The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046716	Escherichia coli strain T16R chromosome, complete genome	4639361	45508	56158	4639361	integrase	Enterobacteria_phage(100.0%)	12	45001:45023	56319:56341
45001:45023	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_152921169.1|45508_47842_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|47856_48177_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_152921170.1|48312_48768_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_001244670.1|48760_49048_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980227.1|49040_49640_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001149160.1|49636_49903_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283014.1|50454_51189_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	6.1e-130
WP_000984202.1|51185_51431_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
WP_023352767.1|51445_52018_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	98.9	5.3e-97
WP_001697486.1|52223_52877_-	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
WP_001697485.1|52878_54975_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001697482.1|54967_56158_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	85.0	1.8e-195
56319:56341	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP046716	Escherichia coli strain T16R chromosome, complete genome	4639361	244594	292298	4639361	transposase	Bacillus_phage(30.0%)	36	NA	NA
WP_000090707.1|244594_245437_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000351437.1|245423_247547_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049180.1|247546_248995_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|249035_250592_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000262423.1|250603_251530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|251882_252182_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001239419.1|252745_254572_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647571.1|254740_255091_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_000790485.1|255238_255670_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_165887128.1|255914_257396_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	29.7	3.3e-26
WP_000697968.1|257388_258069_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_100881939.1|258258_259644_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|259671_260025_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_001381488.1|260138_261431_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_020219104.1|261441_264588_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_000758229.1|264674_265115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072657383.1|267108_268026_+|transposase	IS5-like element ISEc35 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	3.3e-101
WP_000843494.1|268790_268988_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|269021_269759_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_001023257.1|270047_270497_-	copper resistance protein	NA	NA	NA	NA	NA
WP_165887129.1|270731_271079_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_000422741.1|271093_271519_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|271515_271866_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|271896_273510_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_001242438.1|275088_275985_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_020219105.1|276024_276405_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_000998778.1|276409_277339_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|277393_278074_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_000723069.1|279688_280123_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_001028905.1|280781_281834_-	DUF2776 domain-containing protein	NA	NA	NA	NA	NA
WP_000643701.1|282216_283824_+	YhiJ/YhiL family protein	NA	NA	NA	NA	NA
WP_001300550.1|284085_285708_+	YhiJ/YhiL family protein	NA	NA	NA	NA	NA
WP_000361491.1|286073_287141_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000149154.1|287137_289873_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
WP_001216257.1|289872_290997_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000420980.1|291161_292298_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP046716	Escherichia coli strain T16R chromosome, complete genome	4639361	1010101	1023284	4639361		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1010101_1010863_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1010856_1011483_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1011622_1012762_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1012824_1013817_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1013910_1015275_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1015363_1016140_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1016144_1016783_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1016779_1018042_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1018038_1018947_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1019142_1019910_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1019960_1020617_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_113402217.1|1020722_1023284_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 4
NZ_CP046716	Escherichia coli strain T16R chromosome, complete genome	4639361	1881319	1887359	4639361	transposase	Escherichia_phage(33.33%)	6	NA	NA
WP_072657387.1|1881319_1881874_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.0	1.9e-51
WP_072657386.1|1881888_1882779_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	4.8e-28
WP_072657385.1|1882810_1883680_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	5.2e-112
WP_072657384.1|1883694_1884759_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	1.3e-104
WP_000654804.1|1885294_1886263_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_072657383.1|1886441_1887359_+|transposase	IS5-like element ISEc35 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	3.3e-101
>prophage 5
NZ_CP046716	Escherichia coli strain T16R chromosome, complete genome	4639361	2199870	2265185	4639361	lysis,transposase,terminase,protease,portal,tail	Enterobacteria_phage(46.34%)	67	NA	NA
WP_000654804.1|2199870_2200839_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_005022848.1|2200913_2202182_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001118241.1|2202206_2203241_-	AI-2 transporter TqsA	NA	NA	NA	NA	NA
WP_000276149.1|2203652_2204018_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|2204004_2204334_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260865.1|2204372_2205194_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2205293_2205377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2205469_2205805_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2206201_2207455_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2207561_2208455_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2208589_2209810_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2209934_2210630_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2210582_2211875_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2212034_2212649_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|2212691_2213546_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2213547_2214165_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072643462.1|2214175_2216599_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	3.7e-208
WP_001300836.1|2219284_2219590_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2219697_2220408_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2220410_2220971_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2221005_2221347_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2221481_2221808_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2222013_2223228_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2223239_2224259_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2224316_2224427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087121889.1|2225704_2226866_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001019207.1|2227269_2227443_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|2227615_2227771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|2227918_2228107_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2228117_2228330_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071774.1|2228693_2229191_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_029364068.1|2229187_2229721_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	2.6e-98
WP_001013163.1|2229848_2230145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000165360.1|2230169_2230388_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.8	1.6e-17
WP_000839587.1|2230392_2230608_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_063501604.1|2230798_2231512_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063501605.1|2231918_2232878_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780584.1|2233070_2233595_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_077880228.1|2234443_2236381_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.5e-58
WP_000005552.1|2236453_2236705_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_113402261.1|2236724_2236847_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	86.2	1.7e-08
WP_087121889.1|2236860_2238023_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_072667107.1|2238107_2238272_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	98.1	1.2e-22
WP_023281932.1|2238280_2240380_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	97.1	0.0e+00
WP_001072975.1|2240376_2240589_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985944.1|2240588_2242097_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	100.0	1.6e-289
WP_077628251.1|2242041_2244069_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	100.0	0.0e+00
WP_001097051.1|2244155_2244479_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	2.5e-51
WP_001283153.1|2244471_2244747_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_063501731.1|2244758_2245337_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	3.0e-100
WP_001079419.1|2245333_2245735_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211096.1|2245745_2246489_+|tail	tail protein	tail	K7PGT7	Enterobacteria_phage	99.2	2.0e-133
WP_063501734.1|2246549_2246936_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	1.1e-61
WP_063501730.1|2246944_2247223_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	5.1e-45
WP_063501729.1|2247245_2250311_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.3	0.0e+00
WP_000447253.1|2250310_2250640_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_072666924.1|2250649_2251348_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.3e-133
WP_001399694.1|2251994_2252642_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_072666923.1|2252701_2256115_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.5	0.0e+00
WP_148245908.1|2256185_2256785_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	3.1e-108
WP_148245909.1|2256849_2260155_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	69.0	5.0e-280
WP_072144121.1|2260209_2260329_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	84.6	3.1e-12
WP_000086527.1|2260426_2261017_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2261333_2261567_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2261635_2261749_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2262352_2263636_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_063091469.1|2263724_2265185_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.1e-41
>prophage 6
NZ_CP046716	Escherichia coli strain T16R chromosome, complete genome	4639361	2679932	2686336	4639361	lysis,holin	Enterobacteria_phage(50.0%)	7	NA	NA
WP_112023872.1|2679932_2680256_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000539894.1|2680358_2680511_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.0	1.4e-20
WP_001291105.1|2682582_2683374_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|2683511_2684969_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2685165_2685351_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_032217964.1|2685567_2686044_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	1.7e-85
WP_000544528.1|2686030_2686336_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
>prophage 7
NZ_CP046716	Escherichia coli strain T16R chromosome, complete genome	4639361	2865261	2994658	4639361	integrase,head,capsid,lysis,terminase,transposase,holin,tRNA,protease,portal,tail,plate	Escherichia_phage(40.98%)	115	2877200:2877220	2981171:2981191
WP_000156518.1|2865261_2867022_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|2867090_2867609_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|2867678_2867846_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759120.1|2868101_2868665_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445533.1|2868661_2870302_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333176.1|2870306_2871560_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053099.1|2871689_2873597_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
WP_001086539.1|2873608_2875717_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000212426.1|2875960_2877070_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|2877066_2877609_-	cell division protein ZapC	NA	NA	NA	NA	NA
2877200:2877220	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_001295352.1|2877782_2878793_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001111465.1|2878903_2879641_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919497.1|2879606_2880122_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000730614.1|2880129_2880672_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165668.1|2880683_2881754_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000286312.1|2881744_2884345_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001295349.1|2884369_2885071_-	molecular chaperone	NA	NA	NA	NA	NA
WP_063501978.1|2885153_2885693_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001263933.1|2886048_2886624_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244308.1|2886616_2887576_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000056006.1|2887572_2888718_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235203.1|2888728_2889520_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090506.1|2889516_2890284_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193841.1|2890326_2892939_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001307697.1|2893204_2894407_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|2894575_2895976_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|2896578_2897667_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|2897851_2899042_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109486.1|2899263_2899911_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|2899937_2900486_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925985.1|2900666_2902514_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572637.1|2902774_2907235_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|2907234_2907939_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|2907919_2909242_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_094338093.1|2909238_2910024_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|2910159_2910939_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|2910915_2911809_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011603.1|2911962_2912709_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|2912705_2912888_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056538.1|2912939_2914172_-	winged helix DNA-binding protein YcaQ	NA	NA	NA	NA	NA
WP_000570539.1|2914208_2915195_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|2915191_2916940_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_113402192.1|2916976_2919241_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|2919448_2919733_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|2919892_2921566_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|2921676_2922360_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|2922532_2923297_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_113402193.1|2923465_2924749_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057138.1|2924819_2925908_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|2926106_2926799_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001295344.1|2926928_2928689_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|2929093_2929951_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|2930005_2932288_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|2932607_2932826_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_021560400.1|2932907_2934071_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	3.1e-205
WP_000978897.1|2934070_2934550_-|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
WP_126119221.1|2934564_2937012_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.4	0.0e+00
WP_000785970.1|2937004_2937124_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|2937156_2937432_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|2937488_2938007_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286743.1|2938019_2939210_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_040072566.1|2939600_2941187_+	hypothetical protein	NA	P79669	Escherichia_phage	99.8	6.4e-310
WP_112910907.1|2941587_2942115_-|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	95.4	2.3e-91
WP_130560175.1|2942118_2944128_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	98.1	0.0e+00
WP_001285314.1|2944138_2944669_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
WP_001121474.1|2944661_2945570_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_000127164.1|2945574_2945922_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_126119223.1|2945918_2946554_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	5.9e-113
WP_001001783.1|2946620_2947073_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	1.5e-75
WP_053285572.1|2947065_2947533_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.8	1.3e-80
WP_001440152.1|2947495_2947669_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_020240770.1|2947640_2948066_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	2.5e-67
WP_000736608.1|2948053_2948479_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001144101.1|2948493_2948991_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|2948990_2949272_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|2949275_2949479_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988636.1|2949478_2949988_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_016239051.1|2950087_2950831_-|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.6	1.2e-125
WP_001248583.1|2950834_2951908_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_001085948.1|2951966_2952821_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_112910896.1|2952994_2954767_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038190.1|2954766_2955801_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	1.4e-201
WP_077250684.1|2956412_2957381_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	2.5e-184
WP_097514442.1|2959002_2960250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130560176.1|2960452_2962573_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	96.9	0.0e+00
WP_000027667.1|2962562_2962838_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_112910914.1|2962834_2963059_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	3.2e-34
WP_001277957.1|2963058_2963361_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_000557703.1|2963360_2963585_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|2963648_2964149_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001005162.1|2964145_2964316_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000022051.1|2964326_2964683_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000072552.1|2964787_2965099_+	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000023395.1|2965192_2966188_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	100.0	7.1e-190
WP_000067979.1|2966219_2967017_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_001190363.1|2967098_2967689_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242684.1|2967788_2968697_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918506.1|2968697_2970128_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109295.1|2970337_2971486_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165879.1|2971799_2972426_+	hydrolase	NA	NA	NA	NA	NA
WP_000534637.1|2972460_2973324_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|2973325_2973943_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|2973953_2976398_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|2976636_2977929_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|2978019_2979363_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2979373_2979985_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077052.1|2980139_2984168_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
2981171:2981191	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_000228473.1|2984302_2984797_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|2985341_2986307_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043621.1|2986429_2988196_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202201.1|2988196_2989918_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001241677.1|2989959_2990664_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2990948_2991167_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934034.1|2992030_2994307_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
WP_113402194.1|2994337_2994658_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.3	1.3e-12
>prophage 8
NZ_CP046716	Escherichia coli strain T16R chromosome, complete genome	4639361	3565685	3656354	4639361	integrase,head,capsid,transposase,terminase,holin,protease,portal,tail,plate	Shigella_phage(40.98%)	95	3603322:3603377	3652443:3652498
WP_000131044.1|3565685_3567719_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3567847_3568435_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3568448_3569921_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3569934_3571605_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3571817_3572486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3572728_3573424_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3573416_3574844_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3574854_3575574_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3576100_3576955_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|3577180_3578506_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3578614_3578851_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3578862_3579456_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000662258.1|3586285_3586387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3586750_3587014_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3587013_3587154_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3587188_3587416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072657383.1|3587726_3588644_+|transposase	IS5-like element ISEc35 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	3.3e-101
WP_063501778.1|3589299_3589842_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3589916_3590504_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3590561_3591230_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_113402160.1|3591255_3593781_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3593770_3595414_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3595382_3596093_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3596405_3596735_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000070699.1|3598012_3598702_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643332.1|3598698_3599655_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_063501779.1|3599651_3601850_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.5	9.6e-38
WP_000121346.1|3601859_3602816_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3602794_3603205_+	hypothetical protein	NA	NA	NA	NA	NA
3603322:3603377	attL	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_052318513.1|3603724_3604999_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_000355479.1|3605598_3606372_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	3.2e-36
WP_001067855.1|3606902_3607607_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|3607992_3608409_+	fosfomycin resistance glutathione transferase FosA3	NA	NA	NA	NA	NA
WP_014839979.1|3608413_3608932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839978.1|3608931_3609720_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|3610058_3610763_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012372818.1|3610888_3611644_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|3611813_3612674_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|3613464_3614169_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_015387340.1|3614590_3615466_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_013023839.1|3615512_3615989_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001067855.1|3617040_3617745_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000383548.1|3618355_3618940_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_165887163.1|3618930_3619989_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.6	1.6e-200
WP_000424730.1|3619975_3620401_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	2.6e-80
WP_001259084.1|3620400_3620949_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000999511.1|3620948_3622028_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_088551947.1|3622024_3623353_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	1.6e-245
WP_000734912.1|3623463_3623910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165887164.1|3623942_3625775_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.2	3.3e-302
WP_000661050.1|3625916_3626186_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	1.0e-42
WP_000090997.1|3626185_3626542_-	hypothetical protein	NA	U5P076	Shigella_phage	99.2	9.0e-63
WP_165887165.1|3626541_3628038_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.0	4.5e-273
WP_000497751.1|3628021_3628192_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779297.1|3628200_3628761_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	97.8	4.4e-104
WP_000213502.1|3628757_3629264_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_165887166.1|3629238_3629649_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.5e-72
WP_000927711.1|3629645_3629969_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601366.1|3629971_3630172_-	hypothetical protein	NA	M1FN89	Enterobacteria_phage	98.5	4.5e-27
WP_089571379.1|3630221_3631427_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	1.8e-224
WP_001193631.1|3631441_3632092_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466250.1|3632069_3633311_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	2.6e-242
WP_000605613.1|3633310_3633493_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	96.7	1.1e-24
WP_122989116.1|3633504_3635001_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.0	2.4e-298
WP_047668526.1|3635234_3635729_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	98.8	4.3e-87
WP_001131133.1|3635854_3636205_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	93.1	1.4e-60
WP_001089763.1|3636355_3636691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000613842.1|3636791_3637361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165887167.1|3637524_3637917_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	66.2	7.2e-37
WP_027661775.1|3637900_3638377_-	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	96.2	2.3e-85
WP_027661774.1|3638380_3638716_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_000799659.1|3638793_3639846_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.1	6.8e-207
WP_000917724.1|3639996_3640200_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000357056.1|3640519_3641539_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
WP_080086273.1|3641553_3641934_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.1e-57
WP_023352842.1|3641948_3642938_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	1.2e-194
WP_024232546.1|3642945_3643743_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_100209684.1|3643762_3644152_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.1e-67
WP_001547992.1|3644148_3644475_-	LexA repressor	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	7.8e-53
WP_000066917.1|3644471_3645125_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001332382.1|3645124_3645619_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104954.1|3645615_3646557_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|3646546_3646726_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001560799.1|3646901_3647453_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.9	5.8e-101
WP_000649477.1|3647496_3647697_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3647787_3648462_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549626.1|3648696_3648903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3648874_3649309_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_032192508.1|3649853_3650390_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.3	6.3e-100
WP_001242717.1|3650380_3650743_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206810.1|3650742_3651048_+	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_000051887.1|3651274_3652438_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_063091315.1|3652642_3653896_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	7.5e-96
3652443:3652498	attR	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3653907_3655011_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3655298_3656354_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 1
NZ_CP046717	Escherichia coli strain T16R plasmid pT16R-1, complete sequence	190391	42418	74886	190391	transposase,integrase	Escherichia_phage(30.77%)	29	71887:71901	76727:76741
WP_001086279.1|42418_43600_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001324690.1|43814_44027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001356349.1|44333_44609_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	97.8	5.0e-45
WP_001119134.1|44527_45031_+|transposase	IS1 family transposase	transposase	U5P0U6	Shigella_phage	98.8	8.2e-94
WP_000807689.1|45612_46368_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
WP_001232452.1|47852_48926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005046357.1|49181_49670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341067.1|50337_50730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024156253.1|51066_51324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094323890.1|52443_53364_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_164538593.1|53374_54511_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_001120888.1|54849_56343_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_136655509.1|56704_58318_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	30.9	1.1e-30
WP_136655510.1|58365_58995_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	37.1	8.3e-19
WP_136655511.1|59217_59673_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072051933.1|59704_61051_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|61081_61966_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214121.1|62182_63397_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001255015.1|63424_63730_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|66568_67273_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001516695.1|67878_68535_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_072319970.1|68853_69270_-	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	44.0	1.4e-17
WP_001067858.1|69324_70029_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001235713.1|70754_71312_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|71494_72355_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
71887:71901	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
WP_000844102.1|72510_72708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|72769_73474_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_165887185.1|73520_73670_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|73872_74886_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
76727:76741	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
>prophage 1
NZ_CP046718	Escherichia coli strain T16R plasmid pT16R-2, complete sequence	172892	1262	65999	172892	bacteriocin,transposase,protease,integrase	Salmonella_phage(16.67%)	58	NA	NA
WP_001066954.1|1262_2003_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_014640565.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|2685_3594_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|3656_4766_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|5198_6152_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001332050.1|6255_6645_+|protease	outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|7424_7583_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000422741.1|8449_8875_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|8871_9222_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|9252_10866_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_165887191.1|10858_11362_+|transposase	IS1 family transposase	transposase	U5P0U6	Shigella_phage	99.4	2.6e-84
WP_072834405.1|11355_11637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339650.1|11777_13604_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001015823.1|13606_14092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072714138.1|14081_15182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165887186.1|15367_16336_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
WP_000450494.1|17103_18297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000738422.1|21382_21676_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|24821_25937_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_165887187.1|26076_29736_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.2e-45
WP_001552738.1|29839_31069_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271276.1|31153_32110_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_072657522.1|32154_34332_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_014640552.1|36148_36385_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|36848_37130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203272.1|37487_38015_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|38258_39074_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|39123_39477_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|39654_40446_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000796228.1|40442_41132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|41175_41526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343102.1|42096_42357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194555.1|42353_42944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142424.1|42961_43309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762580.1|43427_43775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283356.1|43792_45673_-	colicin	NA	NA	NA	NA	NA
WP_001132019.1|45951_47298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517689.1|47651_48254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442119.1|48309_48804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627831.1|48803_49070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031610367.1|49546_49963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138064.1|49971_52938_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_050491481.1|52940_53390_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	2.5e-49
WP_073520228.1|53414_54119_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.4e-138
WP_000454193.1|54454_54805_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|55007_56021_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|56178_56652_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|56782_57571_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|57776_58124_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|58117_58957_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|59084_59288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|59443_60649_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|60659_60965_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_165887188.1|61191_61956_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.2	2.1e-85
WP_001137892.1|62448_63033_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|63032_64271_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|64267_65173_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|65294_65999_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
