481_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|3556505_3557003_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|3556999_3557245_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|3557241_3557688_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|3558249_3560346_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|3560352_3560673_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|3560770_3561364_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|3561465_3561816_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|3561935_3562469_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|3562465_3564418_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|3564410_3565367_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|3565372_3566326_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|3566364_3568233_+	membrane protein	NA	NA	NA	NA	NA
WP_011407749.1|3569748_3570264_+	peptide deformylase	NA	NA	NA	NA	NA
WP_103057268.1|3570780_3571539_+	cellulase	NA	NA	NA	NA	NA
WP_041182379.1|3572011_3572758_+	cellulase	NA	NA	NA	NA	NA
WP_011407751.1|3573374_3574976_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|3575964_3577200_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|3578028_3578997_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
3578327:3578345	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
WP_075241901.1|3579464_3579815_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|3579896_3581216_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	3619946	3662393	4945802	transposase	Leptospira_phage(25.0%)	41	NA	NA
WP_109182097.1|3619946_3621048_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_011407778.1|3622478_3623102_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|3623125_3623365_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|3623414_3624296_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|3624445_3624895_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011407781.1|3625045_3625693_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|3625784_3626255_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|3626251_3626842_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|3627450_3627750_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|3627746_3627968_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|3628203_3628746_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|3628756_3630097_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_162013040.1|3630614_3630773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181925.1|3630804_3631568_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|3631800_3633126_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|3633324_3633672_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|3633668_3636077_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|3636255_3637413_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|3637428_3638028_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|3638024_3638420_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|3638416_3639142_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|3639251_3640112_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|3640228_3640840_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|3641020_3641818_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|3641966_3642266_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|3642394_3644566_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|3644645_3645026_+	RidA family protein	NA	NA	NA	NA	NA
WP_011407792.1|3645046_3647200_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257989.1|3647325_3648264_+	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|3648335_3648578_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|3648791_3650081_+	citrate synthase	NA	NA	NA	NA	NA
WP_011407794.1|3650458_3651109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257992.1|3651418_3653848_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|3654063_3655122_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|3655121_3655880_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|3655876_3656542_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|3656538_3657072_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|3657091_3659041_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|3659111_3659910_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407798.1|3660052_3661288_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011407799.1|3661358_3662393_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	3701609	3734507	4945802	transposase	Staphylococcus_prophage(28.57%)	27	NA	NA
WP_109181945.1|3701609_3702372_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801876.1|3702461_3703427_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|3703536_3704856_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|3705318_3705996_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|3706075_3706465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445833.1|3706678_3707596_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.3e-31
WP_113081219.1|3707999_3708984_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
WP_011407838.1|3709158_3711246_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|3711397_3712057_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|3712137_3712935_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|3712957_3713137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|3713155_3713560_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|3713593_3713953_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|3714196_3715069_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|3715141_3716368_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|3716613_3717231_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_069970072.1|3718161_3719118_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_011407844.1|3719411_3719756_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042464589.1|3719825_3721433_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011258050.1|3721429_3721855_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|3721879_3722383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|3723825_3724275_+	azurin	NA	NA	NA	NA	NA
WP_011407853.1|3727521_3728811_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407854.1|3729096_3732276_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258055.1|3732772_3733642_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_166473754.1|3733663_3734311_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	5.0e-27
WP_012444927.1|3734330_3734507_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	3954178	4098614	4945802	tRNA,transposase	Ralstonia_phage(19.23%)	110	NA	NA
WP_109181897.1|3954178_3955144_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182392.1|3955496_3956201_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|3956738_3956963_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_011407979.1|3956962_3959035_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_011407980.1|3959266_3960124_+	pirin family protein	NA	NA	NA	NA	NA
WP_166473757.1|3961159_3963562_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_027704078.1|3963616_3964477_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075241467.1|3964545_3965124_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011257031.1|3966115_3967084_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_044757009.1|3967695_3970119_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.4e-37
WP_011258248.1|3970115_3971063_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_158645225.1|3971278_3971662_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_041182394.1|3972056_3972605_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|3972999_3973557_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|3973606_3975715_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_069964947.1|3975736_3977638_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.9e-30
WP_027704078.1|3977692_3978553_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075251795.1|3978621_3979200_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258251.1|3979663_3979897_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258252.1|3979893_3980046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407994.1|3980117_3980684_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_012444346.1|3980680_3980833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407995.1|3980886_3981474_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_154583424.1|3981470_3981623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162013049.1|3981826_3982261_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959784.1|3982257_3984666_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|3985010_3985472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|3985718_3986609_-	pirin family protein	NA	NA	NA	NA	NA
WP_012444354.1|3987376_3988090_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|3988193_3988943_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|3989303_3989555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408003.1|3989887_3991945_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
WP_069960076.1|3993892_3995014_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_012444362.1|3995028_3995835_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_069959785.1|3995839_3997123_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011408007.1|3997149_3997665_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069959786.1|3997675_3999832_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_011408009.1|3999899_4001897_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|4001915_4002245_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|4002284_4002503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756996.1|4002734_4006199_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011258270.1|4006601_4007144_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|4007555_4008464_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|4008809_4009608_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|4009751_4010471_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_109181900.1|4010626_4011661_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|4011681_4012494_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|4013229_4013613_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|4013735_4014905_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_162866902.1|4014899_4015931_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.0e-71
WP_011408017.1|4016018_4016831_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|4017346_4017730_+	membrane protein	NA	NA	NA	NA	NA
WP_011408019.1|4017870_4019034_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408020.1|4019064_4019877_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408021.1|4020107_4020695_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011407237.1|4020993_4021950_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075242217.1|4022023_4022755_+	nitrilase	NA	NA	NA	NA	NA
WP_011258289.1|4023944_4025348_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|4025361_4025868_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|4026273_4026732_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|4027509_4027713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408029.1|4029274_4029760_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|4029987_4030203_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|4030453_4030933_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011408031.1|4031064_4031493_-	cytochrome c	NA	NA	NA	NA	NA
WP_011258297.1|4031565_4032396_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011408032.1|4032457_4033225_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|4033224_4033440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|4033585_4034377_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_041182398.1|4034534_4035698_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408036.1|4037931_4038570_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|4038745_4040686_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|4040902_4041457_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|4041678_4043109_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_012444398.1|4043211_4044630_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_011258309.1|4045046_4045772_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011408038.1|4045870_4046281_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041182034.1|4046332_4047289_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_011408040.1|4047532_4049914_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258314.1|4052586_4052997_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|4053296_4053479_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|4053611_4054652_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|4054724_4056170_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011257031.1|4057700_4058669_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408046.1|4059019_4059565_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011408047.1|4059561_4061025_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|4062485_4062740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258324.1|4063142_4063676_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|4063701_4064103_+	membrane protein	NA	NA	NA	NA	NA
WP_011408050.1|4064071_4064452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|4064448_4064691_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011258329.1|4066059_4067964_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_011408052.1|4068227_4070624_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011408053.1|4070773_4071496_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258334.1|4074415_4074916_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_103067809.1|4074857_4076534_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|4076680_4077946_+	potassium transporter	NA	NA	NA	NA	NA
WP_011408056.1|4078004_4079198_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_011408057.1|4079194_4079884_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_011408058.1|4079989_4081459_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|4081478_4082315_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|4082340_4083444_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011408060.1|4083440_4086497_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258343.1|4086562_4087153_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011258344.1|4087284_4089117_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|4089192_4089956_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|4089998_4091318_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408063.1|4092615_4097106_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_125168746.1|4097102_4097594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|4097645_4098614_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 29
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	4143570	4279882	4945802	capsid,integrase,holin,transposase,plate,tail,tRNA,terminase,portal,head	Stenotrophomonas_phage(42.86%)	119	4199230:4199250	4256322:4256342
WP_109181906.1|4143570_4144368_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182403.1|4144513_4144969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408088.1|4145223_4145967_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011408089.1|4146078_4146582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408090.1|4146809_4147715_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_011408091.1|4147785_4148556_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011258392.1|4148579_4149044_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075240114.1|4149157_4149565_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012444462.1|4149561_4152528_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	3.3e-307
WP_011258394.1|4152820_4153141_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_011258395.1|4153153_4153414_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011258396.1|4153646_4154699_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003484323.1|4154790_4155060_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_011408094.1|4155176_4156781_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_011408095.1|4156979_4157996_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_011258399.1|4158002_4160834_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
WP_011408096.1|4161148_4161649_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011258401.1|4161737_4162688_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011258402.1|4163201_4164137_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011408097.1|4164136_4166137_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011408098.1|4166139_4166766_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010365831.1|4166765_4167101_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_162013044.1|4167267_4169148_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012444470.1|4169372_4171619_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_041182048.1|4171642_4173262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408101.1|4173405_4177989_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.7	4.2e-19
WP_041182049.1|4177981_4178578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181910.1|4180313_4181415_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.2e-41
WP_011408105.1|4183319_4185875_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.3e-30
WP_011258418.1|4188844_4190236_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_011258422.1|4191626_4193183_+	membrane protein	NA	NA	NA	NA	NA
WP_011408111.1|4195766_4197005_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408112.1|4197445_4197739_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011258426.1|4198236_4199013_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_011408113.1|4199170_4200937_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
4199230:4199250	attL	CGCCGGCTGGACCGACGTGGC	NA	NA	NA	NA
WP_011258428.1|4201448_4201976_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027703718.1|4202075_4202753_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011258430.1|4202842_4203571_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258431.1|4203685_4204210_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_011258432.1|4204367_4204952_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011258433.1|4205151_4207059_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	3.4e-79
WP_010363979.1|4207187_4208225_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_011258434.1|4208277_4208736_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011258435.1|4208747_4209527_+	protein TolQ	NA	NA	NA	NA	NA
WP_011408114.1|4209683_4210133_+	protein TolR	NA	NA	NA	NA	NA
WP_011258437.1|4210122_4211163_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_011408115.1|4211422_4212742_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_011408116.1|4212799_4213318_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_113063195.1|4213324_4214143_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_011408117.1|4214185_4214869_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.5	1.5e-37
WP_011408120.1|4216102_4216813_-	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_011408121.1|4217047_4217254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408122.1|4217457_4217886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113063194.1|4217889_4218372_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_103057327.1|4218969_4219548_-	amino acid transporter	NA	NA	NA	NA	NA
WP_011408191.1|4222083_4223319_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|4223369_4224133_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959795.1|4224199_4225576_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_008578058.1|4225954_4226629_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011258445.1|4226873_4228058_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	57.2	2.0e-122
WP_041182055.1|4228057_4228279_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	58.3	1.9e-18
WP_011408130.1|4228275_4228482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408131.1|4228478_4228751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182407.1|4228747_4228993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161795300.1|4228989_4229235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053503014.1|4229257_4229434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010364106.1|4229426_4229837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258448.1|4230062_4230341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408133.1|4230337_4230556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408134.1|4230864_4233561_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.9	0.0e+00
WP_011258450.1|4233570_4233783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|4233779_4234058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408136.1|4234068_4234389_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.6	7.4e-24
WP_053503015.1|4234391_4234649_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|4234720_4235158_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_011258453.1|4235818_4236805_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
WP_011258454.1|4236801_4237203_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_011258455.1|4237215_4240086_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	49.2	6.4e-207
WP_011258456.1|4240118_4240232_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|4240240_4240543_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|4240588_4241098_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_011258459.1|4241128_4242295_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_011258460.1|4242306_4242666_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	65.3	1.2e-35
WP_011408138.1|4242662_4243226_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	44.3	8.2e-26
WP_011408139.1|4243286_4243865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408140.1|4243872_4245378_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	48.2	6.6e-54
WP_011408141.1|4245387_4245933_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	2.1e-50
WP_011408142.1|4245925_4246816_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	6.8e-83
WP_011408143.1|4246946_4248116_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_011258467.1|4248607_4249054_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.1	1.8e-36
WP_011408144.1|4249041_4249461_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.0	1.4e-38
WP_011408145.1|4249457_4249946_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	50.7	1.2e-25
WP_011408146.1|4249945_4250584_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.8e-49
WP_011408147.1|4250583_4250859_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	58.6	1.1e-20
WP_011408148.1|4250851_4251208_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	55.3	1.7e-21
WP_011258473.1|4251212_4251422_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	58.0	3.5e-14
WP_011408149.1|4251421_4251889_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.0	2.0e-30
WP_011408150.1|4251988_4252708_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	62.9	3.4e-69
WP_011408151.1|4252711_4253728_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.5	4.2e-137
WP_011408152.1|4253774_4254617_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.9	2.0e-68
WP_011408153.1|4254738_4256523_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.6	4.7e-269
4256322:4256342	attR	CGCCGGCTGGACCGACGTGGC	NA	NA	NA	NA
WP_011408154.1|4256522_4257545_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.5	2.6e-139
WP_075251737.1|4257570_4257816_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	50.0	7.7e-13
WP_011408155.1|4257733_4258435_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.2	3.2e-104
WP_011408156.1|4258501_4259248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408157.1|4259244_4259952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408158.1|4259965_4260307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052285781.1|4260287_4260845_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	5.3e-09
WP_011408160.1|4260793_4261195_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011408161.1|4262333_4263620_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	42.2	1.4e-81
WP_011408162.1|4263847_4264183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408164.1|4264889_4265294_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|4265372_4265870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258487.1|4266008_4267805_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	1.5e-81
WP_011408166.1|4268361_4268907_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_011258489.1|4269008_4273130_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	1.9e-47
WP_011408167.1|4273350_4275993_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182063.1|4277434_4278949_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_094187715.1|4279119_4279882_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	4433762	4493042	4945802	transposase,protease	Tupanvirus(18.18%)	52	NA	NA
WP_011408249.1|4433762_4435349_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_041182078.1|4435529_4437320_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011258600.1|4437426_4438227_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|4438257_4438635_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258602.1|4438624_4439305_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|4439301_4440201_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|4440424_4441147_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011408250.1|4441295_4442018_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011408251.1|4442176_4443511_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	1.0e-29
WP_011258607.1|4443685_4444183_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011257310.1|4444278_4445514_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408252.1|4445742_4447119_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_041182416.1|4447238_4447922_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408254.1|4447938_4448973_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408255.1|4449153_4450731_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408256.1|4450848_4451853_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408257.1|4451852_4452407_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408258.1|4452492_4453245_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|4453331_4453538_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_014504008.1|4455048_4455693_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_011408263.1|4455682_4458184_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_011408264.1|4458180_4459785_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	4.9e-15
WP_011258619.1|4459781_4460015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|4460011_4461034_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|4461370_4461736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|4461732_4462323_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011408268.1|4462420_4464130_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|4464238_4464565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|4464794_4465139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408270.1|4465261_4466437_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011258626.1|4466592_4469421_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|4469481_4470582_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_041182081.1|4471050_4471578_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|4471979_4472153_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|4472313_4472568_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|4472742_4473009_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|4473199_4473766_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_166473755.1|4475190_4476525_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258635.1|4476847_4477033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445232.1|4477222_4478599_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011408277.1|4478738_4479212_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408279.1|4480883_4481933_-	cation transporter	NA	NA	NA	NA	NA
WP_011408280.1|4482047_4482383_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_075239156.1|4482671_4482962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408282.1|4483852_4484971_-	alkene reductase	NA	NA	NA	NA	NA
WP_011258642.1|4485191_4486403_+	MFS transporter	NA	NA	NA	NA	NA
WP_011258643.1|4488325_4488781_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011408284.1|4489054_4489657_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258645.1|4489692_4490301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258646.1|4490360_4490555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408285.1|4490624_4491995_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_109181916.1|4492279_4493042_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	4509084	4568186	4945802	tRNA,coat,transposase,protease	Acidithiobacillus_phage(25.0%)	44	NA	NA
WP_011258663.1|4509084_4511169_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408302.1|4511393_4511843_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_162866904.1|4512633_4513665_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|4513935_4515333_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408306.1|4515329_4516307_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_069959816.1|4516488_4518426_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|4518846_4519623_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|4519627_4520302_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_082323429.1|4521936_4523313_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|4523352_4523748_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_069959817.1|4523790_4525266_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_011408313.1|4526064_4526481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|4526494_4526665_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011258676.1|4530353_4530917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013197.1|4531389_4532697_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|4532873_4533476_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408317.1|4533549_4533996_+	membrane protein	NA	NA	NA	NA	NA
WP_075244058.1|4534073_4534304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258681.1|4536441_4537854_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258682.1|4537850_4538588_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_042464756.1|4538587_4540768_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258685.1|4541607_4542567_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011408321.1|4542742_4546333_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011408322.1|4546790_4547531_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_027703356.1|4547527_4548784_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011258689.1|4548822_4549614_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|4549637_4550099_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_069959820.1|4550095_4551109_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_012445188.1|4551508_4553875_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011408324.1|4553958_4555305_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|4555331_4556522_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|4556524_4557352_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|4557348_4558110_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|4558127_4558685_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|4558865_4559588_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|4559644_4560022_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|4560149_4561028_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|4561197_4562001_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|4562376_4563102_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|4563104_4563437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|4563483_4564518_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011258704.1|4564514_4566866_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011408330.1|4566882_4567653_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011408331.1|4567661_4568186_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 32
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	4619347	4746123	4945802	tRNA,transposase	Ralstonia_phage(17.39%)	89	NA	NA
WP_011408357.1|4619347_4620667_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|4621001_4621928_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|4622057_4622663_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408359.1|4623001_4624771_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_027703751.1|4624767_4625370_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011258751.1|4625628_4626222_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|4626420_4627857_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|4628098_4629301_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|4629343_4632172_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|4632352_4633285_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|4633281_4634781_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|4635118_4635382_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|4635661_4636162_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|4636403_4637771_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_109181925.1|4640794_4641557_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408367.1|4643009_4644413_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_042464794.1|4644535_4644958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258770.1|4645590_4646427_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_075242602.1|4646436_4647423_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011258772.1|4647419_4648295_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_011408371.1|4648291_4648654_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|4648656_4648905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|4649040_4649598_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|4649689_4650655_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|4650680_4652030_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|4652022_4652259_+	protein SlyX	NA	NA	NA	NA	NA
WP_042464803.1|4652259_4653012_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|4653345_4654191_+	transporter	NA	NA	NA	NA	NA
WP_041182423.1|4654331_4655507_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011408378.1|4655520_4656831_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011408379.1|4656827_4657814_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408380.1|4657810_4659016_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011408381.1|4659402_4662156_-	methionine synthase	NA	NA	NA	NA	NA
WP_011408382.1|4662298_4663438_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|4663434_4664430_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_011408383.1|4664518_4665700_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464808.1|4665699_4665840_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464810.1|4666211_4667657_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258790.1|4668223_4670752_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|4670962_4671761_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258793.1|4672831_4673599_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011408388.1|4673600_4673948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|4674106_4675075_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181928.1|4676427_4677393_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|4677837_4679022_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408398.1|4679076_4680552_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011258799.1|4680873_4681056_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|4681204_4682404_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258803.1|4683264_4684233_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_109181930.1|4684512_4685311_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181931.1|4685536_4686502_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181932.1|4688731_4689697_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4690728_4691697_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181933.1|4692872_4693975_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|4694161_4694629_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408403.1|4694989_4695649_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|4695760_4697110_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187728.1|4697259_4698058_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408404.1|4698497_4699817_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|4700029_4700998_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408405.1|4701061_4701646_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|4701745_4702759_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296745.1|4703449_4703722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408408.1|4707866_4708166_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|4708169_4708364_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408412.1|4720036_4721356_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464827.1|4723187_4724273_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|4724600_4725299_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|4725301_4725868_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|4725879_4726557_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_069959832.1|4726645_4728076_-	amino acid permease	NA	NA	NA	NA	NA
WP_033013325.1|4728152_4729625_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|4729770_4730358_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|4730499_4731741_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011408423.1|4731949_4733368_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|4733402_4733702_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011408425.1|4733698_4735570_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_041182103.1|4735859_4736873_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011258848.1|4736872_4737304_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|4737300_4737903_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|4737895_4739833_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|4740001_4740472_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|4740468_4740639_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011408427.1|4740635_4741388_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258853.1|4741482_4742178_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|4742174_4742819_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|4743045_4744194_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|4744333_4745137_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|4745157_4746123_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP050114	Xanthomonas oryzae pv. oryzae strain K3 chromosome, complete genome	4945802	4844084	4903100	4945802	tRNA,transposase	Xanthomonas_phage(86.21%)	55	NA	NA
WP_012444952.1|4844084_4845497_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187798.1|4846002_4846801_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|4847114_4847441_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|4847450_4848365_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|4848361_4849657_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|4849653_4850745_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|4850741_4851869_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|4851865_4852468_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|4852464_4853199_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|4853192_4853969_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|4853958_4854579_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_011408491.1|4859242_4859542_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|4859545_4859740_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_145973245.1|4860007_4863391_-	avirulence protein	NA	NA	NA	NA	NA
WP_011258951.1|4863848_4864628_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|4864669_4864768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182117.1|4865521_4865707_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|4865706_4865910_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|4866045_4867119_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|4867223_4867523_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|4867886_4868126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|4868232_4869717_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|4869718_4870039_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011258954.1|4870035_4871220_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	2.3e-54
WP_080493496.1|4871274_4871445_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
WP_075240059.1|4872553_4872814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242175.1|4873013_4873397_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	100.0	9.1e-69
WP_069959845.1|4873678_4873990_+	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	100.0	1.8e-54
WP_113085484.1|4874014_4874227_-	hypothetical protein	NA	A0A1W6DXJ1	Xanthomonas_phage	100.0	2.4e-26
WP_069959846.1|4874282_4874576_-	hypothetical protein	NA	A0A1W6DXU7	Xanthomonas_phage	100.0	3.4e-47
WP_069959847.1|4874736_4875384_-	conjugal transfer protein	NA	A0A1W6DY89	Xanthomonas_phage	100.0	2.7e-121
WP_069959848.1|4875385_4876579_-	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	100.0	5.5e-221
WP_011408503.1|4876578_4876908_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_069959849.1|4876907_4878314_-	hypothetical protein	NA	A0A1W6DXV5	Xanthomonas_phage	99.6	7.9e-235
WP_011347634.1|4878450_4878681_-	hypothetical protein	NA	A0A1W6DXZ2	Xanthomonas_phage	100.0	2.2e-30
WP_042464854.1|4878692_4878896_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_069959850.1|4878899_4879196_-	DNA-binding protein	NA	A0A1W6DXU2	Xanthomonas_phage	100.0	2.8e-49
WP_069959851.1|4879192_4880134_-	inovirus-type Gp2 protein	NA	A0A1D6ZIT9	Xanthomonas_phage	99.0	9.7e-181
WP_134953795.1|4880219_4880405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408508.1|4880385_4880598_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
WP_069970101.1|4880910_4881540_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408511.1|4881664_4881847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|4881968_4882280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|4882349_4883112_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168752.1|4883616_4883940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|4885059_4886028_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181945.1|4886357_4887120_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082325281.1|4888341_4892139_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|4892407_4892602_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|4892605_4892905_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_109181946.1|4896972_4897735_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182100.1|4897966_4898161_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|4898164_4898464_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069959856.1|4898688_4902705_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444927.1|4902923_4903100_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
