The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049353	Escherichia coli strain T28R chromosome, complete genome	4606706	1027922	1134320	4606706	head,tRNA,capsid,tail,terminase,portal,integrase,plate,lysis	Salmonella_phage(65.45%)	109	1065128:1065173	1095854:1095899
WP_000047184.1|1027922_1030553_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1030787_1030973_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273290.1|1032430_1032997_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287454.1|1032993_1033422_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|1033494_1035051_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130211.1|1035200_1035716_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1035779_1037318_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|1037334_1038507_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|1038633_1039164_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_048265082.1|1039134_1039236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119763.1|1039254_1039590_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445651.1|1039579_1040317_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000165699.1|1040440_1041625_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216521.1|1041916_1042909_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774988.1|1042966_1044031_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985494.1|1044023_1045226_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|1045579_1046539_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246527.1|1046548_1048693_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000080947.1|1048665_1049076_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|1049072_1049318_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|1049565_1049895_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1050046_1050391_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|1050427_1050877_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|1051544_1051949_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229442.1|1051995_1052520_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|1052529_1052829_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1053011_1053170_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522415.1|1053253_1053703_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|1053703_1054366_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001301367.1|1054386_1055787_-	GABA permease	NA	NA	NA	NA	NA
WP_001752988.1|1056024_1057305_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_000772831.1|1057318_1058767_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271951.1|1058789_1060058_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993126.1|1060077_1061055_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
1065128:1065173	attL	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001547641.1|1065290_1066316_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.3	1.4e-193
WP_023352525.1|1066317_1066950_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	90.5	6.9e-106
WP_000063849.1|1067069_1067318_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	71.6	3.4e-24
WP_023135813.1|1067350_1067860_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	95.9	7.8e-84
WP_000956182.1|1067867_1068068_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963473.1|1068031_1068373_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244230.1|1068440_1068674_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752613.1|1068673_1068901_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_165899005.1|1068897_1069755_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	93.7	1.3e-155
WP_021539286.1|1069751_1072145_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	92.3	0.0e+00
WP_001154443.1|1072306_1072495_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_001217561.1|1072506_1072740_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_021539285.1|1073127_1074168_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.4	4.5e-171
WP_001098431.1|1074167_1075934_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000216237.1|1076076_1076910_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742511.1|1076926_1077985_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059193.1|1077988_1078639_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	4.3e-111
WP_000673520.1|1078734_1079199_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000868175.1|1079198_1079402_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1079405_1079621_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_021539284.1|1079601_1080114_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	4.0e-88
WP_032252346.1|1080115_1080493_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	4.4e-15
WP_021539282.1|1080489_1080918_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	3.8e-47
WP_001039945.1|1081013_1081445_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_000829146.1|1081437_1081884_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_042096888.1|1081952_1082531_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	1.9e-94
WP_021539281.1|1082527_1082887_+	hypothetical protein	NA	A0A1S6KZZ4	Salmonella_phage	84.0	5.2e-50
WP_000268294.1|1082873_1083782_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_114505330.1|1083774_1084380_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	1.5e-110
WP_165899006.1|1084376_1085900_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.1	1.1e-194
WP_032176790.1|1085899_1086493_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	57.7	2.4e-52
WP_000905027.1|1087388_1087955_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_001522722.1|1088097_1089270_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_001207660.1|1089279_1089795_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|1089849_1090152_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1090166_1090286_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_004015225.1|1090278_1093356_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980413.1|1093352_1093838_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_165899007.1|1093834_1094935_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.3e-176
WP_000980501.1|1095003_1095222_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_048231062.1|1095248_1095731_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	33.7	6.0e-17
WP_000162574.1|1096431_1096914_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1095854:1095899	attR	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600189.1|1097045_1097522_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1097511_1097802_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1097863_1098205_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1098353_1100015_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1100100_1100979_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1101101_1101695_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1101749_1103036_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001189257.1|1103056_1103923_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1104014_1105376_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1105624_1105873_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1105891_1106440_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1106470_1107238_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1107279_1107627_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589847.1|1107702_1108185_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|1108200_1109427_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1109416_1109935_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1110084_1110450_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168037.1|1110659_1111730_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|1111740_1112862_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200099.1|1112904_1114065_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010723158.1|1114163_1114211_-	phe operon leader peptide	NA	NA	NA	NA	NA
WP_000178456.1|1114314_1114656_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1114926_1115664_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079100.1|1115798_1116779_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_001752929.1|1116775_1117507_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1117636_1120210_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|1126064_1127363_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_000464877.1|1127359_1127704_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1127728_1129084_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_033801372.1|1129197_1131858_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_053270338.1|1131901_1132588_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1132656_1133076_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1133282_1134320_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP049353	Escherichia coli strain T28R chromosome, complete genome	4606706	1376030	1419680	4606706	head,holin,tail,capsid,protease,terminase,integrase,lysis	Salmonella_phage(38.33%)	67	1375941:1375957	1418596:1418612
1375941:1375957	attL	GATGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_001163428.1|1376030_1376231_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001277767.1|1376362_1376542_-	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_073456042.1|1376638_1377268_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.3	5.5e-55
WP_104769644.1|1377269_1377821_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	80.7	6.1e-58
WP_087613738.1|1377817_1377985_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	2.8e-22
WP_000855558.1|1377981_1378272_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	100.0	3.7e-46
WP_016063329.1|1378282_1378576_-	DUF2856 family protein	NA	K7P845	Enterobacteria_phage	100.0	8.5e-51
WP_089075571.1|1379078_1379552_-	single-stranded DNA-binding protein	NA	Q716E8	Shigella_phage	98.1	2.3e-58
WP_000365280.1|1379552_1380260_-	recombinase	NA	K7PKU3	Enterobacteria_phage	100.0	7.6e-138
WP_000613346.1|1380268_1380457_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000361831.1|1380453_1380567_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_016246170.1|1380559_1380706_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A2D1GLZ1	Escherichia_phage	100.0	3.8e-20
WP_000005785.1|1380730_1381699_-	hypothetical protein	NA	G5DA88	Enterobacteria_phage	100.0	7.7e-56
WP_165899010.1|1381841_1382312_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.1	3.5e-86
WP_165899011.1|1382513_1382669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088201.1|1382602_1382875_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_024250699.1|1383346_1384339_-	SppA protein	NA	NA	NA	NA	NA
WP_000428098.1|1384514_1385219_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064149.1|1385332_1385566_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	98.7	2.3e-35
WP_165899012.1|1385704_1386004_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	6.9e-48
WP_063101521.1|1386026_1386299_+	hypothetical protein	NA	G9L679	Escherichia_phage	96.7	7.4e-41
WP_001579631.1|1386361_1387249_+	phage replication protein	NA	A5VW95	Enterobacteria_phage	99.3	3.1e-144
WP_165899013.1|1387245_1388622_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	3.1e-252
WP_000736913.1|1388695_1389136_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000611491.1|1389132_1390005_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000984218.1|1390001_1390175_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113771.1|1390141_1390324_+	NinE family protein	NA	Q716C5	Shigella_phage	98.3	4.8e-28
WP_000567006.1|1390320_1390491_+	protein ninF	NA	A0A2I6PIG4	Escherichia_phage	96.4	6.1e-25
WP_001003989.1|1390483_1391206_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_001008194.1|1391492_1391855_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	99.2	2.7e-62
WP_165899014.1|1391851_1392040_+	protein ninH	NA	K7PH29	Enterobacteria_phage	96.8	2.7e-26
WP_001235461.1|1392036_1392660_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|1393093_1393417_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229386.1|1393400_1393877_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	3.2e-87
WP_165899015.1|1393873_1394311_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	5.5e-70
WP_000877024.1|1394515_1395046_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	95.5	3.4e-90
WP_000969108.1|1395152_1395359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001472362.1|1395536_1396151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218996.1|1396104_1396656_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	70.3	1.9e-67
WP_165899016.1|1396658_1398281_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	96.1	0.0e+00
WP_148116393.1|1398280_1399750_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.5	1.1e-268
WP_130563077.1|1399634_1400372_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.0	3.0e-108
WP_165899017.1|1400386_1401607_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.0	5.3e-203
WP_001066731.1|1401610_1402117_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	1.7e-70
WP_001473318.1|1402128_1403070_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	1.4e-155
WP_165899053.1|1403066_1403300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023565719.1|1403298_1403706_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.0	3.5e-71
WP_165899018.1|1403702_1404257_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.8	7.9e-82
WP_097495130.1|1404243_1404633_+|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	95.3	2.5e-66
WP_089075579.1|1404607_1405171_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	3.8e-79
WP_072651494.1|1405174_1406320_+	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	1.4e-160
WP_000109249.1|1406330_1406771_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_023565715.1|1406774_1407227_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_165899019.1|1407404_1409393_+	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.2	3.3e-271
WP_001420197.1|1409392_1409980_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_000155119.1|1409979_1410282_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_034169224.1|1410284_1411349_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	82.0	5.0e-157
WP_165899020.1|1411348_1411681_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.0	2.9e-23
WP_000050470.1|1411830_1412562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000110002.1|1412561_1412990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000301074.1|1413054_1413807_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.3	2.2e-87
WP_001270636.1|1413806_1414160_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	2.0e-54
WP_001197068.1|1414159_1415359_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.6	2.2e-185
WP_000049948.1|1415355_1416036_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.3	4.5e-103
WP_165899021.1|1416750_1417191_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	63.3	3.2e-49
WP_000958671.1|1417278_1418436_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_072657475.1|1418747_1419680_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	5.1e-166
1418596:1418612	attR	GATGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 3
NZ_CP049353	Escherichia coli strain T28R chromosome, complete genome	4606706	1664676	1674117	4606706		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569316.1|1664676_1665603_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1665607_1666339_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1666319_1666427_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1666486_1667218_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1667439_1669125_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1669121_1669841_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1669887_1670358_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1670397_1670859_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001375261.1|1670983_1672984_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001333512.1|1672980_1674117_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
NZ_CP049353	Escherichia coli strain T28R chromosome, complete genome	4606706	1769973	1778005	4606706		Enterobacteria_phage(33.33%)	8	NA	NA
WP_053276396.1|1769973_1771368_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
WP_000999466.1|1771525_1772521_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_053276397.1|1772752_1773646_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.7	4.3e-45
WP_053276398.1|1774017_1775094_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.5e-102
WP_032318852.1|1775090_1775963_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	6.4e-110
WP_053276399.1|1775955_1776363_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_089565361.1|1776355_1776889_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032318850.1|1776901_1778005_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.2	1.5e-39
>prophage 5
NZ_CP049353	Escherichia coli strain T28R chromosome, complete genome	4606706	2078039	2125531	4606706	head,holin,tail,tRNA,capsid,terminase,portal,integrase,plate	Enterobacteria_phage(74.47%)	61	2085375:2085399	2123105:2123129
WP_001144190.1|2078039_2079968_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
WP_001700733.1|2079971_2080514_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2080610_2080808_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2080860_2081217_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2081339_2081384_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|2081667_2082651_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672380.1|2082665_2085053_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2085057_2085357_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2085375:2085399	attL	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_000078916.1|2085658_2085799_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488099.1|2085989_2086250_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000965749.1|2086569_2087652_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000132828.1|2087743_2088853_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	3.7e-195
WP_112020057.1|2089010_2090195_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	1.4e-224
WP_000290450.1|2090194_2090707_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_001756478.1|2090761_2091127_+|tail	phage tail protein E	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	2.2e-56
WP_000333495.1|2091135_2091291_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_165899025.1|2091277_2094085_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.1	0.0e+00
WP_000979945.1|2094097_2094586_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905053.1|2094619_2095207_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	99.5	7.1e-105
WP_165899026.1|2095332_2096175_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	59.9	2.2e-38
WP_024227096.1|2096176_2096704_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	84.6	1.4e-80
WP_165899027.1|2096732_2097266_-|tail	tail fiber assembly protein	tail	A0A222YXY8	Escherichia_phage	97.7	2.7e-95
WP_165899028.1|2097268_2099365_-|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	59.1	1.6e-199
WP_053897037.1|2099367_2099898_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	5.6e-93
WP_001694968.1|2099890_2100787_-|plate	baseplate J-like family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213447.1|2100790_2101141_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271925.1|2101137_2101719_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.1e-102
WP_000356339.1|2101715_2102351_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920594.1|2102343_2102811_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780549.1|2102948_2103356_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	4.6e-63
WP_165899029.1|2103352_2103745_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_000104350.1|2103741_2104065_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|2104067_2104268_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|2104267_2104762_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632347.1|2104863_2105664_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	1.6e-131
WP_001055119.1|2105709_2106762_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
WP_001262673.1|2106784_2107621_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_165899030.1|2107775_2109527_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.5	0.0e+00
WP_000087812.1|2109526_2110573_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000885992.1|2111109_2112309_+	hypothetical protein	NA	A0A0P0IKU8	Acinetobacter_phage	33.2	1.8e-54
WP_000279222.1|2112311_2112830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211252.1|2112960_2113272_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	91.3	1.5e-45
WP_137529493.1|2113276_2114236_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.7e-180
WP_165899031.1|2114312_2117153_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.4	0.0e+00
WP_000564228.1|2117149_2117539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122985482.1|2117535_2118153_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000153700.1|2118461_2118728_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985163.1|2118724_2118928_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	1.9e-25
WP_001092663.1|2118951_2119368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021654.1|2119460_2119574_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000514277.1|2119570_2119813_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159462.1|2119824_2120103_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000917809.1|2120113_2120452_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	2.3e-52
WP_001151410.1|2120466_2120745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000904674.1|2120841_2121150_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	52.1	8.7e-22
WP_097474496.1|2121238_2122177_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	3.0e-81
WP_033809090.1|2122209_2122542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997174.1|2122649_2122979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956529.1|2123187_2124168_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2123105:2123129	attR	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_001154183.1|2124230_2124782_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_001752566.1|2124781_2125531_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
>prophage 6
NZ_CP049353	Escherichia coli strain T28R chromosome, complete genome	4606706	2367141	2457904	4606706	transposase	Salmonella_phage(26.32%)	63	NA	NA
WP_001752488.1|2367141_2368278_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_108933438.1|2368979_2369677_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	92.7	3.3e-125
WP_000148192.1|2369853_2370351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076751473.1|2371494_2374353_-	helicase	NA	Q1MVN7	Enterobacteria_phage	98.4	0.0e+00
WP_001352029.1|2374711_2374879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139206.1|2374965_2375217_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000222771.1|2375213_2375501_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	4.5e-20
WP_000896262.1|2375790_2375991_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_165899034.1|2376360_2379876_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.1	2.7e-98
WP_001189111.1|2382048_2383557_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_085947771.1|2385090_2386253_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_165899035.1|2387493_2390967_-	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_001351999.1|2394095_2396246_-	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_001352000.1|2396309_2398415_-	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_165899036.1|2399239_2400415_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_165899037.1|2403292_2407516_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_000103220.1|2407582_2409691_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	5.6e-27
WP_050559578.1|2410511_2410757_-	YncH family protein	NA	NA	NA	NA	NA
WP_001752483.1|2410800_2411418_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_001491068.1|2411683_2413183_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_001752482.1|2413295_2414357_-	YncE family protein	NA	NA	NA	NA	NA
WP_097302049.1|2414598_2416701_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
WP_001752480.1|2416736_2417402_-	DNA-binding transcriptional regulator McbR	NA	NA	NA	NA	NA
WP_000531453.1|2417599_2418637_-	NADPH-dependent curcumin/dihydrocurcumin reductase	NA	NA	NA	NA	NA
WP_001351727.1|2418816_2419335_+	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
WP_001076535.1|2419331_2419781_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000018633.1|2419781_2420015_-	YdcY family protein	NA	NA	NA	NA	NA
WP_000061178.1|2420100_2420274_-	orphan toxin OrtT	NA	NA	NA	NA	NA
WP_001303494.1|2420468_2420564_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_001163875.1|2420660_2422085_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_152927295.1|2422106_2422901_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_001251313.1|2422890_2423832_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000220399.1|2423832_2424846_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	55.4	1.1e-25
WP_000047424.1|2424863_2426009_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760626.1|2426253_2427660_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|2427738_2428155_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|2428200_2428377_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|2428598_2428829_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001752477.1|2428920_2430882_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.6	1.6e-23
WP_000429141.1|2430954_2431491_-	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_071531711.1|2431543_2432773_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000826407.1|2432812_2434021_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.3e-206
WP_001261013.1|2434547_2435216_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_001723473.1|2435518_2436112_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001296725.1|2436108_2437101_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_021546897.1|2437224_2438205_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_001491065.1|2438196_2438736_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2438798_2439023_-	YdcH family protein	NA	NA	NA	NA	NA
WP_064759437.1|2439161_2440817_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001752472.1|2441041_2442385_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|2442601_2443525_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351729.1|2445909_2446302_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|2446439_2447324_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|2447355_2448555_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|2448660_2449311_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|2449342_2449585_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001138014.1|2449642_2452609_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|2452612_2453173_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323888.1|2453161_2453329_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001323889.1|2453482_2455060_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001309484.1|2456734_2456884_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2456955_2457129_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2457373_2457904_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 7
NZ_CP049353	Escherichia coli strain T28R chromosome, complete genome	4606706	3068160	3112845	4606706	transposase,tail,coat,terminase,integrase,lysis	Enterobacteria_phage(38.89%)	45	3070076:3070090	3112919:3112933
WP_001389241.1|3068160_3069450_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
WP_000767389.1|3069508_3069985_+	kinase inhibitor	NA	NA	NA	NA	NA
3070076:3070090	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001468417.1|3070730_3072062_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
WP_001171282.1|3072566_3073529_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
WP_001164109.1|3073532_3074060_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	97.1	8.1e-92
WP_152927213.1|3074088_3074622_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	2.4e-96
WP_089624975.1|3074624_3077462_-|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	60.6	1.0e-204
WP_001752322.1|3077526_3078126_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	4.4e-110
WP_152927214.1|3078195_3081609_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_072158278.1|3081669_3082317_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	1.2e-108
WP_001396591.1|3082214_3082958_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.2e-146
WP_001152432.1|3082963_3083662_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|3083661_3084000_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_032139919.1|3088168_3088369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122452218.1|3088476_3088836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328756.1|3088986_3089949_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
WP_021546825.1|3089975_3090368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|3090364_3090745_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_001547052.1|3090745_3091129_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	38.6	1.1e-13
WP_000634214.1|3091128_3091524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908084.1|3091527_3091704_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_152927215.1|3091746_3092886_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.3	1.1e-159
WP_000770037.1|3092984_3093749_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
WP_001469192.1|3093853_3094966_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	54.8	2.7e-113
WP_021546823.1|3094949_3096356_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	6.1e-187
WP_021546822.1|3096358_3097660_-	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	60.3	9.4e-150
WP_001547055.1|3097640_3098735_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.8	3.1e-114
WP_000126790.1|3098738_3098948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752317.1|3099206_3099857_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	52.4	2.2e-59
WP_001752316.1|3099849_3100638_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.9	9.7e-49
WP_001393986.1|3100775_3102233_-	trk system potassium uptake protein trkG	NA	NA	NA	NA	NA
WP_001228696.1|3102429_3102615_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_152927216.1|3102891_3103320_-	glycoside hydrolase family protein	NA	A0A0N7KZA0	Stx2-converting_phage	94.3	8.9e-73
WP_085947771.1|3103369_3104531_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000839596.1|3104589_3104805_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001146308.1|3104992_3105724_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592543.1|3106075_3107035_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3107227_3107752_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3107907_3108285_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971055.1|3108370_3108511_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3108507_3108870_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_085959875.1|3110024_3111253_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.3e-172
WP_000545741.1|3111371_3111539_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|3111578_3111797_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3111774_3112845_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3112919:3112933	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 8
NZ_CP049353	Escherichia coli strain T28R chromosome, complete genome	4606706	3566739	3618768	4606706	transposase,tail,holin,integrase	Enterobacteria_phage(53.85%)	44	3578120:3578134	3618028:3618042
WP_000131044.1|3566739_3568773_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3568901_3569489_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3569502_3570975_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3570988_3572659_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3572871_3573540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023927.1|3574470_3575898_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3575908_3576628_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3577154_3578009_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
3578120:3578134	attL	AAAAAGAAAATATCA	NA	NA	NA	NA
WP_001046306.1|3578234_3579560_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000474084.1|3579668_3579905_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|3579916_3580510_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_085959875.1|3581720_3582949_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.3e-172
WP_000020219.1|3583427_3587684_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3588798_3588900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001752157.1|3589263_3589527_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3589526_3589667_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3589701_3589929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752155.1|3590751_3591294_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3591368_3591956_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3592013_3592682_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3592707_3595233_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001350485.1|3596834_3597545_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3597857_3598187_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3598434_3599049_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3599466_3600156_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643332.1|3600152_3601109_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667036.1|3601105_3603304_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.3e-38
WP_001752149.1|3603313_3604270_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3604248_3604659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110216236.1|3605216_3606287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152927292.1|3606572_3608906_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	81.7	0.0e+00
WP_014837515.1|3608917_3609238_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|3609234_3609462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114265317.1|3609458_3610010_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	72.2	5.6e-35
WP_015585920.1|3610006_3610273_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.3e-29
WP_114265318.1|3610812_3611550_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.8	4.5e-72
WP_004136116.1|3611546_3611792_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_152927291.1|3611809_3612376_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	1.9e-59
WP_165899055.1|3612447_3612597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048981219.1|3612906_3613560_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_048981221.1|3613552_3614800_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_064178924.1|3614800_3615979_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.6	4.5e-143
WP_024046444.1|3616279_3617353_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.0	1.9e-47
WP_024046445.1|3617370_3618768_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
3618028:3618042	attR	AAAAAGAAAATATCA	NA	NA	NA	NA
>prophage 1
NZ_CP049354	Escherichia coli strain T28R plasmid pT28R-1, complete sequence	193098	42418	126433	193098	integrase,transposase	Escherichia_phage(18.18%)	76	40717:40733	84996:85012
40717:40733	attL	AAAAAGTTACTTTTGCC	NA	NA	NA	NA
WP_001086279.1|42418_43600_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001324690.1|43814_44027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001356349.1|44333_44609_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	97.8	5.0e-45
WP_001119134.1|44527_45031_+|transposase	IS1 family transposase	transposase	U5P0U6	Shigella_phage	98.8	8.2e-94
WP_000807689.1|45612_46368_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
WP_001232452.1|47852_48926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005046357.1|49181_49670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341067.1|50337_50730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024156253.1|51066_51324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094323890.1|52443_53364_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_164538593.1|53374_54511_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_001120888.1|54849_56343_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_136655509.1|56704_58318_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	30.9	1.1e-30
WP_136655510.1|58365_58995_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	37.1	8.3e-19
WP_136655511.1|59217_59673_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072051933.1|59704_61051_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|61081_61966_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|62182_63397_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|63424_63730_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|66568_67273_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001516695.1|67878_68535_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_072319970.1|68853_69270_-	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	44.0	1.4e-17
WP_001067858.1|69324_70029_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001235713.1|70754_71312_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|71494_72355_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|72769_73474_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_165887185.1|73520_73670_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|73872_74886_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_032491824.1|75034_75826_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
WP_001287388.1|77272_77677_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001082182.1|77938_78211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010892343.1|78207_78876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062400.1|79382_79838_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000272280.1|80006_80195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010892342.1|80197_81418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323423.1|81472_81676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000529857.1|81713_83009_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000220757.1|83033_83201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162992108.1|83332_84733_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.0e-101
WP_000173534.1|84983_85499_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	7.1e-08
84996:85012	attR	AAAAAGTTACTTTTGCC	NA	NA	NA	NA
WP_005046389.1|85504_86428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250919.1|86483_87263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039026432.1|87610_87910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627692.1|88159_89206_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000125669.1|89257_90664_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001447552.1|91675_92101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537778.1|92112_92499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012817917.1|92748_92970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136655514.1|93265_96601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694887.1|96876_97230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963398.1|97377_97992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001395519.1|98169_98604_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	41.1	1.2e-21
WP_000281816.1|98587_99847_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	43.1	9.3e-94
WP_000593841.1|99898_100708_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000945974.1|100814_101426_+	lipoprotein	NA	NA	NA	NA	NA
WP_000061015.1|101484_101907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833502.1|101929_102322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001044069.1|102347_103097_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_000470506.1|103244_103760_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000941927.1|103856_104423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010892329.1|104669_108659_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001200841.1|108667_110083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197598.1|110072_111119_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001140954.1|111730_112243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038989149.1|112245_113046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000045622.1|113803_114289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133069.1|114285_115008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039026431.1|115018_118054_+	helicase	NA	NA	NA	NA	NA
WP_000167418.1|118053_120138_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000344269.1|120137_121241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000718546.1|121227_121890_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000476771.1|121902_123084_+	S49 family peptidase	NA	A0A2I6UGK8	Salinibacter_virus	31.4	7.8e-10
WP_165899057.1|123085_123781_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	36.4	5.6e-08
WP_165899058.1|123817_124495_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	45.2	1.6e-20
WP_000624622.1|124494_124842_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|124861_126433_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 1
NZ_CP049355	Escherichia coli strain T28R plasmid pT28R-2, complete sequence	161057	1262	75482	161057	transposase,bacteriocin,protease,integrase	Escherichia_phage(31.82%)	57	NA	NA
WP_001066954.1|1262_2003_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_014640565.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|2685_3594_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|3656_4766_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|5198_6152_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001332050.1|6255_6645_+|protease	outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|7424_7583_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001189111.1|9178_10687_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000450494.1|14523_15717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000738422.1|18802_19096_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|22243_23359_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001111199.1|23498_27158_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.2e-45
WP_000933675.1|27261_28491_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_064055648.1|28575_29532_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|29576_31754_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_001259759.1|32696_32900_-|bacteriocin	colicin V family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014640552.1|32877_33114_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|34354_34636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203272.1|34993_35521_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|35764_36580_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|36629_36983_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|37160_37952_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000796228.1|37948_38638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|38681_39032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064055658.1|39563_43385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000251882.1|43628_43790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142450.1|43807_44155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311056.1|44456_44939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023154360.1|45055_45904_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	39.0	5.0e-27
WP_000969990.1|45949_46231_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012783960.1|46337_47927_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
WP_001067855.1|47917_48622_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014342101.1|48822_48945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001617865.1|48924_49800_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_014839980.1|50411_50828_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|50832_51351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071448054.1|51350_52097_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|52102_52807_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|52920_53697_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000602738.1|55247_56000_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_165488106.1|57924_58296_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_085940648.1|58492_59583_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|59672_60488_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|60574_60877_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|60770_61022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|61052_62546_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|62657_62963_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|62990_64205_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|64421_65306_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|66230_66935_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|67019_67421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344976.1|67429_70381_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_061093074.1|70383_70851_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	3.4e-49
WP_001067858.1|70901_71606_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067855.1|72917_73622_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|73811_74627_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|74777_75482_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP049355	Escherichia coli strain T28R plasmid pT28R-2, complete sequence	161057	78820	105397	161057	tRNA,transposase,integrase	Escherichia_phage(27.27%)	29	79660:79719	84957:85778
WP_001389365.1|78820_79585_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
79660:79719	attL	AGGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_001067858.1|79713_80418_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000679427.1|80800_81148_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|81311_82103_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_071523897.1|82108_82354_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|82510_83008_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|83152_84166_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|84368_84719_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_165899059.1|84844_85120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|85010_85715_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|86017_86878_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
84957:85778	attR	AGGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGTTGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGTGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_001262765.1|87154_88465_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001398199.1|88749_89151_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|89083_89341_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000381395.1|90889_92461_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|92480_92828_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_165899058.1|92827_93505_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	45.2	1.6e-20
WP_000774297.1|93721_94579_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001324615.1|94571_95066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442103.1|95046_95121_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083845.1|95352_95610_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|95893_96043_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001299730.1|96723_96936_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139315.1|97071_97632_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704514.1|97734_98595_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_000205749.1|98653_99400_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
WP_000986962.1|99419_104690_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000450520.1|104771_104999_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911313.1|104998_105397_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
