The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050020	Burkholderia thailandensis strain BPM chromosome 1, complete sequence	3725540	93235	160322	3725540	transposase,integrase,tRNA,tail,protease	Vibrio_phage(16.67%)	60	80543:80570	95372:95399
80543:80570	attL	TCCAGACCTGCATCGTGCATCTGATCCG	NA	NA	NA	NA
WP_025369672.1|93235_94465_+|integrase	tyrosine-type recombinase/integrase	integrase	G9L697	Escherichia_phage	36.8	8.0e-66
WP_165981626.1|94638_95838_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	9.2e-43
95372:95399	attR	TCCAGACCTGCATCGTGCATCTGATCCG	NA	NA	NA	NA
WP_009908304.1|96513_97062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009908303.1|97304_98756_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	34.4	3.4e-31
WP_009908302.1|98771_100385_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_009908301.1|100534_101476_-	3-methyladenine DNA glycosylase 2	NA	NA	NA	NA	NA
WP_009908300.1|101472_102567_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	38.1	1.3e-19
WP_009908299.1|102969_103386_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_009908298.1|103513_104068_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_009902065.1|104288_104636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009908296.1|105121_105682_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_004524602.1|105841_106012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009902052.1|106355_106511_-	lipoprotein	NA	NA	NA	NA	NA
WP_009908295.1|106575_107736_-	DUF4382 domain-containing protein	NA	NA	NA	NA	NA
WP_009908294.1|108149_108374_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_165981627.1|108801_110001_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.2	3.5e-42
WP_165981513.1|110308_111721_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_009893635.1|111717_112308_+	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_009893633.1|112309_114718_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_009893632.1|114718_115405_+	response regulator	NA	NA	NA	NA	NA
WP_165981514.1|117474_120267_-	hypothetical protein	NA	K4NXL6	Burkholderia_phage	98.6	0.0e+00
WP_165981515.1|120278_120533_-	hypothetical protein	NA	A4JWQ9	Burkholderia_virus	97.6	2.9e-39
WP_004531070.1|120529_120889_-	hypothetical protein	NA	K4NXB4	Burkholderia_phage	100.0	1.1e-60
WP_165981516.1|121075_121435_+	hypothetical protein	NA	A4JWS0	Burkholderia_virus	99.2	3.1e-63
WP_015985032.1|121442_122540_-	phage late control D family protein	NA	A4JWS1	Burkholderia_virus	100.0	8.1e-203
WP_004552648.1|123543_123657_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	100.0	5.4e-14
WP_165981517.1|123677_123932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165981518.1|124671_125991_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_165981519.1|125987_127181_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	32.6	1.2e-31
WP_165981520.1|127193_128813_-	Alw26I/Eco31I/Esp3I family type II restriction adenine-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_059649961.1|128866_129163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893630.1|130235_130970_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	2.1e-50
WP_009893629.1|131067_131700_+	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	34.7	1.9e-07
WP_009893627.1|131719_132172_+	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.1	1.3e-13
WP_009893625.1|132517_133303_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_025369666.1|133299_134067_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_009893622.1|134184_135333_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_009893621.1|135344_137753_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_009893619.1|137916_138429_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_009893617.1|138425_139505_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189550.1|139624_140668_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_009893592.1|141033_141333_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_009893590.1|141459_142950_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_009893589.1|142952_144425_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_009893588.1|144551_145391_+	polyphosphate kinase	NA	NA	NA	NA	NA
WP_009893587.1|145422_146193_+	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	32.7	2.4e-28
WP_009893586.1|146333_147398_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	46.7	1.5e-81
WP_009893585.1|147616_148561_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_165981521.1|148788_149829_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_009893581.1|149818_151132_-	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_009893580.1|151143_151758_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_009893578.1|151754_152900_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_045599994.1|153205_153898_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_165981522.1|153864_154668_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_009893574.1|154664_155564_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_009893570.1|155889_156147_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_009893568.1|156164_157445_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_009893567.1|157464_158007_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_009902157.1|158432_159776_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.2	1.0e-37
WP_009893562.1|159785_160322_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP050020	Burkholderia thailandensis strain BPM chromosome 1, complete sequence	3725540	851056	861938	3725540	protease	Streptococcus_phage(16.67%)	9	NA	NA
WP_009892620.1|851056_853171_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	1.2e-56
WP_011401863.1|853434_853950_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	1.5e-13
WP_080511442.1|854145_854361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009892615.1|854621_855200_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_009892614.1|855464_856724_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	6.8e-12
WP_009892613.1|856885_858481_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004196460.1|858592_858796_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_009892611.1|859326_859641_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
WP_009892610.1|859637_861938_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	5.1e-167
>prophage 3
NZ_CP050020	Burkholderia thailandensis strain BPM chromosome 1, complete sequence	3725540	1386435	1464447	3725540	integrase,plate,transposase	Stx2-converting_phage(30.77%)	54	1381311:1381327	1449411:1449427
1381311:1381327	attL	CGCGGAGCCGGGCGGCG	NA	NA	NA	NA
WP_165981566.1|1386435_1387597_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	1.6e-84
WP_165981567.1|1387605_1387872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165981568.1|1387868_1388963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011402469.1|1390546_1390894_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009891843.1|1392237_1392495_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009891839.1|1392498_1392798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009891835.1|1392899_1393709_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_009891833.1|1393764_1394850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009891830.1|1394846_1395761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009891828.1|1395829_1396045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011402467.1|1396056_1397052_-	endonuclease	NA	A6XMH8	Bacillus_virus	39.5	1.3e-55
WP_009891822.1|1397121_1397322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009891820.1|1397318_1398287_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.0	3.1e-57
WP_059844718.1|1398390_1398618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165981569.1|1399545_1408989_+	contact-dependent inhibition toxin BcpA	NA	A0A0R6PJK4	Moraxella_phage	31.4	9.9e-31
WP_011402464.1|1408985_1409798_+	contact-dependent inhibition immunity protein BcpI	NA	NA	NA	NA	NA
WP_165981570.1|1409825_1410050_+	CDI system lipoprotein BcpO	NA	NA	NA	NA	NA
WP_165981571.1|1410074_1411811_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_009891812.1|1412235_1414590_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_009891810.1|1414586_1416506_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_009891806.1|1416676_1417147_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009891805.1|1417421_1418861_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_025369441.1|1419904_1420810_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	75.1	1.7e-129
WP_059844701.1|1420942_1422229_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	72.0	3.9e-172
WP_009891799.1|1422545_1422881_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009891798.1|1423184_1424663_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_009910381.1|1425423_1425642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009910382.1|1427134_1428985_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_043036944.1|1429013_1430441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009891791.1|1430464_1430731_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_025369438.1|1431256_1434055_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.1	1.5e-27
WP_009891787.1|1434057_1434891_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_165981629.1|1435027_1435585_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011402458.1|1435581_1436181_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_038712723.1|1436177_1438586_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_025369435.1|1438713_1439271_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011402455.1|1439267_1439867_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_165981572.1|1439863_1442266_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_009891777.1|1442374_1445710_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_009891776.1|1446661_1446994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011402452.1|1447011_1447317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025369432.1|1447329_1450158_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.1	2.6e-27
1449411:1449427	attR	CGCGGAGCCGGGCGGCG	NA	NA	NA	NA
WP_025369431.1|1450161_1451178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165981573.1|1451180_1454204_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004556892.1|1454640_1454934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080511660.1|1455876_1456569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009951519.1|1457141_1457309_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	50.0	9.5e-07
WP_009891747.1|1457523_1457799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080511659.1|1458064_1458511_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_009888727.1|1458695_1459103_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	38.2	3.1e-14
WP_009889515.1|1459099_1459447_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.0	2.1e-40
WP_009889500.1|1459476_1461048_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.8	6.7e-150
WP_156530037.1|1462138_1462909_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	1.4e-36
WP_165981574.1|1462923_1464447_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP050020	Burkholderia thailandensis strain BPM chromosome 1, complete sequence	3725540	2148483	2156208	3725540	transposase	Ralstonia_virus(33.33%)	11	NA	NA
WP_009890596.1|2148483_2149593_+	class II histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	32.7	1.2e-39
WP_009890595.1|2149796_2150420_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	32.6	6.3e-19
WP_011402264.1|2150657_2151119_-	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_009890590.1|2151322_2151781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009890589.1|2151796_2152198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009894408.1|2152259_2152685_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	4.9e-15
WP_025370026.1|2152684_2153191_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.1	1.0e-19
WP_009894404.1|2153183_2153657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891862.1|2153752_2155012_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	1.5e-43
WP_165981593.1|2155063_2155498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025369324.1|2155500_2156208_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	42.5	1.4e-35
>prophage 5
NZ_CP050020	Burkholderia thailandensis strain BPM chromosome 1, complete sequence	3725540	2654082	2662799	3725540		Acanthocystis_turfacea_chlorella_virus(16.67%)	8	NA	NA
WP_009908916.1|2654082_2654994_+	alpha/beta hydrolase	NA	A7K906	Acanthocystis_turfacea_chlorella_virus	24.6	4.2e-11
WP_009889864.1|2655329_2656253_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
WP_009889862.1|2656431_2657673_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_009904404.1|2657767_2658670_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	4.3e-53
WP_009889858.1|2659004_2659322_-	competence protein ComE	NA	NA	NA	NA	NA
WP_009908914.1|2659393_2660386_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_080511617.1|2660443_2661367_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.9	1.3e-15
WP_009908912.1|2661398_2662799_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.7	1.1e-79
>prophage 6
NZ_CP050020	Burkholderia thailandensis strain BPM chromosome 1, complete sequence	3725540	2770797	2777195	3725540	transposase	Stx2-converting_phage(33.33%)	8	NA	NA
WP_059844922.1|2770797_2771934_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.9	7.4e-42
WP_009889675.1|2771948_2772578_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.2	2.4e-26
WP_009889673.1|2772621_2773005_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.6	9.9e-07
WP_009889671.1|2773001_2773229_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_080713227.1|2773367_2773595_+	helicase	NA	NA	NA	NA	NA
WP_009891862.1|2774625_2775885_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	1.5e-43
WP_009888727.1|2776161_2776569_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	38.2	3.1e-14
WP_107645277.1|2776565_2777195_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	69.6	1.5e-31
>prophage 7
NZ_CP050020	Burkholderia thailandensis strain BPM chromosome 1, complete sequence	3725540	3010074	3019305	3725540		unidentified_phage(16.67%)	7	NA	NA
WP_009889266.1|3010074_3011619_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	3.3e-24
WP_009889265.1|3011654_3012182_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_009889263.1|3012178_3012862_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
WP_025369782.1|3012926_3013742_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	4.4e-36
WP_009889260.1|3013917_3015927_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.2	1.7e-52
WP_009889258.1|3015958_3017089_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.0	1.8e-24
WP_009889255.1|3017352_3019305_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.5	1.2e-148
>prophage 8
NZ_CP050020	Burkholderia thailandensis strain BPM chromosome 1, complete sequence	3725540	3304284	3355367	3725540	tRNA,protease,plate,transposase	Pseudomonas_phage(33.33%)	42	NA	NA
WP_009888666.1|3304284_3305583_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_009888664.1|3305651_3306734_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_009888662.1|3306759_3307617_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_009888661.1|3307696_3308005_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_009888659.1|3308018_3308615_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_009888656.1|3308870_3309659_+	dioxygenase	NA	NA	NA	NA	NA
WP_009888654.1|3309815_3311417_-	APC family permease	NA	NA	NA	NA	NA
WP_004196837.1|3311851_3312055_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	73.1	6.3e-21
WP_009888639.1|3312232_3313495_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_009888637.1|3313711_3314317_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_043036354.1|3314628_3315912_-	MFS transporter	NA	NA	NA	NA	NA
WP_009888634.1|3316070_3316718_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009888632.1|3317038_3317644_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_009888631.1|3317704_3318601_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_009888630.1|3318732_3319869_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_009888629.1|3320558_3321065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043288838.1|3321667_3323818_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	25.7	1.3e-47
WP_154659998.1|3324433_3324775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009888623.1|3324861_3325110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009888621.1|3325211_3325433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009888619.1|3326083_3327352_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_009888617.1|3327366_3329622_+	peptidase domain-containing ABC transporter	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	2.3e-10
WP_009888616.1|3329618_3331067_+	TolC family protein	NA	NA	NA	NA	NA
WP_009910677.1|3331263_3332229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025369750.1|3332354_3333206_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011402549.1|3333491_3337397_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009888606.1|3337393_3338383_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_009888604.1|3338387_3339323_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009888602.1|3339522_3340653_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_009910486.1|3340738_3343402_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.2	1.8e-91
WP_009888601.1|3343435_3344536_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009888599.1|3344499_3346338_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009888597.1|3346418_3346901_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_009906860.1|3346958_3347462_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_009888594.1|3347534_3349025_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009888592.1|3349041_3349560_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_043036367.1|3349596_3350286_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_025404121.1|3350659_3351274_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_009888581.1|3351382_3352729_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009888580.1|3352725_3353511_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_158338514.1|3354144_3354273_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_009909975.1|3354854_3355367_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.5	1.1e-21
>prophage 1
NZ_CP050021	Burkholderia thailandensis strain BPM chromosome 2, complete sequence	2875717	1675544	1686956	2875717	transposase	Stx2-converting_phage(37.5%)	12	NA	NA
WP_025370137.1|1675544_1676762_+	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	25.9	2.1e-26
WP_009891862.1|1677011_1678271_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	1.5e-43
WP_165981566.1|1678361_1679524_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	1.6e-84
WP_009888727.1|1679974_1680382_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	38.2	3.1e-14
WP_009889515.1|1680378_1680726_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.0	2.1e-40
WP_009889500.1|1680755_1682327_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.8	6.7e-150
WP_165981704.1|1682373_1683102_+	site-specific DNA-methyltransferase	NA	A0A2N9QVT4	Dishui_lake_phycodnavirus	25.7	9.3e-14
WP_165981705.1|1683136_1683661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165981706.1|1683757_1684297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165981707.1|1684431_1685016_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_165981708.1|1685066_1685603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009891862.1|1685696_1686956_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	1.5e-43
