The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050073	Enterobacter kobei strain 070 chromosome, complete genome	4921999	916862	956097	4921999	tail,integrase,holin,terminase	uncultured_Caudovirales_phage(30.0%)	43	919400:919420	956324:956344
WP_014882684.1|916862_917966_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	5.9e-60
WP_045281951.1|917977_919231_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	1.7e-92
919400:919420	attL	ACTCCTATTATCGGCACCATC	NA	NA	NA	NA
WP_166479158.1|919571_920744_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	50.0	5.4e-112
WP_024136027.1|920740_920917_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_166479159.1|920925_922335_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.3	2.6e-214
WP_166479160.1|922461_922764_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.1	1.2e-26
WP_166479161.1|922768_922957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023295974.1|922953_923169_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166479162.1|923179_923377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121527482.1|923373_923586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479163.1|923591_925652_-	DNA polymerase	NA	Q775A3	Bordetella_phage	68.0	3.9e-275
WP_111969787.1|925729_926278_-	DUF2815 family protein	NA	Q3LZQ2	Bacteriophage	57.4	4.2e-51
WP_166479164.1|926292_927594_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	57.3	6.1e-141
WP_166479165.1|927596_928520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479166.1|928516_928666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052895616.1|928790_929303_-	hypothetical protein	NA	C9EH97	Sodalis_phage	50.6	2.8e-41
WP_111969790.1|929797_930421_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	45.3	1.0e-37
WP_052895612.1|930541_930754_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	44.4	2.1e-06
WP_166479167.1|930757_932944_+	replication protein	NA	B6SCY1	Bacteriophage	70.3	9.5e-171
WP_166479168.1|933236_933506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479169.1|933518_933776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479170.1|934056_934497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015571350.1|934510_934741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479171.1|934744_936370_+|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	58.9	1.0e-169
WP_047359763.1|936366_936600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479172.1|936586_937423_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	44.6	1.8e-48
WP_166479173.1|937458_937623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479174.1|937837_938749_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	37.6	2.7e-42
WP_166479175.1|938806_939370_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	50.8	9.6e-51
WP_166479176.1|939371_941360_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.5	3.3e-186
WP_166479177.1|941361_941811_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	41.6	7.5e-22
WP_017384448.1|941813_942281_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	46.8	3.2e-07
WP_166479178.1|942283_944992_+	lytic transglycosylase domain-containing protein	NA	G9L6D3	Escherichia_phage	65.9	0.0e+00
WP_166479179.1|944991_947883_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	75.6	0.0e+00
WP_166479180.1|947947_948289_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	51.8	4.8e-21
WP_166479181.1|948285_949896_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	70.1	7.1e-224
WP_166479182.1|949916_952262_+	hypothetical protein	NA	T1S9Y2	Salmonella_phage	38.8	4.3e-36
WP_166479183.1|952291_953557_-	glucosyl transferase	NA	O22006	Shigella_phage	40.1	1.2e-80
WP_166479184.1|953558_954482_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.1	1.0e-158
WP_166479185.1|954478_954841_-	GtrA family protein	NA	U5P0S6	Shigella_phage	82.5	6.4e-48
WP_166479186.1|954990_955221_+|holin	holin	holin	A5LH82	Enterobacteria_phage	72.5	1.3e-22
WP_166479187.1|955201_955741_+	lysozyme	NA	H6WRZ4	Salmonella_phage	89.9	5.7e-93
WP_166479188.1|955737_956097_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	44.5	9.2e-15
956324:956344	attR	ACTCCTATTATCGGCACCATC	NA	NA	NA	NA
>prophage 2
NZ_CP050073	Enterobacter kobei strain 070 chromosome, complete genome	4921999	1142976	1192616	4921999	transposase,tail,head,holin	Salmonella_phage(40.3%)	79	NA	NA
WP_058655854.1|1142976_1143177_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	95.5	6.7e-31
WP_148400011.1|1143366_1143693_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	83.8	1.7e-44
WP_166479195.1|1143702_1143942_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	50.0	8.3e-12
WP_166479196.1|1144250_1144442_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	67.8	3.2e-14
WP_094935799.1|1144438_1144735_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	65.6	4.2e-29
WP_166479197.1|1144731_1144950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479198.1|1144946_1146077_-	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	47.6	1.2e-87
WP_045889100.1|1146073_1146226_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	42.3	8.1e-05
WP_045889101.1|1146222_1146651_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	92.3	2.0e-69
WP_166479199.1|1146647_1147265_-	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	57.3	3.6e-59
WP_063843726.1|1147261_1148008_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
WP_166479200.1|1148026_1148311_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	90.4	6.1e-46
WP_166479201.1|1148318_1149290_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	98.8	3.5e-85
WP_162269773.1|1149656_1149932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479202.1|1149961_1150231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479203.1|1150380_1151019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514161.1|1151076_1151289_-	hypothetical protein	NA	K7P7B4	Enterobacteria_phage	100.0	5.4e-31
WP_166479204.1|1151367_1151820_-	HNH endonuclease	NA	E5KJN9	Acinetobacter_phage	42.8	1.8e-23
WP_045286846.1|1152246_1152456_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	96.9	2.6e-25
WP_025760147.1|1152491_1152848_-	hypothetical protein	NA	G0ZNF1	Cronobacter_phage	90.7	7.7e-54
WP_023294194.1|1153125_1153488_-	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	49.5	1.1e-18
WP_063159765.1|1153700_1154360_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	66.0	1.8e-72
WP_022650973.1|1154468_1154687_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	47.0	1.9e-10
WP_063160545.1|1154725_1154947_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_072052368.1|1155029_1155239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052697489.1|1155207_1155918_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	58.0	2.2e-39
WP_166479205.1|1155914_1156694_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.0	8.0e-96
WP_023330689.1|1156690_1156990_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	53.7	2.2e-17
WP_166479206.1|1156986_1157184_+	hypothetical protein	NA	K7PKS4	Enterobacteria_phage	90.8	1.1e-25
WP_166479207.1|1157180_1157687_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	84.1	3.3e-50
WP_166479208.1|1157689_1157866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479132.1|1157876_1158644_+	hypothetical protein	NA	A0A1I9KFE6	Aeromonas_phage	78.0	5.4e-20
WP_163313499.1|1158830_1159280_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	46.5	7.2e-33
WP_166479209.1|1159272_1159443_+	NinE family protein	NA	G8C7V4	Escherichia_phage	87.5	9.0e-21
WP_166479210.1|1159439_1160108_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	94.1	1.7e-126
WP_047748520.1|1160100_1160385_+	hypothetical protein	NA	G8C7V5	Escherichia_phage	96.8	7.2e-47
WP_166479211.1|1160381_1160741_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	97.5	3.3e-65
WP_166479212.1|1160737_1160854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479213.1|1160853_1161663_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	97.8	2.1e-152
WP_089518920.1|1162112_1163259_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	7.8e-148
WP_166479214.1|1163290_1163914_+	hypothetical protein	NA	D2XJS0	Escherichia_phage	45.9	2.5e-47
WP_166479215.1|1164017_1164359_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	54.2	1.4e-28
WP_166479216.1|1164342_1164786_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	68.5	4.2e-49
WP_166479217.1|1164782_1165169_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	37.9	7.1e-13
WP_166479218.1|1165359_1165560_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	80.0	6.9e-20
WP_058683376.1|1165730_1165952_-	hypothetical protein	NA	Q38575	Escherichia_phage	76.7	6.7e-24
WP_166479219.1|1165979_1166198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479220.1|1166359_1166998_+	hypothetical protein	NA	I6S676	Salmonella_phage	90.1	5.9e-113
WP_166479221.1|1167030_1167510_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	86.5	5.7e-60
WP_166479222.1|1167496_1168975_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	87.4	6.9e-258
WP_166479223.1|1168990_1170343_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	82.9	5.8e-219
WP_121527568.1|1170296_1171226_+|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	82.2	6.5e-137
WP_166479224.1|1171229_1172495_+	hypothetical protein	NA	H6WRT2	Salmonella_phage	94.3	3.9e-225
WP_020838514.1|1172507_1172969_+	hypothetical protein	NA	G0ZND8	Cronobacter_phage	81.1	2.6e-62
WP_166479225.1|1172981_1174079_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	84.4	2.3e-181
WP_121527570.1|1174089_1174374_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	73.2	1.1e-31
WP_121527571.1|1174436_1174838_+	hypothetical protein	NA	I6S619	Salmonella_phage	78.9	4.9e-57
WP_020838521.1|1174837_1175017_+	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	89.8	2.6e-26
WP_166479226.1|1175009_1175372_+	hypothetical protein	NA	A0A1V0E5P3	Salmonella_phage	88.3	3.9e-61
WP_023205067.1|1175361_1175853_-	Pathogenesis-related transcriptional factor and ERF protein	NA	J7HXG5	Pseudomonas_phage	57.1	1.6e-46
WP_063153212.1|1175974_1176370_+	hypothetical protein	NA	I6RSK8	Salmonella_phage	96.2	1.5e-66
WP_047359535.1|1176366_1176753_+	hypothetical protein	NA	A0A1V0E5P4	Salmonella_phage	96.1	7.3e-66
WP_166479227.1|1176770_1177508_+	hypothetical protein	NA	H6WRU1	Salmonella_phage	85.4	1.5e-115
WP_166479228.1|1177545_1178199_+	hypothetical protein	NA	A0A1V0E5Q0	Salmonella_phage	90.8	2.7e-113
WP_064489268.1|1178400_1178964_+	DNA-binding protein	NA	E5AGA1	Erwinia_phage	70.1	1.1e-70
WP_048339233.1|1179354_1179555_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	98.5	7.6e-27
WP_023237752.1|1179624_1180008_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	55.4	2.8e-33
WP_166479229.1|1180074_1183335_+	tape measure protein	NA	A0A1V0E5N4	Salmonella_phage	29.2	3.0e-11
WP_166479230.1|1183373_1183664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045340953.1|1183705_1184053_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	96.5	1.1e-60
WP_158236498.1|1184074_1184230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100152985.1|1184208_1184406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121527578.1|1184571_1185276_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.9	7.9e-135
WP_166479472.1|1185275_1185995_+|tail	phage tail protein	tail	A0A1V0E5M9	Salmonella_phage	81.4	1.2e-119
WP_058679064.1|1185937_1186471_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	67.6	1.0e-54
WP_166479231.1|1186480_1190584_+|tail	phage tail protein	tail	H6WRW4	Salmonella_phage	86.6	0.0e+00
WP_166479232.1|1190648_1191947_+|tail	phage tail protein	tail	K7P6X7	Enterobacteria_phage	74.5	7.9e-165
WP_121527581.1|1192053_1192293_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	70.5	1.7e-25
WP_058655812.1|1192292_1192616_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.2	1.2e-24
>prophage 3
NZ_CP050073	Enterobacter kobei strain 070 chromosome, complete genome	4921999	1590111	1601393	4921999	protease	Vibrio_phage(33.33%)	7	NA	NA
WP_121527675.1|1590111_1592052_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	3.2e-37
WP_008499993.1|1592122_1592344_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_166479254.1|1592611_1592932_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	4.5e-13
WP_166479255.1|1592959_1595239_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	8.1e-165
WP_121527676.1|1595651_1596092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121527677.1|1597182_1598166_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YZM7	Vibrio_phage	36.3	1.6e-45
WP_121527678.1|1598162_1601393_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	27.2	2.3e-80
>prophage 4
NZ_CP050073	Enterobacter kobei strain 070 chromosome, complete genome	4921999	2786665	2888095	4921999	integrase,holin,protease,tail,terminase,capsid,transposase,head,coat,portal	Enterobacterial_phage(31.67%)	111	2846954:2847013	2888214:2888278
WP_121527990.1|2786665_2787628_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_108444027.1|2787624_2790009_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_014884347.1|2789984_2790743_-	molecular chaperone	NA	NA	NA	NA	NA
WP_032636170.1|2790759_2791308_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_014884349.1|2791320_2791893_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_014884350.1|2792322_2793582_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_014884351.1|2793685_2794189_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_014884353.1|2796249_2797179_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_008500417.1|2797175_2798063_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_014884354.1|2798186_2798765_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_078310272.1|2798767_2799127_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_014884355.1|2799912_2800341_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_014884356.1|2800357_2801782_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_014884357.1|2801756_2802560_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_014884358.1|2802736_2803717_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_014884359.1|2803731_2805246_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.5e-13
WP_008500409.1|2805317_2806307_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_014884361.1|2807096_2807600_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_014884362.1|2807754_2809098_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_014884363.1|2809140_2809392_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_014884364.1|2809500_2809584_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_014884365.1|2809821_2810160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884366.1|2810357_2810855_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_032636168.1|2810891_2811233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032665646.1|2812186_2814058_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_047358320.1|2814115_2814625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097466141.1|2814675_2815431_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_166479307.1|2815427_2818712_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.9	2.8e-65
WP_038416300.1|2820589_2821273_-	YecA family protein	NA	NA	NA	NA	NA
WP_166479308.1|2821269_2822499_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_166479309.1|2822488_2824012_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.7	5.4e-88
WP_032665655.1|2824318_2825494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479310.1|2825653_2826775_+|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	25.6	1.7e-14
WP_166479311.1|2826937_2827126_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166479312.1|2827157_2827760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479479.1|2828430_2830419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023314385.1|2830681_2831608_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	30.3	6.1e-34
WP_021536926.1|2831600_2832008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479313.1|2832000_2832888_+	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_021536924.1|2833058_2833520_+	hypothetical protein	NA	A0A0U2JTY1	Escherichia_phage	53.9	2.3e-42
WP_021536923.1|2833582_2833975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048206746.1|2834674_2835109_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_048206745.1|2835182_2835713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479480.1|2835738_2836053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048206744.1|2836470_2837688_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032425611.1|2837926_2838958_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_053072949.1|2839027_2839282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479314.1|2839293_2839932_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_048207192.1|2840368_2841169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479315.1|2842600_2843317_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_089518920.1|2843377_2844524_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	7.8e-148
WP_166479316.1|2844603_2845074_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_048206742.1|2845231_2845591_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	88.1	3.5e-54
WP_117261820.1|2845595_2845859_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	47.8	1.7e-13
WP_166479317.1|2845828_2846218_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	52.4	1.5e-31
2846954:2847013	attL	TTTTCCCATGGTAGCCGGAGTGGGACTTGAACCCACACAGCGCGAACGCCGAGGGATTTT	NA	NA	NA	NA
WP_063666318.1|2847189_2847510_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	83.0	3.3e-48
WP_166479318.1|2847509_2847749_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	92.3	5.7e-37
WP_166479319.1|2847848_2848115_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	92.0	8.9e-39
WP_166479320.1|2848157_2849489_-|tail	phage tail protein	tail	K7P6I4	Enterobacteria_phage	53.4	9.1e-116
WP_000440211.1|2853805_2854393_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	4.7e-48
WP_023296258.1|2854392_2855103_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	70.2	1.3e-97
WP_016240208.1|2855105_2855864_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	3.9e-95
WP_022648882.1|2855860_2856199_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_166479321.1|2856201_2859504_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	85.6	0.0e+00
WP_071785226.1|2859562_2859856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006809154.1|2859907_2860186_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	97.8	1.2e-43
WP_045357645.1|2860194_2860578_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	92.9	2.8e-62
WP_006809155.1|2860586_2861030_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_166479322.1|2861089_2861437_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	97.4	8.5e-58
WP_166479323.1|2861433_2861883_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.7	6.5e-74
WP_045626370.1|2861879_2862218_-|head	phage head closure protein	head	K7P7L2	Enterobacteria_phage	96.4	5.4e-57
WP_016063563.1|2862217_2862544_-|head,tail	head-tail connector I	head,tail	K7PGU9	Enterobacterial_phage	100.0	2.6e-56
WP_166479324.1|2862577_2863735_-|capsid	phage major capsid protein	capsid	Q77WA0	Escherichia_phage	98.2	1.6e-209
WP_016063561.1|2863737_2864415_-|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	100.0	2.4e-125
WP_032624427.1|2864432_2865707_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	99.8	1.9e-248
WP_015980155.1|2865706_2867221_-|terminase	terminase large subunit	terminase	Q9MCT1	Enterobacteria_phage	100.0	2.8e-294
WP_045133819.1|2867227_2867713_-	hypothetical protein	NA	K7PGU7	Enterobacterial_phage	97.5	3.8e-80
WP_166479325.1|2867862_2868063_-	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	55.7	9.7e-14
WP_166479326.1|2868062_2868404_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	98.2	3.3e-62
WP_116363837.1|2868400_2868991_-	hypothetical protein	NA	F1C588	Cronobacter_phage	88.8	4.3e-102
WP_166479327.1|2868972_2870430_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	90.7	6.4e-272
WP_166479481.1|2870441_2871089_-	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	77.3	1.6e-62
WP_166479328.1|2871456_2871792_-	hypothetical protein	NA	S4TTH3	Salmonella_phage	73.0	2.4e-41
WP_032636956.1|2871868_2872414_+	hypothetical protein	NA	S4TR57	Salmonella_phage	95.6	7.5e-93
WP_032636957.1|2872728_2873004_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	68.1	6.4e-24
WP_166479329.1|2873011_2873638_-	glycoside hydrolase family 19 protein	NA	K7PJS7	Enterobacterial_phage	91.3	3.6e-107
WP_022648766.1|2873637_2873919_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	4.1e-42
WP_022648767.1|2873905_2874301_-	phage membrane protein	NA	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
WP_166479330.1|2874883_2875462_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.2	5.6e-46
WP_166479331.1|2875475_2876465_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	94.2	1.2e-186
WP_023330784.1|2876472_2877267_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	61.4	1.1e-92
WP_045133830.1|2877337_2877745_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	86.9	9.1e-59
WP_045281484.1|2877741_2878062_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	59.4	1.4e-27
WP_166479482.1|2878058_2878718_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	76.3	7.5e-95
WP_166479332.1|2878717_2879212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479333.1|2879208_2880150_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	59.6	1.1e-30
WP_166479334.1|2880106_2880319_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	2.8e-11
WP_164845848.1|2880482_2881037_-	hypothetical protein	NA	S5FXP0	Shigella_phage	54.1	1.1e-46
WP_045357683.1|2881059_2881263_-	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	64.9	1.8e-15
WP_045357684.1|2881363_2881996_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP50	Morganella_phage	57.7	2.4e-50
WP_080471925.1|2882148_2882457_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	57.9	3.4e-10
WP_032622321.1|2882383_2882638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479335.1|2883007_2883262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479336.1|2883320_2883680_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	79.0	9.5e-44
WP_166479337.1|2883679_2884507_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	87.0	6.7e-125
WP_166479338.1|2884616_2885129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157845141.1|2885130_2885307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479339.1|2886152_2886488_+	hypothetical protein	NA	K7P7P8	Enterobacteria_phage	94.6	2.7e-53
WP_166479340.1|2886554_2886824_+	YeaH/YhbH family protein	NA	K7PKM4	Enterobacterial_phage	87.6	3.4e-38
WP_072050211.1|2886857_2887085_+	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	98.7	1.7e-38
WP_166479341.1|2887084_2888095_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	90.8	3.7e-178
2888214:2888278	attR	TTTTCCCATGGTAGCCGGAGTGGGACTTGAACCCACACAGCGCGAACGCCGAGGGATTTTAAATC	NA	NA	NA	NA
>prophage 5
NZ_CP050073	Enterobacter kobei strain 070 chromosome, complete genome	4921999	3060119	3066392	4921999		Enterobacteria_phage(50.0%)	6	NA	NA
WP_032636062.1|3060119_3060656_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	1.1e-51
WP_032636061.1|3060659_3061538_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_032636060.1|3061590_3062490_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.5	4.4e-29
WP_166479353.1|3062489_3063575_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	3.5e-97
WP_032636058.1|3063927_3064824_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	2.0e-42
WP_121528042.1|3065000_3066392_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	30.9	1.3e-19
>prophage 6
NZ_CP050073	Enterobacter kobei strain 070 chromosome, complete genome	4921999	3307042	3365077	4921999	transposase,integrase,protease,tRNA	Enterobacteria_phage(30.0%)	55	3331200:3331216	3351036:3351052
WP_014884669.1|3307042_3307855_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_023330985.1|3307854_3308868_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_166479367.1|3308935_3310072_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.6	2.0e-18
WP_014884672.1|3310185_3311190_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_014884673.1|3311274_3312453_-	MFS transporter	NA	NA	NA	NA	NA
WP_014884674.1|3312521_3313739_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_121528097.1|3313897_3315895_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_014884676.1|3315998_3316274_-	YfcL family protein	NA	NA	NA	NA	NA
WP_014884677.1|3316287_3316833_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_023330989.1|3316832_3317642_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_014884679.1|3317641_3318466_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_014884680.1|3318468_3319554_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	3.2e-87
WP_014884681.1|3319614_3320547_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_014884682.1|3320692_3321244_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_014884683.1|3321291_3321777_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_166479368.1|3321986_3324134_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_032635967.1|3324133_3325444_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_014884686.1|3325680_3325965_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_014884687.1|3326337_3327621_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_014884688.1|3327665_3328418_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_014884689.1|3328733_3329663_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	86.0	7.9e-143
3331200:3331216	attL	TTCGAGTTCGGCCTTCG	NA	NA	NA	NA
WP_070585259.1|3331411_3332662_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	38.8	5.6e-83
WP_070585257.1|3332773_3333583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001092369.1|3333749_3333956_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032723346.1|3333976_3334276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070585255.1|3334571_3335774_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_166479369.1|3335766_3337071_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_166479370.1|3337067_3338942_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001062154.1|3338956_3339343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479371.1|3339439_3339868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549554.1|3339958_3340660_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001549553.1|3340734_3340965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549552.1|3341019_3341337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154914723.1|3341356_3341743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064408310.1|3342273_3343428_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001549549.1|3343396_3343834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479372.1|3344100_3344277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097293566.1|3344278_3344731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077270097.1|3344796_3345390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070585007.1|3345382_3347635_-	N-6 DNA methylase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	21.7	2.5e-09
WP_070585008.1|3347688_3348711_-	DNA methyltransferase	NA	Q96718	Paramecium_bursaria_Chlorella_virus	27.7	6.7e-26
WP_070585010.1|3348950_3350045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070585011.1|3350129_3350843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007851504.1|3351167_3351458_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	93.2	2.2e-30
3351036:3351052	attR	TTCGAGTTCGGCCTTCG	NA	NA	NA	NA
WP_166479373.1|3351625_3352708_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	97.8	1.5e-188
WP_015386474.1|3352829_3355904_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|3355955_3357209_+	lactose permease	NA	NA	NA	NA	NA
WP_004118209.1|3358372_3358636_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015386469.1|3358650_3358914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|3359157_3359439_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152117.1|3359473_3360043_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|3360148_3362944_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|3362943_3363141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023312611.1|3363378_3364128_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|3364114_3365077_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP050073	Enterobacter kobei strain 070 chromosome, complete genome	4921999	3582732	3668781	4921999	holin,tRNA,protease,tail,terminase,capsid,transposase,portal,head	Enterobacteria_phage(35.85%)	93	NA	NA
WP_045268358.1|3582732_3583470_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_014884852.1|3583602_3584931_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	7.1e-44
WP_014884853.1|3584983_3585367_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	72.8	7.3e-34
WP_014884854.1|3585681_3586371_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	1.3e-54
WP_014884855.1|3586411_3587542_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_014884856.1|3587746_3588166_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	7.7e-13
WP_047344912.1|3588235_3588934_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023331102.1|3588969_3591633_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023331103.1|3591743_3593099_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_014884860.1|3593144_3593468_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_023331104.1|3593464_3594760_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.8e-44
WP_014884862.1|3600378_3602952_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.3e-128
WP_045135202.1|3603082_3603814_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_014884864.1|3603810_3604791_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_014884865.1|3604922_3605660_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_014884866.1|3605927_3606269_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100249759.1|3606373_3606421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121528150.1|3606528_3607689_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_121528151.1|3607685_3608558_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_023337646.1|3608618_3609740_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_014884870.1|3609750_3610821_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	9.0e-90
WP_121528152.1|3611035_3611410_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_045135207.1|3611503_3612100_+	YfiR family protein	NA	NA	NA	NA	NA
WP_121528153.1|3612092_3613313_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.9e-06
WP_014884874.1|3613325_3613811_+	OmpA family protein	NA	NA	NA	NA	NA
WP_121528154.1|3613813_3615184_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_014884876.1|3615222_3615627_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3615760_3616108_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_014884877.1|3616151_3616919_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003863136.1|3616950_3617490_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3617505_3617754_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_014884878.1|3617870_3619232_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_023308879.1|3619323_3620190_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032629440.1|3620208_3621495_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_014884881.1|3621546_3622140_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_008502500.1|3622262_3623141_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_014884882.1|3623226_3624888_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_014884883.1|3625026_3625365_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_023331115.1|3625469_3625757_-	RnfH family protein	NA	NA	NA	NA	NA
WP_023331116.1|3625746_3626223_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_008502505.1|3626340_3626823_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_166479388.1|3627547_3627814_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	95.5	2.8e-40
WP_166479389.1|3627909_3629241_-|tail	phage tail protein	tail	K7P6I4	Enterobacteria_phage	53.6	4.5e-115
WP_166479390.1|3629305_3633457_-|tail	phage tail protein	tail	Q9MCR7	Enterobacteria_phage	77.3	0.0e+00
WP_166479391.1|3633510_3634119_-|tail	tail assembly protein	tail	K7PM69	Enterobacteria_phage	97.0	9.9e-102
WP_166479392.1|3634169_3634622_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	41.2	9.9e-06
WP_166479393.1|3634696_3635407_-	peptidase P60	NA	K7PGV2	Enterobacterial_phage	96.2	7.9e-143
WP_166479394.1|3635408_3636167_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	98.8	5.7e-147
WP_000963855.1|3636163_3636502_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	100.0	6.6e-63
WP_166479395.1|3636504_3639843_-|tail	phage tail tape measure protein	tail	K7PH87	Enterobacterial_phage	68.4	0.0e+00
WP_166479396.1|3639877_3640141_-	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	97.7	5.5e-41
WP_001135721.1|3640164_3640566_-|tail	phage tail protein	tail	K7PGV0	Enterobacterial_phage	100.0	4.3e-69
WP_166479397.1|3640621_3641092_-|tail	phage tail protein	tail	K7PJR9	Enterobacterial_phage	96.8	3.7e-80
WP_166479398.1|3641145_3641493_-	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	98.3	6.5e-58
WP_047357535.1|3641489_3641939_-	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	98.7	4.5e-75
WP_045286830.1|3641935_3642274_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	8.6e-39
WP_045286829.1|3642283_3642610_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	96.3	4.9e-55
WP_097570890.1|3642609_3642858_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	84.8	8.3e-15
WP_112001051.1|3642897_3644109_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.2	3.4e-194
WP_045619490.1|3644118_3644967_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.5	1.1e-138
WP_059343121.1|3644980_3646285_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.8	2.1e-234
WP_166479399.1|3646284_3648021_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.3	0.0e+00
WP_113975614.1|3648020_3648518_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	86.7	3.8e-75
WP_080286624.1|3648673_3649210_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_032636954.1|3649338_3649695_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	77.2	5.3e-47
WP_166479484.1|3649694_3650498_-	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	56.2	1.9e-39
WP_032622824.1|3650898_3651348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479400.1|3652159_3652693_+|protease	Clp protease	protease	NA	NA	NA	NA
WP_089518920.1|3652737_3653884_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	7.8e-148
WP_117580503.1|3654156_3654432_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	64.4	1.5e-20
WP_114978170.1|3654428_3654971_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	72.6	3.4e-77
WP_065187067.1|3654970_3655252_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	1.7e-19
WP_001283165.1|3655238_3655625_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	93.8	7.3e-58
WP_045407358.1|3655769_3656690_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	72.9	1.7e-57
WP_166479401.1|3656801_3657638_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	81.1	3.3e-124
WP_166479402.1|3657665_3659045_-	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	68.8	4.7e-176
WP_166479403.1|3659041_3659923_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.3	4.8e-81
WP_166479404.1|3659938_3660850_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	63.6	5.9e-90
WP_058660279.1|3660846_3661143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058660280.1|3661168_3661426_-	hypothetical protein	NA	A0A0M3LQ90	Mannheimia_phage	47.9	9.9e-11
WP_111969765.1|3661533_3662202_+	hypothetical protein	NA	A0A2H4J176	uncultured_Caudovirales_phage	66.5	3.5e-68
WP_058660281.1|3662402_3662708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479405.1|3662773_3663163_+	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	58.8	4.9e-30
WP_110820593.1|3663278_3663482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058683782.1|3663462_3663873_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	88.3	1.2e-47
WP_166479406.1|3664062_3664470_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	48.6	2.5e-24
WP_048703183.1|3664469_3664664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479407.1|3664660_3665488_+	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	84.4	3.2e-111
WP_166479408.1|3665533_3666283_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	86.7	5.3e-121
WP_166479409.1|3666279_3666846_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	37.8	3.4e-27
WP_166479410.1|3666842_3667067_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	67.1	5.6e-18
WP_063846397.1|3667167_3667452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479411.1|3667605_3668781_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	94.6	2.3e-211
>prophage 8
NZ_CP050073	Enterobacter kobei strain 070 chromosome, complete genome	4921999	3986803	4041118	4921999	transposase,integrase,protease,tRNA	Clostridium_phage(33.33%)	48	3981211:3981226	4029977:4029992
3981211:3981226	attL	GAGCTGAACGTATTCC	NA	NA	NA	NA
WP_014885186.1|3986803_3987301_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_014885187.1|3987395_3988103_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_023331277.1|3988154_3988886_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_023331278.1|3988905_3989853_+	glutathione synthase	NA	NA	NA	NA	NA
WP_008499752.1|3989927_3990488_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_006811925.1|3990487_3990904_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_121528264.1|3990914_3991895_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_014885191.1|3991912_3992614_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014885192.1|3992635_3993202_+	YggT family protein	NA	NA	NA	NA	NA
WP_014885193.1|3993198_3993495_+	YggU family protein	NA	NA	NA	NA	NA
WP_023331280.1|3993498_3994092_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_121528265.1|3994084_3995227_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_023331282.1|3995290_3995629_+	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_014885197.1|3995710_3996427_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_014885198.1|3996484_3996811_-	YggL family protein	NA	NA	NA	NA	NA
WP_121528266.1|3996810_3997530_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_032664911.1|3997668_3998727_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003862425.1|3998753_3999026_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_032664912.1|3999150_4000227_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_014885202.1|4000496_4001753_+	nucleoside permease	NA	NA	NA	NA	NA
WP_023338783.1|4002614_4003154_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_166479426.1|4003156_4004674_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_047345185.1|4004684_4005560_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_014885207.1|4005556_4005850_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_014885208.1|4005866_4006889_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_045134818.1|4006899_4007763_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_014885210.1|4007780_4009142_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_047625990.1|4009489_4011115_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_023337769.1|4011104_4011797_+	response regulator	NA	NA	NA	NA	NA
WP_121528268.1|4011851_4013987_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_023331294.1|4014169_4014883_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_128339033.1|4015183_4016848_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_128339037.1|4016893_4017829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128339034.1|4018321_4018756_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_128339035.1|4019026_4019593_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	48.0	8.2e-34
WP_128339036.1|4019600_4020254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023331295.1|4020537_4020930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080865721.1|4021609_4022875_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	7.6e-80
WP_080865722.1|4023094_4023385_+	endonuclease	NA	NA	NA	NA	NA
WP_165770690.1|4023537_4024278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089518920.1|4024647_4025795_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	7.8e-148
WP_097595476.1|4026024_4026627_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_166479427.1|4026623_4027226_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_080865889.1|4027237_4030879_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
4029977:4029992	attR	GAGCTGAACGTATTCC	NA	NA	NA	NA
WP_097595463.1|4030924_4034533_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_080865884.1|4034709_4037307_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_001193073.1|4037317_4039402_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_097595465.1|4040086_4041118_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP050073	Enterobacter kobei strain 070 chromosome, complete genome	4921999	4319939	4424959	4921999	integrase,protease,tRNA,tail,terminase,capsid,portal,head	uncultured_Caudovirales_phage(37.5%)	94	4335388:4335403	4402272:4402287
WP_121527302.1|4319939_4322795_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	6.0e-141
WP_014885406.1|4322918_4323422_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_045134765.1|4323505_4324525_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	30.8	2.7e-43
WP_045134764.1|4324568_4326209_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_014885409.1|4326346_4327849_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	2.6e-82
WP_096059327.1|4327828_4328770_-	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_045268617.1|4329456_4333917_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_045134760.1|4333926_4335345_+	glutamate synthase subunit GltD	NA	NA	NA	NA	NA
4335388:4335403	attL	GGTTTACAGCCATTGA	NA	NA	NA	NA
WP_121527301.1|4335459_4336020_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_121527300.1|4336016_4338437_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_014885415.1|4338441_4339146_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_023337863.1|4339266_4339950_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_014885417.1|4340403_4340898_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	8.5e-27
WP_014885418.1|4340903_4341542_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_137984552.1|4341540_4341840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003860436.1|4341850_4342243_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003860434.1|4342258_4342687_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_014885419.1|4343017_4344142_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_028014591.1|4344331_4344730_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_023331415.1|4344900_4346268_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.8	6.0e-22
WP_014885421.1|4346360_4347428_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_014885422.1|4347518_4348457_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_008502836.1|4348854_4349325_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_014885423.1|4349700_4349964_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_121527299.1|4350075_4350342_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_014885425.1|4350409_4350682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023337864.1|4350726_4352181_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014885427.1|4352270_4354238_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_014885428.1|4354243_4355176_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003860416.1|4355183_4355387_-	AaeX family protein	NA	NA	NA	NA	NA
WP_121527298.1|4355566_4356493_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_121527297.1|4356544_4357990_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_121527296.1|4358074_4361872_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_014885432.1|4361914_4363384_-	ribonuclease G	NA	NA	NA	NA	NA
WP_121527295.1|4363373_4363967_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_008502849.1|4363977_4364466_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_008502850.1|4364465_4365482_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|4365543_4366587_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_121527294.1|4366869_4368810_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_023337867.1|4368992_4369967_+	oxidoreductase	NA	NA	NA	NA	NA
WP_023331424.1|4370044_4371046_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_014885437.1|4371046_4371646_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_023331425.1|4371880_4372333_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_010436174.1|4372354_4372816_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003860388.1|4372826_4374176_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_121527293.1|4374398_4376300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121527292.1|4376582_4378370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014885441.1|4378474_4378717_+	YhdT family protein	NA	NA	NA	NA	NA
WP_121527291.1|4378706_4380158_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_014885443.1|4380169_4381051_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_121527290.1|4381179_4381920_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_032635398.1|4382250_4383216_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4383239_4383536_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_166479437.1|4383884_4384235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479438.1|4384231_4384834_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	73.1	4.3e-73
WP_166479439.1|4384847_4386509_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_023326190.1|4386492_4386849_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	95.8	4.6e-59
WP_166479440.1|4386977_4387130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479441.1|4387122_4387566_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	89.8	5.2e-76
WP_166479442.1|4387565_4387859_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.4	4.7e-41
WP_023304516.1|4387851_4388190_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	48.6	5.1e-23
WP_134390526.1|4388186_4389422_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.8	1.9e-237
WP_000848270.1|4389423_4389984_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	7.7e-101
WP_166479443.1|4390035_4391202_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.2	1.3e-214
WP_166479444.1|4391435_4391699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479445.1|4391757_4392051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479446.1|4392345_4395036_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	40.0	1.9e-184
WP_019077818.1|4395032_4395287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019077819.1|4395276_4395483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063844866.1|4395479_4395674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479447.1|4395666_4396695_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_061351395.1|4396793_4397600_-	anti-repressor protein	NA	A0A0R6PJV6	Moraxella_phage	58.9	1.7e-24
WP_048210781.1|4397620_4397905_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_166479448.1|4397983_4398823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166479449.1|4398819_4400043_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	63.2	1.0e-153
WP_014885446.1|4400407_4400572_+	DUF2556 family protein	NA	NA	NA	NA	NA
WP_032635394.1|4400708_4402790_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	35.9	4.1e-22
4402272:4402287	attR	TCAATGGCTGTAAACC	NA	NA	NA	NA
WP_121527289.1|4402705_4403422_-	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_166479450.1|4403811_4404951_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_121527288.1|4404962_4408076_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_008502867.1|4408380_4408602_+	lipoprotein	NA	NA	NA	NA	NA
WP_014885451.1|4409076_4410102_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	40.3	1.2e-72
WP_121527287.1|4410169_4411351_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014885453.1|4411360_4412464_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014885454.1|4412471_4413230_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	1.5e-19
WP_050863156.1|4419033_4419588_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_047624748.1|4419563_4419812_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_014885457.1|4419808_4420627_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_023337875.1|4420631_4421204_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.1	2.4e-09
WP_023338824.1|4421196_4421751_-	DNA topoisomerase type IA Zn finger domain-containing protein	NA	NA	NA	NA	NA
WP_008503477.1|4421778_4422252_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_121527286.1|4422223_4423348_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_006812188.1|4423476_4423986_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	3.3e-18
WP_087529702.1|4424011_4424959_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.1	2.5e-06
>prophage 1
NZ_CP050074	Enterobacter kobei strain 070 plasmid p070, complete sequence	120547	1708	87019	120547	integrase,transposase	Escherichia_phage(26.09%)	54	NA	NA
WP_001515717.1|1708_2449_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_000227969.1|3404_4481_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189111.1|5022_6531_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_166479489.1|7796_8750_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	96.8	5.2e-174
WP_003100856.1|17966_18467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099531314.1|19387_19789_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|19785_20076_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_166479490.1|20208_20907_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	97.4	2.3e-134
WP_004357616.1|21115_21649_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166479491.1|22673_23033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004357657.1|23874_24057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479492.1|26334_27033_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.8e-131
WP_000074143.1|29671_29827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016247550.1|30017_30614_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	35.9	2.2e-21
WP_063942106.1|30777_31146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023234134.1|31462_32188_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_001067855.1|33242_33947_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_161958642.1|34291_35215_-	acyltransferase	NA	NA	NA	NA	NA
WP_114191444.1|35407_38464_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	1.1e-52
WP_016241530.1|38463_39549_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016241528.1|40073_40505_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	44.1	2.0e-24
WP_016241527.1|40555_43243_+	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.5	1.2e-71
WP_000509966.1|43632_44238_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_023307208.1|44332_47230_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_000948259.1|47654_48296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449980.1|48295_49234_-	MCE family protein	NA	NA	NA	NA	NA
WP_000254595.1|49235_50039_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
WP_001325018.1|50032_51178_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_166479493.1|52239_52518_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_166479494.1|53052_53220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166479495.1|53219_53585_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_151316193.1|54524_55229_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.6e-138
WP_166479496.1|57424_57643_-	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
WP_004099052.1|59259_61452_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_088903427.1|61581_62865_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_004197677.1|62954_64388_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_166479497.1|64406_66854_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	70.5	9.4e-26
WP_166479498.1|66958_68602_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.4	2.5e-22
WP_004181748.1|68957_69926_-|transposase	IS5-like element IS903 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.2	1.3e-180
WP_004197642.1|71827_72046_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_009309918.1|72047_72353_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_162898808.1|72581_72722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309920.1|72771_73107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309921.1|73140_74157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023287113.1|74354_75134_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_009310077.1|75191_75449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343462.1|75577_75691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072196505.1|76222_77191_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.9	4.5e-173
WP_166479499.1|77528_78224_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.1	5.1e-126
WP_166479500.1|78282_80109_+	N-6 DNA methylase	NA	A0A220A2U5	Liberibacter_phage	27.0	3.4e-20
WP_100229850.1|80105_81155_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	33.1	4.0e-34
WP_166479501.1|81151_82477_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_166479502.1|82473_85722_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_076611309.1|85714_87019_+|transposase	ISL3-like element ISSm4 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	31.0	7.2e-57
>prophage 2
NZ_CP050075	Enterobacter kobei strain 070 plasmid p070_A-KPC-2, complete sequence	109956	96927	98136	109956		Enterobacterial_phage(50.0%)	3	NA	NA
WP_071667453.1|96927_97236_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	42.9	4.5e-18
WP_058670716.1|97363_97570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071667454.1|97581_98136_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.8	3.3e-19
