The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050067	Klebsiella aerogenes strain 035 chromosome, complete genome	4832387	79306	90578	4832387	transposase	Enterobacteria_phage(63.64%)	14	NA	NA
WP_085950818.1|79306_80426_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_166479537.1|81072_83406_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
WP_166479538.1|83420_83741_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_058676329.1|83737_83965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479873.1|83961_84507_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	3.1e-30
WP_058676330.1|84509_84776_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.2e-30
WP_166479539.1|84880_85018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058676331.1|85315_86053_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	1.7e-79
WP_058676332.1|86049_86310_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	66.7	3.2e-25
WP_166479540.1|86309_86873_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	61.2	2.4e-54
WP_015632445.1|87373_87781_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_032414478.1|87777_88128_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.1e-39
WP_015632444.1|88157_89747_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	66.1	1.9e-189
WP_166479541.1|90164_90578_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	91.2	2.7e-66
>prophage 2
NZ_CP050067	Klebsiella aerogenes strain 035 chromosome, complete genome	4832387	453072	514943	4832387	tail,transposase,protease,tRNA	Stx2-converting_phage(30.0%)	60	NA	NA
WP_015703637.1|453072_454020_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	6.5e-07
WP_015703636.1|454034_454544_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.5	2.0e-18
WP_047075921.1|454673_455798_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_015369440.1|455769_456243_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_015369441.1|456269_456824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015369442.1|456816_457389_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_032709258.1|457392_458211_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_072057803.1|458207_458465_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_015703633.1|458440_458995_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_015369447.1|465148_465370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632445.1|466587_466995_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_032414478.1|466991_467342_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.1e-39
WP_015632444.1|467371_468961_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	66.1	1.9e-189
WP_152280609.1|469783_469963_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_048291734.1|469971_470253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152280610.1|470344_471925_+	virulence-associated E family protein	NA	A0A088FVF8	Escherichia_phage	66.2	7.9e-151
WP_152280607.1|471934_472159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155687102.1|472910_473822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048291730.1|473824_474139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479552.1|474141_474309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479553.1|474514_474847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152292643.1|474848_475058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152292642.1|475074_475287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479554.1|475308_477402_+|tail	phage tail tape measure protein	tail	A0A193GYN8	Enterobacter_phage	67.2	2.9e-241
WP_000462905.1|477489_477786_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_015369451.1|477810_478776_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_015703628.1|479134_480016_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_015369453.1|480027_481479_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_015369454.1|481468_481711_-	DUF997 family protein	NA	NA	NA	NA	NA
WP_015369455.1|481821_483171_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_015369456.1|483181_483643_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_015369457.1|483665_484118_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_058675831.1|484351_484951_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_015369459.1|484950_485952_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_166479555.1|486029_487004_-	oxidoreductase	NA	NA	NA	NA	NA
WP_015369461.1|487218_489159_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918653.1|489459_490503_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_015369462.1|490573_491572_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_015369463.1|491571_492060_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_015369464.1|492068_492650_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_015369465.1|492652_494122_+	ribonuclease G	NA	NA	NA	NA	NA
WP_058675833.1|494211_498009_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_166479556.1|498123_499569_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_020077822.1|499613_500543_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918640.1|500673_500877_+	AaeX family protein	NA	NA	NA	NA	NA
WP_015369469.1|500884_501817_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_015369470.1|501822_503790_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_015369471.1|503874_504150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047039050.1|504199_504466_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_015369473.1|504566_504830_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_015369474.1|505210_505681_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_015369475.1|506096_507035_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_015703614.1|508003_509062_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_015369479.1|509149_510517_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.2	4.3e-20
WP_015369480.1|510690_511089_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_015369481.1|511279_512410_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918559.1|512657_513086_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|513101_513494_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_015369483.1|513803_514442_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_015369484.1|514445_514943_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	6.6e-27
>prophage 3
NZ_CP050067	Klebsiella aerogenes strain 035 chromosome, complete genome	4832387	613486	700064	4832387	tail,integrase,portal,terminase,holin,transposase,capsid,head,tRNA	Cronobacter_phage(67.57%)	81	661874:661921	693899:693946
WP_004099053.1|613486_614455_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_045359741.1|615109_616522_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_047053680.1|616540_618028_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_015703565.1|618557_619805_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_020077873.1|620072_621041_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.6	9.8e-35
WP_015369583.1|621309_622299_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_015369584.1|622372_622873_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_015369585.1|622943_624074_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_045359752.1|624182_626204_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_166479561.1|626385_627984_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_058675846.1|628021_628993_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_047046763.1|629211_630699_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.0e-19
WP_058675847.1|630695_631730_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_047039109.1|631730_632729_+	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
WP_015959041.1|632730_633732_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_002917724.1|633743_634631_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_015369591.1|634627_634924_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_047039111.1|634964_637316_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_047039114.1|637333_638392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479562.1|638405_639809_-	amino acid permease	NA	NA	NA	NA	NA
WP_009485171.1|640038_641472_-	amino acid permease	NA	NA	NA	NA	NA
WP_004900777.1|641566_642016_-	beta-galactosidase subunit beta	NA	NA	NA	NA	NA
WP_058675848.1|642012_645105_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.9	1.5e-158
WP_020077884.1|645520_646504_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_015369597.1|646711_647044_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_020077886.1|647086_648466_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.0	5.8e-33
WP_020077887.1|648730_649249_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166479563.1|649478_650258_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_045414273.1|650361_652011_-	glycerone kinase	NA	NA	NA	NA	NA
WP_058675849.1|652085_653504_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_007372179.1|653514_654147_-	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_032709201.1|654157_655228_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_007372182.1|655784_656882_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_058675850.1|656995_658927_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_166479564.1|658937_659582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015703533.1|660506_660935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015369625.1|660992_661205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015369626.1|661448_661748_+	DUF1889 family protein	NA	NA	NA	NA	NA
661874:661921	attL	ATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_166479565.1|662037_662835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117083101.1|662831_663851_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.0	4.5e-123
WP_166479566.1|663852_664434_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	38.3	5.3e-28
WP_015460844.1|664577_664799_+	regulator from bacteriophage origin	NA	NA	NA	NA	NA
WP_059288009.1|664829_665333_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	6.6e-59
WP_059288008.1|665342_665537_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_032411117.1|665526_665955_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	50.4	1.8e-25
WP_059288007.1|665954_666356_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	54.1	5.1e-38
WP_059288006.1|666422_666656_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_166479567.1|666646_667507_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	79.5	1.9e-127
WP_166479877.1|667838_669824_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	56.9	1.5e-199
WP_000343760.1|669945_671166_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_166479568.1|671267_671474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047043583.1|671447_671771_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	91.3	6.7e-49
WP_059288001.1|671767_672817_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	79.5	3.4e-158
WP_166479569.1|672813_674589_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	85.1	2.0e-296
WP_059287999.1|674762_675566_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	55.8	1.7e-77
WP_032411135.1|675626_676649_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	80.9	2.4e-156
WP_047043570.1|676651_677353_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	65.9	1.3e-84
WP_047043567.1|677413_677902_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	83.3	7.3e-63
WP_047043564.1|677898_678405_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	72.4	6.6e-67
WP_166479570.1|678401_679109_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	4.8e-100
WP_047043558.1|679105_680233_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	80.8	6.4e-171
WP_032411150.1|680229_680685_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.8	2.3e-58
WP_032411153.1|680694_680988_+|holin	holin	holin	NA	NA	NA	NA
WP_047043555.1|680984_681326_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	83.2	1.4e-44
WP_047043552.1|681325_681658_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
WP_032411162.1|681804_682062_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	9.5e-22
WP_166479571.1|682249_684217_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	66.7	5.4e-250
WP_047043541.1|684213_684543_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	66.1	1.1e-35
WP_047043538.1|684539_685724_+	phage protein	NA	F1BUK6	Cronobacter_phage	78.3	4.5e-175
WP_116327642.1|685716_686304_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	80.0	4.9e-90
WP_116327635.1|688599_689103_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	60.2	9.5e-50
WP_166479572.1|689092_689818_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	4.0e-57
WP_047043529.1|689789_690341_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	74.3	5.7e-64
WP_166479573.1|690343_692023_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	67.3	1.8e-193
WP_166479531.1|692012_692372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105517326.1|692609_693644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045359807.1|694102_694609_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
693899:693946	attR	ATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_015369628.1|694678_696523_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_015369629.1|696673_698419_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	2.4e-76
WP_001144069.1|698596_698812_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015369630.1|699050_700064_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
>prophage 4
NZ_CP050067	Klebsiella aerogenes strain 035 chromosome, complete genome	4832387	1636699	1647580	4832387	transposase	Enterobacteria_phage(22.22%)	10	NA	NA
WP_142974942.1|1636699_1637764_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.9	7.1e-103
WP_047062039.1|1637778_1638648_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	1.3e-110
WP_166479644.1|1638679_1639570_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	9.0e-27
WP_166479645.1|1639581_1640136_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	2.3e-52
WP_166479646.1|1640310_1641477_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	2.7e-111
WP_166479647.1|1641798_1642803_-	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.8	2.7e-35
WP_085950818.1|1643083_1644204_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_045412931.1|1644909_1645677_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_045412934.1|1645676_1646417_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.3	2.4e-09
WP_166479648.1|1646428_1647580_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.4	3.4e-79
>prophage 5
NZ_CP050067	Klebsiella aerogenes strain 035 chromosome, complete genome	4832387	1670116	1730186	4832387	integrase,transposase	Salmonella_phage(25.0%)	46	1703077:1703136	1736225:1737281
WP_166479655.1|1670116_1672219_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.8	5.2e-65
WP_166479881.1|1672257_1673679_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_166479656.1|1674129_1675035_+	acyltransferase	NA	C6ZR20	Salmonella_phage	46.1	1.8e-59
WP_004099053.1|1675056_1676025_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_166479657.1|1676110_1677208_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.0	8.8e-08
WP_166479658.1|1677315_1678464_-	acyltransferase	NA	Q6QI96	Burkholderia_phage	30.9	3.0e-35
WP_166479659.1|1678857_1680024_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	81.1	4.0e-184
WP_000343760.1|1680214_1681435_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_020078368.1|1681499_1681973_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_015706020.1|1682071_1683130_+	FUSC family protein	NA	NA	NA	NA	NA
WP_015365834.1|1683298_1683622_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_058675536.1|1683795_1684338_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_045361460.1|1684334_1685075_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_166479660.1|1685102_1686161_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_032708694.1|1686199_1687309_-	adenosylhomocysteinase	NA	NA	NA	NA	NA
WP_015365839.1|1687508_1688246_+	HPP family protein	NA	NA	NA	NA	NA
WP_046883129.1|1689003_1690323_-	shikimate transporter	NA	NA	NA	NA	NA
WP_015365842.1|1690610_1691108_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015706013.1|1694026_1694359_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_042895719.1|1694368_1694707_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_020078378.1|1694754_1695645_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042895723.1|1695776_1696364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365870.1|1697002_1698442_+	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_015365872.1|1698791_1700171_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_058675535.1|1700350_1701499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026612260.1|1701470_1701749_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
1703077:1703136	attL	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAG	NA	NA	NA	NA
WP_077255787.1|1703132_1704101_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
WP_042896345.1|1704587_1705832_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_042896347.1|1705831_1706995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042896349.1|1706991_1708236_+	biotin carboxylase	NA	NA	NA	NA	NA
WP_166479661.1|1708251_1709460_+	MFS transporter	NA	NA	NA	NA	NA
WP_166479882.1|1709510_1710965_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_020078389.1|1711092_1711332_-	histidine kinase	NA	NA	NA	NA	NA
WP_020078390.1|1711480_1713058_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_020078391.1|1712968_1713901_-	nucleoside recognition family protein	NA	NA	NA	NA	NA
WP_020078392.1|1713968_1714682_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_015365883.1|1715191_1716109_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_015705998.1|1716215_1717166_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_058675534.1|1717242_1718184_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_020078434.1|1718414_1719215_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_058675533.1|1719715_1720858_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.6	1.2e-119
WP_058675532.1|1722506_1723202_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	30.7	2.3e-09
WP_000343760.1|1724646_1725867_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_071556924.1|1726008_1727448_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	47.1	1.5e-95
WP_085950818.1|1727679_1728799_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_166479662.1|1728809_1730186_-|integrase	site-specific integrase	integrase	A0A2H4J165	uncultured_Caudovirales_phage	30.5	8.4e-40
1736225:1737281	attR	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAGGCAATACGCACGCTTTCAGGCATACCTGCTTTCGTCATTTTGTTCAGCGCTCGTACCAGGGCCATAGCCTCCGCAACCTGACCATCGTAGTCACGCAGCGTCAGTGAACCCCCGAACAGCTGTTTTACCCGGTACATCGCCGTTTCCGCTATCGAGCGACGGTTGTAATCTGTTGTCCATTTCCACCGCGCATTACTCCCGGTCAGCCGCTGATTCGCAACAGCACGGTTACGGTCTGCATATTCACCGGGCCAGTAACCCGCGCCTTTTCGGGGCGGGATAAGCGCGCTGATTTTCTTACGCCGCAGTTCATCGTGACAGAGCCGGGTGTCGTAAGCGCCGTCTGCCGATGCTGCCCTGATTTTTCTGTGAGTCTGCCGGATAAGACCCGGGAAGGCTTCTGAGTCCGTCACATTGTTCAGCGACAGGTCTGCGCAGATGATTTCATGTGTTTTACTGTCAACGGCGAGATGCAGCTTACGCCAGATACGGCGGCGTTCCTGGCCATGCTTTTTGACTTTCCACTCGCCTTCACCGAAGACCTTCAGCCCGGTGGAATCAATTACCAGGTGTGCGATTTCACCCCGGGTGGGCGTTTTGAAACTGACATTAACCGACTTTGCCCGCCTGCTGACACAGCTGTAATCCGGGCAGCGTAGCGGAACGTTCATCAGAGAAAAAATGGAATCAATAAAGCCCTGCGCAGCGCGCAGGGTCAGCCTGAATACGCGTTTAATGACCAGCACAGTCGTGATGGCAAGGTCAGAATAGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATAGCTTCATCATCCAGCCAGAAAGTTATGGAGCCACGGTTGATGAGGGCTTTATTGTAGGTGGGCCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCC	NA	NA	NA	NA
>prophage 6
NZ_CP050067	Klebsiella aerogenes strain 035 chromosome, complete genome	4832387	2060104	2065452	4832387	tRNA	Escherichia_phage(50.0%)	6	NA	NA
WP_042894631.1|2060104_2061478_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	5.1e-53
WP_032711785.1|2061525_2062461_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_032711784.1|2062804_2063140_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	76.8	2.4e-41
WP_042894575.1|2063197_2063494_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	77.9	4.0e-40
WP_015366316.1|2063730_2064165_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.0	1.8e-28
WP_042894578.1|2064309_2065452_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.5	6.2e-113
>prophage 7
NZ_CP050067	Klebsiella aerogenes strain 035 chromosome, complete genome	4832387	2966199	3008357	4832387	tail,lysis,portal,integrase,plate,terminase,transposase,capsid,head	Escherichia_phage(14.81%)	52	2988628:2988642	3018502:3018516
WP_166479728.1|2966199_2968017_-|tail	phage tail protein	tail	A0A2K9VK37	Klebsiella_phage	59.6	3.3e-07
WP_166479729.1|2968099_2968510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479730.1|2968509_2969355_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_166479731.1|2969375_2970053_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	37.8	3.4e-34
WP_166479732.1|2970049_2971198_-|plate	baseplate J/gp47 family protein	plate	B6SBU6	Clostridium_virus	26.1	2.4e-08
WP_166479733.1|2971187_2971637_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	42.9	1.9e-17
WP_166479734.1|2972210_2973296_-|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	31.2	5.1e-40
WP_166479735.1|2973292_2974693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479736.1|2974739_2976593_-	hypothetical protein	NA	A0A172JGI1	Citrobacter_phage	45.3	4.0e-21
WP_112041618.1|2976734_2977013_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_040210562.1|2977014_2977386_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_166479737.1|2977389_2978901_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.5	4.8e-105
WP_112041615.1|2978897_2979083_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_112041614.1|2979085_2979631_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_112041613.1|2979627_2979987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479738.1|2979991_2980372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112041611.1|2980373_2981423_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	34.3	9.5e-52
WP_166479739.1|2981521_2981929_-|head	head decoration protein	head	NA	NA	NA	NA
WP_166479740.1|2981928_2982519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112041608.1|2982520_2983387_-	S49 family peptidase	NA	A0A1I9KF73	Aeromonas_phage	39.4	1.4e-48
WP_102098480.1|2983383_2985021_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.9	3.3e-91
WP_000483310.1|2985020_2985284_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_166479741.1|2985292_2987419_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.9	1.8e-97
WP_166479742.1|2987360_2987924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479743.1|2988171_2988810_-	hypothetical protein	NA	NA	NA	NA	NA
2988628:2988642	attL	GGCGCCAGCAGCGCC	NA	NA	NA	NA
WP_101865484.1|2988925_2989432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479744.1|2989504_2989798_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	59.6	9.8e-23
WP_166479890.1|2989969_2990284_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	56.2	2.2e-20
WP_166479745.1|2990349_2990883_-	lysozyme	NA	G9L6J6	Escherichia_phage	81.6	6.9e-83
WP_032708406.1|2990884_2991133_-|lysis	lysis protein	lysis	A0A127KNH9	Pseudomonas_phage	35.1	1.1e-06
WP_166479746.1|2991301_2991589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479747.1|2991638_2992067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479891.1|2992291_2992894_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	72.3	2.5e-81
WP_032708410.1|2992907_2993939_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	1.5e-94
WP_166479748.1|2994138_2994531_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	43.3	8.3e-17
WP_015367395.1|2994873_2995107_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	74.0	2.3e-27
WP_032708415.1|2995259_2995589_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	61.9	1.9e-27
WP_000343760.1|2995690_2996911_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_166479749.1|2998522_2998870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479750.1|2998866_2999535_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	50.0	6.9e-56
WP_032708420.1|2999527_2999881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479892.1|2999883_3000135_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166479893.1|3000184_3000649_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	68.2	5.0e-61
WP_166479751.1|3000641_3001625_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	53.4	1.7e-42
WP_166479752.1|3001676_3002231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479753.1|3002233_3002449_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_012542200.1|3002550_3002940_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_166479754.1|3003671_3003866_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_166479755.1|3004035_3004332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479894.1|3005439_3006933_+	hypothetical protein	NA	K7PLW7	Enterobacteria_phage	58.8	4.4e-58
WP_166479756.1|3007000_3007264_+	excisionase	NA	NA	NA	NA	NA
WP_166479757.1|3007238_3008357_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	46.3	1.7e-86
3018502:3018516	attR	GGCGCCAGCAGCGCC	NA	NA	NA	NA
>prophage 8
NZ_CP050067	Klebsiella aerogenes strain 035 chromosome, complete genome	4832387	3540014	3561585	4832387	transposase,holin,terminase	Pseudomonas_phage(22.73%)	30	NA	NA
WP_166479785.1|3540014_3540437_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.1e-26
WP_166479898.1|3540514_3540700_-	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	94.9	1.6e-23
WP_047053439.1|3541560_3541917_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	2.5e-44
WP_123277580.1|3541987_3542182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015705689.1|3542319_3542802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163366192.1|3542856_3544029_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.5	2.5e-24
WP_063422107.1|3544052_3544445_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_063422106.1|3544441_3544993_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.8	3.9e-28
WP_042896406.1|3544994_3545378_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	44.4	4.6e-20
WP_058674196.1|3545364_3545598_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	48.5	2.6e-10
WP_042896379.1|3545607_3545862_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	54.8	5.5e-22
WP_166479786.1|3545863_3546259_-	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	42.5	2.1e-12
WP_153594459.1|3546299_3546572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042896375.1|3546580_3547534_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	73.7	9.4e-131
WP_166479787.1|3547544_3548330_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	3.5e-67
WP_166479788.1|3548415_3549528_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.7	6.2e-110
WP_166479789.1|3549511_3550912_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	7.1e-127
WP_166479790.1|3550911_3552219_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.7	1.4e-148
WP_166479791.1|3552196_3553189_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	34.5	6.3e-29
WP_166479792.1|3553683_3553836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047052335.1|3553873_3554110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059304787.1|3554319_3554604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479793.1|3555372_3555648_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	37.8	5.4e-07
WP_166479794.1|3555644_3555992_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	73.0	3.5e-35
WP_166479795.1|3555988_3556531_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	70.8	1.6e-71
WP_127175772.1|3556527_3556827_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	67.7	2.3e-27
WP_085950818.1|3557243_3558364_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_071609890.1|3558640_3558883_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.4	2.5e-24
WP_166479796.1|3558930_3559266_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015367875.1|3560718_3561585_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.3	5.0e-30
>prophage 9
NZ_CP050067	Klebsiella aerogenes strain 035 chromosome, complete genome	4832387	4197094	4247055	4832387	integrase,holin,transposase,capsid,tRNA	Bacillus_phage(20.0%)	35	4238894:4238953	4247241:4248009
WP_058676313.1|4197094_4200481_+|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
WP_047056429.1|4200566_4201514_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_015368475.1|4201526_4201925_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_015368476.1|4201921_4202542_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_058676314.1|4202554_4203223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015704255.1|4203254_4203668_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_004204123.1|4203685_4204015_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_032715926.1|4204215_4205223_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_046883383.1|4205270_4206665_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.1	4.4e-20
WP_026612414.1|4207035_4208100_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_058676316.1|4208096_4210856_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	1.6e-21
WP_015368483.1|4210855_4211980_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_020079735.1|4212008_4212326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072205731.1|4212649_4212925_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_015704249.1|4219038_4220160_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_166479839.1|4220214_4221657_-	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.4	2.4e-13
WP_008807068.1|4221646_4222330_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
WP_032706755.1|4222503_4223889_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_015368490.1|4223906_4224251_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_015368491.1|4224296_4225559_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_058675772.1|4225570_4228720_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.7	8.9e-61
WP_058675774.1|4229037_4229757_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_047053152.1|4229871_4230216_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_042894158.1|4230342_4230612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058675771.1|4230774_4234020_-	DEAD/DEAH box helicase	NA	A0A1B1ISM1	uncultured_Mediterranean_phage	25.9	1.1e-29
WP_058675770.1|4234019_4235699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058675769.1|4235695_4236436_-	OmpA family protein	NA	NA	NA	NA	NA
WP_058675768.1|4236449_4238639_-	anti-phage defense ZorAB system ZorA	NA	NA	NA	NA	NA
4238894:4238953	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATATTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_166479840.1|4240242_4241523_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059XK29	uncultured_phage	42.9	3.7e-05
WP_077255787.1|4241640_4242609_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
WP_047053704.1|4242771_4243005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479841.1|4243110_4244151_-|capsid	major capsid protein E	capsid	NA	NA	NA	NA
WP_166479842.1|4244969_4245320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479843.1|4245306_4245531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255787.1|4246086_4247055_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
4247241:4248009	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATATTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCCTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCGCCGACGTAACCCCACTGTTCGTCCATTTCCGCGCAAACAATGACGTCACTGCCCGGTTGTATGCGTGAGTTTACCGACTGCGGCCTGAGTTTTTTAAGTGTCGTAAAATCGTGTTGAGGCCAACGCCCATAATGCGTGCACTGGCGCGACATCCGACGCCATTCATGGCCATATCAATAATTTTCTGGTGTGTACCGGGCTGAGAGGCGGTGTAAGTGAACTGTAGCTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCAGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCC	NA	NA	NA	NA
>prophage 1
NZ_CP050069	Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence	88962	4425	56665	88962	integrase,transposase	Escherichia_phage(31.58%)	57	NA	NA
WP_000948429.1|4425_5625_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048230572.1|5634_5823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111963096.1|6670_6757_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_114079564.1|6834_7026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|6997_7834_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|7833_8637_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001189111.1|9282_10791_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001067855.1|11157_11862_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|14044_14749_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|14870_15776_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|15772_17011_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|17010_17595_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166479946.1|18087_18852_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	5.6e-86
WP_000130000.1|19078_19384_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|19394_20600_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000427614.1|20827_21832_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004883563.1|22013_22286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|22413_23253_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|23246_23594_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_012477387.1|23762_24395_-	type B-2 chloramphenicol O-acetyltransferase CatB2	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	44.4	4.1e-26
WP_001206317.1|24447_25239_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_019407932.1|25355_26150_-	aminoglycoside O-phosphotransferase APH(3')-XV	NA	Q75ZG1	Hepacivirus	39.4	1.3e-40
WP_003159191.1|26220_26775_-	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_013263789.1|26882_27683_-	subclass B1 metallo-beta-lactamase VIM-1	NA	NA	NA	NA	NA
WP_000845048.1|27849_28863_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_003159187.1|29276_29813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003159186.1|29824_30220_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003108276.1|30216_30468_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_058689425.1|30649_31189_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	57.3	1.3e-44
WP_001067855.1|31222_31927_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839878.1|32474_33866_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|33902_34475_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|34611_35202_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_014839983.1|35636_36251_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.4	8.1e-35
WP_001516695.1|36569_37226_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067855.1|37730_38435_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376623.1|39343_39844_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|39971_40811_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|40804_41152_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_032490158.1|41355_41829_-	trimethoprim-resistant dihydrofolate reductase DfrA16	NA	G3MBI7	Bacillus_virus	30.8	1.4e-18
WP_000845048.1|41984_42998_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001247892.1|43302_43593_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|43589_43991_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|43980_44337_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|44591_44918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|44914_45415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100853.1|45411_45783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|45776_46334_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_000427614.1|46412_47417_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_040119802.1|47765_49310_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048702525.1|49334_50048_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_049100499.1|50040_50553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023092982.1|50562_51378_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_023092983.1|51377_51989_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001067855.1|52191_52896_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001039464.1|55277_55664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131729011.1|56278_56665_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	89.9	4.3e-58
>prophage 2
NZ_CP050069	Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence	88962	61714	71338	88962	integrase	Escherichia_phage(42.86%)	10	48935:48950	74233:74248
48935:48950	attL	TGAGGCCAACGCCCAT	NA	NA	NA	NA
WP_160863065.1|61714_63202_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.8e-32
WP_040119803.1|63607_64039_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.4e-28
WP_004118291.1|64038_65310_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000064120.1|65391_66366_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|66365_67571_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|67986_68256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|68612_69479_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|70013_70118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|70246_70504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|70561_71338_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
74233:74248	attR	ATGGGCGTTGGCCTCA	NA	NA	NA	NA
>prophage 1
NZ_CP050068	Klebsiella aerogenes strain 035 plasmid p35, complete sequence	397663	2242	47375	397663	integrase,transposase	Stx2-converting_phage(27.27%)	43	2175:2234	46327:47526
2175:2234	attL	GGAAGGTGCGAATAAGTCCGAGATGTGAGATCATCGTGTTGTAACCTGAACCCAGAATGA	NA	NA	NA	NA
WP_000082736.1|2242_3223_+|transposase	IS5-like element ISEc68 family transposase	transposase	Q38213	Escherichia_phage	80.9	1.4e-153
WP_065892030.1|4135_4390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065892032.1|4566_5703_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004213829.1|5768_6086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|6236_6560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181760.1|6556_7315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386528.1|7311_8271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186937.1|8313_8721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|8730_9195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181763.1|9242_9485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181765.1|10072_10291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181766.1|10435_10975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181767.1|11043_12288_-	topoisomerase	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
WP_004181768.1|12398_12629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479906.1|12700_14530_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026538.1|14593_15670_-	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_004186944.1|15762_16815_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_004181772.1|16842_17664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181774.1|17725_18079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025368599.1|18223_19210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181776.1|19543_21343_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	23.1	1.8e-26
WP_004181777.1|21633_21882_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004181778.1|21871_22156_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	4.7e-22
WP_166479907.1|22309_23536_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	77.8	9.2e-155
WP_077257669.1|24109_24538_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.6	1.6e-34
WP_040209642.1|24573_25761_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.0	3.5e-143
WP_040209648.1|27460_28309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479908.1|28357_31543_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_004026524.1|31552_32590_-	traU family protein	NA	NA	NA	NA	NA
WP_014386515.1|32586_33948_-	conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_004026522.1|33934_34459_-	signal peptidase I	NA	NA	NA	NA	NA
WP_004181747.1|34543_36082_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
WP_004114612.1|36131_36479_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_131729011.1|36475_36862_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	89.9	4.3e-58
WP_040209782.1|37043_41285_-	cell motility protein	NA	NA	NA	NA	NA
WP_004181791.1|41412_41949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032437918.1|41936_42341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196672.1|42315_42774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032437920.1|43457_44261_+	TrhO	NA	NA	NA	NA	NA
WP_040209781.1|44250_44967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196661.1|44953_45454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386510.1|45425_45842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000082736.1|46394_47375_+|transposase	IS5-like element ISEc68 family transposase	transposase	Q38213	Escherichia_phage	80.9	1.4e-153
46327:47526	attR	GGAAGGTGCGAATAAGTCCGAGATGTGAGATCATCGTGTTGTAACCTGAACCCAGAATGAGTAACCGGATGAGCCAGCAACTGACTTTTGCCGACAGTGAGTTTTCCAGTAAACGCCGCCAGACCCGCAAAGAAGTTTTCCTTGGCAGAATGGATGACTTGCTTCCCTGGGACAAATTACTTGGCGTTATCGAGCCTGTGTATCCCAAGGCCGGTAATGGTCGCAGGCCCTATCCGCTGGAAACCATGCTGCGTATTCACTGCATGCAGCAATGGTACAACCTGAGCGATGAGGCCATGGAAGATGCCCTCTATGAAATCGCCTCCATGCGCCAATTTGCTCGCCTGTCACTGGATAAAGCCATTCCAGACCGCACTACCATCATGAATTTCCGGCATTTGCTGGAGCAGCATGAACTGGCCCGCAAAATCTTCAGTACCGTTAATCACTGGCTAGCAGAGTGTGGCGTTCTAATGACCCAGGGCACCTTGGTGGATGCCACCATCATTCAAGCCCCCAGCTCTACCAAAAACAAACACAACAGCCGTGATGAAGACATGCACCAGACCAAGAAAGGTAACCAGTGGTACTTCGGCATGAAAGCGCACATTGGCGTGGACGCCAAAAGTGGCCTGACCCACAGTCTGGTGACCACGGCGGCTAACGAGCACGACCTCAATCAGGTTGGCAAGTTACTGCATGGCGATGAAGAATTTATCTCAGCCGATGCTGGTTATCAGGGGGCCGAAAAGCGCGATGAGCTCAGCGATGTCAGCGCAGACTGGCTTATCGCCAAGCGTCCCGGCAAAGTGAATGCATTGAAGCAACACCCGCGCAAGAACAAGCTGGCCATCCGTTACGAATACCTGAAAGCGAGTATCCGAGCGAAGGTTGAGCATCCATTTCGGATAGTAAAATGTCAGTTTGGTTTCGTCAAAGCCAGGTACAAGGGGCTGGCTAAAAATGACAGTCAACTGGCGATGTTATTCACCCTGGCGAACCTGGTTCGAGTTGACCAATTGATACGGGCACAGGCGAGATCTACCTGAAATGAGGAAATTGGCCTGAAACAGGGCCAAAATCAGCCACGAAGAGACGATTTTGGGCTGAAAATTGGAAAATTGAGCCACAGGACGTCGATAAAGGACGGTTTGGGGCGTCATATCGGGAGCTGCGGACCACTTAATCGCAACTTCCTTA	NA	NA	NA	NA
>prophage 2
NZ_CP050068	Klebsiella aerogenes strain 035 plasmid p35, complete sequence	397663	81487	137470	397663	transposase	Salmonella_phage(24.14%)	65	NA	NA
WP_004196710.1|81487_82066_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
WP_004181824.1|82056_82371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883033.1|82495_82906_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	60.0	2.9e-41
WP_004196726.1|83090_83450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|84376_84637_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_004883130.1|84669_85104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883132.1|85192_85522_+	hypothetical protein	NA	A0A060D1I0	Salmonella_phage	62.2	5.7e-11
WP_074167814.1|85623_87009_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
WP_057774868.1|87098_88301_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	37.7	1.8e-33
WP_004883142.1|88880_89129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026459.1|89156_89474_+	DUF3846 domain-containing protein	NA	A0A2H4P7A4	Pseudomonas_phage	47.7	3.2e-11
WP_123600090.1|89594_89873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004099053.1|90406_91375_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_004026456.1|92157_92466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077251652.1|92760_93195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883151.1|93423_94044_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	46.5	4.8e-51
WP_004181834.1|94110_94329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883155.1|94364_94637_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_004181835.1|94915_95227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883156.1|95238_95556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883159.1|95585_95975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883162.1|96351_96840_+	hypothetical protein	NA	K7PM35	Enterobacteria_phage	34.0	2.3e-08
WP_004883165.1|97094_97268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057774875.1|97392_98040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025368632.1|98062_98308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883182.1|98569_99814_+	site-specific DNA-methyltransferase	NA	A0A1U9WRT4	Mycobacterium_phage	25.3	2.9e-07
WP_004883186.1|99882_103263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026444.1|103272_103626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026443.1|103946_104738_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	32.5	1.4e-10
WP_000427614.1|105990_106995_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_040210162.1|107047_108127_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.4	4.4e-60
WP_004026440.1|110154_110685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883194.1|110762_110969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883196.1|111052_111532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104457020.1|112289_113517_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	3.5e-170
WP_065883099.1|113944_114238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071557840.1|114276_114858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026418.1|115246_116116_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_166479911.1|116169_116490_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.0	5.0e-28
WP_004883213.1|116570_116885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197205.1|117004_117256_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026415.1|117421_117640_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_004026414.1|117732_118230_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.6e-23
WP_004026413.1|118226_118415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197209.1|118892_119120_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
WP_004883219.1|119116_119761_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
WP_004197228.1|120177_120564_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_004026408.1|121262_121478_+	hypothetical protein	NA	J9Q804	Salmonella_phage	51.4	6.1e-14
WP_126033806.1|123208_123415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197207.1|123498_123771_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
WP_004883232.1|124050_124338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197199.1|124791_125316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197222.1|125379_126147_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	62.7	3.5e-43
WP_004197181.1|126598_127048_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	40.7	1.3e-18
WP_004026394.1|127117_127726_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
WP_014386579.1|128013_128469_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_004026392.1|128529_128694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883242.1|129352_130594_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
WP_004883245.1|131041_131437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883249.1|131446_131854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016947074.1|131883_132294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|132664_133669_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004883268.1|134244_134658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123072385.1|135203_136151_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	2.3e-41
WP_123072386.1|136138_137470_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.2	8.3e-85
>prophage 3
NZ_CP050068	Klebsiella aerogenes strain 035 plasmid p35, complete sequence	397663	155120	201461	397663	integrase,protease,transposase	Stx2-converting_phage(21.43%)	37	188880:188893	199501:199514
WP_166479924.1|155120_156677_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	55.4	1.7e-161
WP_088734067.1|156696_157044_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.2e-43
WP_166479925.1|157040_157715_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	35.1	1.8e-11
WP_166479926.1|157768_158695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479927.1|158846_159215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479943.1|159445_159754_+	copper-binding protein	NA	NA	NA	NA	NA
WP_104457020.1|159877_161106_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	3.5e-170
WP_166479928.1|161181_161811_-	hypothetical protein	NA	A0A2H4J137	uncultured_Caudovirales_phage	42.6	5.7e-44
WP_166479904.1|162219_162384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004099053.1|162385_163354_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_166479929.1|163414_163870_+	MFS transporter	NA	NA	NA	NA	NA
WP_009654821.1|164153_166292_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016154436.1|166572_166821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016154435.1|167205_167568_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009654826.1|167613_168618_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_009654818.1|168803_171299_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.6	2.0e-92
WP_016154433.1|171312_171777_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_135683941.1|171866_172319_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_023336665.1|172400_174896_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.8	1.0e-144
WP_080396553.1|174986_175394_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023336666.1|175383_175647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135683944.1|175959_176907_+	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_023336667.1|177126_177561_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_023302365.1|177710_181151_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	24.3	2.8e-36
WP_016154430.1|182196_182649_-	peptide deformylase	NA	A0A2I7R224	Vibrio_phage	34.5	2.4e-12
WP_077264203.1|182825_183884_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_020805474.1|183968_185000_+|transposase	IS630-like element ISSpu2 family transposase	transposase	NA	NA	NA	NA
WP_016154426.1|186258_186432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016154425.1|186757_186970_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_016154424.1|187396_188134_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.1	1.7e-55
188880:188893	attL	CCGGGCCAGGATCC	NA	NA	NA	NA
WP_162838707.1|190467_191707_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	79.4	1.9e-131
WP_016154417.1|194117_194606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016154416.1|194602_195826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016154415.1|196393_197416_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016154414.1|197817_199008_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.7	1.5e-122
WP_047727575.1|199425_200382_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
199501:199514	attR	CCGGGCCAGGATCC	NA	NA	NA	NA
WP_044347237.1|200381_201461_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	32.7	8.1e-38
>prophage 4
NZ_CP050068	Klebsiella aerogenes strain 035 plasmid p35, complete sequence	397663	209083	270517	397663	protease,transposase	Salmonella_phage(26.32%)	59	NA	NA
WP_040217779.1|209083_210352_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.4	1.5e-59
WP_115660846.1|210356_213614_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_115667342.1|213614_214907_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_166479930.1|214903_216931_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.7	2.7e-26
WP_000470624.1|217069_217705_+	recombinase family protein	NA	NA	NA	NA	NA
WP_009652884.1|217732_218569_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000235177.1|218634_219033_-	VOC family protein	NA	NA	NA	NA	NA
WP_000842086.1|219074_220184_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
WP_001141270.1|220214_220490_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000427623.1|221017_222022_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_009652583.1|222370_223366_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004207021.1|223426_224254_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.0	3.0e-53
WP_009652585.1|224272_225751_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.6	4.3e-199
WP_004207019.1|226176_226800_+	recombinase family protein	NA	NA	NA	NA	NA
WP_004207017.1|226854_229839_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.2	3.5e-301
WP_000427623.1|229917_230922_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_074449071.1|231402_232371_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	4.5e-181
WP_086893234.1|232490_234356_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_069196742.1|234493_235417_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	5.6e-173
WP_004181739.1|235557_235974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057775061.1|236274_236733_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_057775064.1|236735_237959_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_014386544.1|237969_238926_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_004210251.1|238925_240005_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	1.1e-39
WP_004181732.1|240006_240780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934785.1|240772_241915_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	3.7e-33
WP_042934773.1|241926_242985_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_004210240.1|243296_243881_+	tellurium resistance protein	NA	K4JRX3	Caulobacter_phage	29.9	1.8e-12
WP_023287201.1|243877_245029_+	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004026604.1|245051_245507_+	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_004026607.1|245530_246571_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026609.1|246609_247188_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026611.1|247274_247850_+	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
WP_016947104.1|247934_249176_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
WP_004026615.1|249512_250160_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_042934775.1|250387_250717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016947103.1|250744_251134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279773.1|251254_252223_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
WP_166479931.1|252268_253024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060589129.1|253257_253989_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004181720.1|254248_254851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038992356.1|255843_257115_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_038992354.1|257297_257792_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	34.9	2.1e-17
WP_166479932.1|257901_258684_+	DNA repair protein	NA	NA	NA	NA	NA
WP_000654804.1|258701_259670_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_004026629.1|260188_260587_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001567369.1|261173_261806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|261834_263238_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_000343760.1|263413_264634_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_004883458.1|264768_265083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883454.1|265091_265601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071526709.1|265590_266031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883452.1|266060_266717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883447.1|267066_268023_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_004883444.1|268082_268424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883441.1|268437_268749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883438.1|268765_269494_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_004883436.1|269626_270241_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_071526708.1|270280_270517_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	85.5	7.1e-32
>prophage 5
NZ_CP050068	Klebsiella aerogenes strain 035 plasmid p35, complete sequence	397663	312954	342349	397663	transposase	Escherichia_phage(25.0%)	26	NA	NA
WP_062959135.1|312954_314244_+|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.2	4.7e-85
WP_001407551.1|314516_315533_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_166479935.1|315850_316273_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166479936.1|316376_316964_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_166479937.1|317077_317521_+	zinc-binding protein	NA	NA	NA	NA	NA
WP_166479944.1|317643_318252_+	LysE family translocator	NA	NA	NA	NA	NA
WP_166479938.1|318292_319114_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_166479939.1|319148_319550_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_166479940.1|319614_320295_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_166479945.1|320487_321258_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_104457020.1|321370_322598_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	3.5e-170
WP_009654824.1|322620_323757_+	hypothetical protein	NA	A0A2H4J138	uncultured_Caudovirales_phage	43.6	5.6e-74
WP_001567660.1|324223_325246_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016154439.1|325563_325893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000509966.1|329444_330050_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_009654924.1|330545_330812_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_032449369.1|330945_332139_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_009654921.1|332356_332986_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_009654925.1|332987_333992_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_009654922.1|334112_335015_-	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_020323220.1|335290_336766_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_004886861.1|336842_337124_-	peptidylprolyl isomerase PpiC	NA	NA	NA	NA	NA
WP_001067855.1|337883_338588_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072193945.1|338668_338932_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	43.4	2.0e-06
WP_032443218.1|340371_340581_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_085954962.1|341198_342349_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.6	9.8e-50
