The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045916	Pseudomonas aeruginosa strain CF39S chromosome, complete genome	6797918	642253	694888	6797918	tRNA,plate,tail	Pseudomonas_phage(24.0%)	55	NA	NA
WP_003099590.1|642253_643279_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	1.4e-108
WP_003085061.1|643357_643927_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|644010_644364_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|644354_644897_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|644869_646102_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_003099582.1|646145_646652_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|646745_648299_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|648295_649567_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|649667_651590_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|651868_652201_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003099572.1|652244_653096_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R4ALP3	Aeromonas_phage	44.2	2.4e-08
WP_003085085.1|653095_653476_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|653512_654319_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003099567.1|654434_655421_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|655417_656710_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003099560.1|656690_659462_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003099554.1|659588_660605_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|660601_661276_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|661277_662036_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003099546.1|662036_663098_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_003099544.1|663249_665643_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003099542.1|665691_666321_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|666449_667484_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|667717_668827_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|668882_669929_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003099537.1|670042_671290_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|671395_672226_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|672349_673024_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|673023_673842_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|673914_675393_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003085128.1|675580_675895_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003085129.1|675994_676765_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.0	6.1e-72
WP_003085132.1|677222_677423_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003085135.1|677470_677830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|678192_678642_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|678663_679179_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003085141.1|679175_679733_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003085143.1|679885_680212_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|680208_681096_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003137385.1|681088_681622_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_003101626.1|681623_683732_+	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	52.1	2.5e-224
WP_003085172.1|683740_684181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003101628.1|684223_685384_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.6	7.8e-188
WP_003085175.1|685396_685900_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|685914_686259_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003101633.1|686428_688666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085182.1|688675_689548_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|689522_689729_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003101637.1|689786_690776_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	2.2e-106
WP_003085188.1|690808_691438_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	3.2e-87
WP_003101639.1|691434_691797_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	1.9e-15
WP_003118919.1|691793_692051_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003101640.1|692398_693004_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|693005_694055_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|694051_694888_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP045916	Pseudomonas aeruginosa strain CF39S chromosome, complete genome	6797918	875622	918234	6797918	terminase,portal,tRNA,capsid,tail,head,integrase,protease,holin	Pseudomonas_phage(89.83%)	61	869594:869609	901071:901086
869594:869609	attL	CTGCTGGCGCGCGGCG	NA	NA	NA	NA
WP_003129398.1|875622_876672_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	53.7	1.3e-101
WP_031640221.1|876671_876914_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	60.3	1.1e-16
WP_034002387.1|876897_877674_-	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	88.6	6.7e-111
WP_023092496.1|877670_877862_-	hypothetical protein	NA	A0A1W6JTB8	Pseudomonas_phage	98.4	1.2e-29
WP_074202382.1|877980_879540_-	hypothetical protein	NA	H2BDF1	Pseudomonas_virus	74.1	6.3e-68
WP_023092499.1|879526_879958_-	hypothetical protein	NA	A0A0U1T4M5	Pseudomonas_phage	90.0	6.0e-61
WP_034002389.1|879954_880401_-	hypothetical protein	NA	Q6JIG5	Burkholderia_virus	70.3	6.2e-53
WP_034002391.1|880397_882308_-	DNA methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	94.7	4.1e-287
WP_023092501.1|882304_882733_-	hypothetical protein	NA	A0A291AUJ5	Sinorhizobium_phage	40.9	1.3e-12
WP_003129627.1|882777_883614_-	prohibitin family protein	NA	A0A0A0YRT7	Pseudomonas_phage	99.6	2.9e-128
WP_023121762.1|883610_883865_-	hypothetical protein	NA	A0A0A0YUF2	Pseudomonas_phage	96.4	9.4e-38
WP_023085534.1|883964_884198_-	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	96.1	2.1e-36
WP_033987591.1|884200_884581_-	response regulator transcription factor	NA	A0A1W6JTA9	Pseudomonas_phage	62.0	3.7e-30
WP_078451236.1|884696_885467_-	helix-turn-helix transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	51.9	2.2e-61
WP_031691380.1|886376_886688_+	hypothetical protein	NA	A0A0A0YUF6	Pseudomonas_phage	93.2	1.8e-46
WP_034053192.1|886684_886972_+	hypothetical protein	NA	A0A0A0YQ33	Pseudomonas_phage	98.9	1.3e-43
WP_023085532.1|886968_887277_+	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	75.5	1.2e-34
WP_023085531.1|887273_887552_+	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	81.5	8.4e-32
WP_003119035.1|887544_887778_+	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	94.8	8.3e-33
WP_023083808.1|887774_888575_+	hypothetical protein	NA	A0A1W6JTB2	Pseudomonas_phage	84.6	6.9e-119
WP_023083807.1|888571_888802_+	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	97.4	1.7e-38
WP_052150899.1|888798_889821_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	54.4	1.3e-42
WP_003159056.1|889804_890644_+	ATP-binding protein	NA	A0A1W6JTD8	Pseudomonas_phage	52.2	1.2e-70
WP_003159057.1|890640_892032_+	AAA family ATPase	NA	A0A1W6JTB3	Pseudomonas_phage	86.5	3.1e-231
WP_003159059.1|892028_893306_+|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	46.3	1.6e-101
WP_003159060.1|893320_893605_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	87.5	4.0e-37
WP_003159061.1|893601_894159_+	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	80.7	1.7e-60
WP_071534974.1|894353_894893_+	DUF4124 domain-containing protein	NA	A0A1B0Z2K9	Pseudomonas_phage	83.8	1.3e-76
WP_003119044.1|895161_895497_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	100.0	2.2e-58
WP_034053194.1|895493_896111_+	glycoside hydrolase family 19 protein	NA	A0A0U4JP23	Pseudomonas_phage	93.7	4.7e-107
WP_031759151.1|896080_896560_+	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	89.2	2.8e-51
WP_023981182.1|896696_897101_+	HNH endonuclease	NA	A0A0U4B0J6	Pseudomonas_phage	52.7	3.7e-28
WP_014602593.1|897182_897665_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	74.4	1.4e-61
WP_034053197.1|897668_899396_+|terminase	terminase large subunit	terminase	A0A2D1GNU5	Pseudomonas_phage	76.3	1.2e-269
WP_023092517.1|899395_900619_+|portal	phage portal protein	portal	A0A2D1GNU4	Pseudomonas_phage	81.0	1.9e-189
WP_023092518.1|900596_901250_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2D1GNL2	Pseudomonas_phage	82.6	2.6e-100
901071:901086	attR	CTGCTGGCGCGCGGCG	NA	NA	NA	NA
WP_023092519.1|901260_902463_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	76.8	9.9e-178
WP_034053198.1|902508_902787_+	hypothetical protein	NA	A0A2D1GNQ9	Pseudomonas_phage	41.6	2.5e-15
WP_034053200.1|902779_903100_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2D1GNK0	Pseudomonas_phage	55.2	2.6e-29
WP_023093247.1|903122_903305_+	hypothetical protein	NA	A0A0U4K5G7	Pseudomonas_phage	55.9	3.1e-11
WP_034053203.1|903314_903866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034053205.1|903862_904456_+	hypothetical protein	NA	A0A0U4J906	Pseudomonas_phage	97.5	1.8e-100
WP_023092524.1|904468_904906_+	hypothetical protein	NA	A0A0U4IBQ1	Pseudomonas_phage	95.9	2.0e-72
WP_034053207.1|904929_905715_+	hypothetical protein	NA	A0A0U4ISK2	Pseudomonas_phage	96.9	6.7e-143
WP_023092526.1|905770_906136_+	hypothetical protein	NA	A0A0U4KLC4	Pseudomonas_phage	98.3	3.1e-58
WP_003098505.1|906180_906330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034053208.1|906319_908461_+	tape measure protein	NA	A0A0U3TH20	Pseudomonas_phage	98.9	0.0e+00
WP_003098501.1|908470_908974_+	hypothetical protein	NA	A0A0U4IIK1	Pseudomonas_phage	100.0	1.8e-93
WP_079382100.1|908975_910679_+	hypothetical protein	NA	A0A0U4JP39	Pseudomonas_phage	94.0	7.9e-306
WP_034008369.1|910681_911092_+	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	100.0	9.1e-59
WP_023092530.1|911091_911637_+	hypothetical protein	NA	A0A1W6JT85	Pseudomonas_phage	100.0	1.7e-100
WP_023092531.1|911647_912052_+	hypothetical protein	NA	A0A0U4B0P9	Pseudomonas_phage	98.5	7.6e-66
WP_023092532.1|912048_913707_+	hypothetical protein	NA	A0A0A0YRR5	Pseudomonas_phage	95.6	0.0e+00
WP_003159081.1|913727_914315_+	hypothetical protein	NA	A0A1B0Z051	Pseudomonas_phage	94.9	1.5e-102
WP_003159082.1|914307_914499_+	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	98.4	3.5e-29
WP_034008367.1|914503_915064_+	hypothetical protein	NA	A0A0U4JIY3	Pseudomonas_phage	98.4	7.2e-99
WP_023083623.1|915064_915346_+	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	95.7	7.4e-44
WP_023083622.1|915338_916271_+	hypothetical protein	NA	A0A1B0YZW2	Pseudomonas_phage	95.2	1.7e-169
WP_003124028.1|916270_916570_+	hypothetical protein	NA	A0A1B0YZW1	Pseudomonas_phage	98.0	3.7e-49
WP_034053211.1|916566_916800_+	hypothetical protein	NA	A0A0S3UFY6	Pseudomonas_phage	97.3	4.4e-34
WP_003105684.1|916995_918234_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2C9CX69	Yersinia_phage	33.3	7.8e-53
>prophage 3
NZ_CP045916	Pseudomonas aeruginosa strain CF39S chromosome, complete genome	6797918	1470260	1479289	6797918		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1470260_1470896_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|1470941_1471835_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1471939_1472944_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1473370_1473694_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|1473760_1476328_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003098486.1|1476453_1477461_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1477608_1478115_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1478248_1479289_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 4
NZ_CP045916	Pseudomonas aeruginosa strain CF39S chromosome, complete genome	6797918	2630204	2637098	6797918	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003097631.1|2630204_2631485_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003097630.1|2631486_2632884_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2632888_2633863_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|2633950_2634934_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003119979.1|2634930_2635266_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003090391.1|2635262_2635568_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2635567_2635927_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003097619.1|2635923_2636319_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	4.5e-47
WP_003090386.1|2636429_2637098_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 5
NZ_CP045916	Pseudomonas aeruginosa strain CF39S chromosome, complete genome	6797918	2801962	2857195	6797918	terminase,integrase,tail,holin	Pseudomonas_phage(61.82%)	71	2805788:2805847	2857424:2857515
WP_020750450.1|2801962_2804848_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.6	1.9e-33
WP_003099002.1|2804938_2805472_+	hypothetical protein	NA	NA	NA	NA	NA
2805788:2805847	attL	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCC	NA	NA	NA	NA
WP_031639986.1|2805933_2806998_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	58.4	5.2e-114
WP_003158549.1|2806999_2807233_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	50.7	5.6e-13
WP_003099004.1|2807289_2807676_-	hypothetical protein	NA	L7TJJ9	Pseudomonas_virus	99.2	1.0e-64
WP_003099007.1|2807672_2807795_-	hypothetical protein	NA	A0A0U1VYM0	Pseudomonas_phage	100.0	1.4e-12
WP_003099014.1|2807787_2808873_-	hypothetical protein	NA	A0A2K8HL62	Pseudomonas_phage	52.6	4.8e-83
WP_003099016.1|2809090_2809420_+	hypothetical protein	NA	A0A1W6JTA1	Pseudomonas_phage	71.3	3.8e-39
WP_033871465.1|2809494_2809989_-	DUF550 domain-containing protein	NA	A0A2K8HR09	Pseudomonas_phage	92.7	5.1e-88
WP_108116075.1|2810362_2810464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099020.1|2810554_2811049_-	hypothetical protein	NA	A0A2K8HVL6	Pseudomonas_phage	93.8	2.7e-73
WP_003099023.1|2811045_2813043_-	DNA methyltransferase	NA	A0A140IES2	Pseudomonas_phage	91.1	0.0e+00
WP_124171382.1|2813158_2813485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003099025.1|2813652_2815398_-	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	94.1	1.6e-298
WP_003099027.1|2815401_2816391_-	cell division protein FtsK	NA	H2BD47	Pseudomonas_phage	61.1	7.5e-91
WP_003099029.1|2816403_2816604_-	hypothetical protein	NA	J7I437	Pseudomonas_phage	98.5	2.5e-30
WP_003099031.1|2816610_2817498_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.6	2.4e-104
WP_003099033.1|2817510_2818419_-	endonuclease	NA	Q858E0	Salmonella_phage	72.0	1.6e-124
WP_003099035.1|2818429_2818639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099037.1|2818635_2818857_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_003099039.1|2818840_2818993_-	hypothetical protein	NA	A0A2K8HR67	Pseudomonas_phage	93.8	1.5e-11
WP_003099041.1|2819572_2819944_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	100.0	8.5e-64
WP_071538254.1|2820120_2820759_+	acetyltransferase	NA	NA	NA	NA	NA
WP_020750452.1|2820861_2821074_-	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	97.1	5.8e-33
WP_003099044.1|2821129_2821372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099046.1|2821409_2821613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099049.1|2821612_2821804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099051.1|2821994_2822201_-	hypothetical protein	NA	A0A0U4IJ22	Pseudomonas_phage	95.6	8.7e-34
WP_003098555.1|2822211_2822418_-	hypothetical protein	NA	A0A0U4B0I0	Pseudomonas_phage	97.1	7.6e-30
WP_003103354.1|2822863_2823739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003103356.1|2823735_2824617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003103358.1|2825258_2825462_+	Cro/Cl family transcriptional regulator	NA	A0A0U1UNM4	Pseudomonas_phage	61.7	6.4e-13
WP_020750446.1|2825701_2826214_-	hypothetical protein	NA	J7HXA3	Pseudomonas_phage	96.5	9.0e-88
WP_003103363.1|2826296_2826869_+	hypothetical protein	NA	J7I4J9	Pseudomonas_phage	100.0	5.5e-102
WP_003103371.1|2826871_2827756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103373.1|2827805_2828414_+	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	43.9	3.4e-41
WP_003103374.1|2828406_2828850_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	98.6	1.4e-76
WP_003103375.1|2828878_2829748_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	87.2	2.9e-147
WP_003103376.1|2829903_2830203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103377.1|2830310_2830691_+	hypothetical protein	NA	H2BDJ3	Pseudomonas_virus	67.5	4.8e-38
WP_003103378.1|2830665_2831013_+|holin	phage holin family protein	holin	Q9MC42	Pseudomonas_phage	61.3	1.9e-25
WP_003103379.1|2831079_2831535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103380.1|2831592_2832192_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	61.9	3.3e-49
WP_020750445.1|2832175_2833471_+|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.2	2.4e-145
WP_003103384.1|2833473_2834829_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	45.8	8.1e-96
WP_003103386.1|2834825_2835905_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	97.8	2.0e-201
WP_003103389.1|2836033_2836777_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	75.5	2.2e-87
WP_003103391.1|2836786_2837758_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	64.7	9.3e-110
WP_003103393.1|2837799_2838285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103395.1|2838268_2838733_+	hypothetical protein	NA	H9EB35	Vibrio_phage	39.3	5.2e-10
WP_003103397.1|2838732_2839122_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	55.0	2.8e-33
WP_003103399.1|2839125_2839800_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.0	1.3e-115
WP_003103401.1|2839796_2840207_+	hypothetical protein	NA	A0A1B0VMI0	Pseudomonas_phage	44.1	3.0e-25
WP_003103403.1|2840274_2840928_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.8	4.5e-60
WP_003103406.1|2840937_2841318_+	hypothetical protein	NA	A0A2H4IYQ5	uncultured_Caudovirales_phage	51.2	7.0e-29
WP_003103408.1|2841380_2841644_+	hypothetical protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	3.6e-16
WP_003103414.1|2841640_2844832_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	41.1	2.2e-155
WP_003103417.1|2844837_2845176_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	98.2	1.5e-59
WP_003158546.1|2845172_2845922_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	98.0	4.7e-146
WP_003103422.1|2845924_2846683_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	97.2	5.7e-147
WP_003158545.1|2847204_2847789_+|tail	tail assembly protein	tail	A0A0S2SYS2	Pseudomonas_phage	96.9	1.1e-100
WP_020750444.1|2848124_2848817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003106739.1|2848876_2852437_+	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	75.7	0.0e+00
WP_071536682.1|2852433_2852718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003106740.1|2853607_2854375_+	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	51.4	7.9e-56
WP_003106743.1|2854417_2855047_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	95.2	2.7e-110
WP_020750441.1|2855043_2855412_+	hypothetical protein	NA	H2BDD6	Pseudomonas_virus	78.7	2.0e-41
WP_003102452.1|2855408_2855672_+	hypothetical protein	NA	A0A0U4B0B7	Pseudomonas_phage	97.7	3.7e-37
WP_003102455.1|2855707_2855974_+	hypothetical protein	NA	L7TP56	Pseudomonas_virus	98.9	1.8e-44
WP_003102456.1|2855955_2856642_-	SOS response-associated peptidase	NA	A0A2K8I970	Pseudomonas_phage	87.7	1.0e-118
WP_003102458.1|2856679_2857195_-	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	94.7	5.8e-95
2857424:2857515	attR	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCCCGTAGCTCAACGAGTTACGGGGCTTTTTTCTT	NA	NA	NA	NA
>prophage 6
NZ_CP045916	Pseudomonas aeruginosa strain CF39S chromosome, complete genome	6797918	3334135	3373628	6797918	integrase,plate,transposase	uncultured_Caudovirales_phage(29.41%)	38	3353883:3353901	3371788:3371806
WP_003100881.1|3334135_3337102_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|3337260_3337551_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003100872.1|3337547_3337934_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003465043.1|3338170_3338527_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|3338781_3339108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|3339104_3339605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100853.1|3339601_3339973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|3339966_3340524_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003117254.1|3340854_3341658_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.4	9.9e-33
WP_003117255.1|3341869_3342145_+	hypothetical protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	64.8	3.3e-28
WP_003117256.1|3342182_3343247_+	hypothetical protein	NA	A0A2H4J9E6	uncultured_Caudovirales_phage	72.8	8.2e-152
WP_003117257.1|3343264_3343789_+|plate	phage baseplate assembly protein	plate	A0A2H4JFE0	uncultured_Caudovirales_phage	67.2	7.8e-63
WP_003117258.1|3343855_3344206_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	67.2	4.2e-36
WP_003117259.1|3344207_3345278_+|plate	baseplate J/gp47 family protein	plate	A0A2H4JC98	uncultured_Caudovirales_phage	41.7	1.6e-70
WP_003117260.1|3345274_3345850_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	39.0	3.1e-28
WP_003117261.1|3346167_3347061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003117262.1|3347069_3347606_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	46.7	1.5e-21
WP_003117263.1|3347610_3348912_-	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A1V0SJA4	Klosneuvirus	24.4	1.7e-13
WP_003117264.1|3349065_3349992_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003117265.1|3350245_3352066_+	DUF1302 domain-containing protein	NA	NA	NA	NA	NA
WP_003117266.1|3352068_3353415_+	DUF1329 domain-containing protein	NA	NA	NA	NA	NA
WP_003117267.1|3353476_3354868_+	DUF1254 domain-containing protein	NA	M1I2Z8	Paramecium_bursaria_Chlorella_virus	32.2	5.1e-53
3353883:3353901	attL	CGGCCGAGCGCTACCTGAT	NA	NA	NA	NA
WP_003117268.1|3355072_3356065_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003117269.1|3356208_3356469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003117270.1|3356528_3357779_-	chromate resistance efflux protein ChrA	NA	NA	NA	NA	NA
WP_003117271.1|3357949_3358894_-	chromate resistance protein	NA	NA	NA	NA	NA
WP_003117272.1|3359169_3359730_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	95.2	3.1e-57
WP_003117273.1|3359733_3362700_+|transposase	Tn3-like element ISPa40 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	92.6	0.0e+00
WP_003117274.1|3362696_3362873_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_003111050.1|3363053_3364025_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003111049.1|3364054_3364798_+	phage Gp37/Gp68 family protein	NA	A0A2P1A0W3	Gordonia_phage	45.5	1.8e-60
WP_003111048.1|3364819_3366136_+	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_003111047.1|3366547_3367957_+	homospermidine synthase	NA	B2ZXX8	Ralstonia_phage	39.1	1.2e-94
WP_003111046.1|3367972_3368701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003111045.1|3368697_3369603_+	EamA family transporter	NA	NA	NA	NA	NA
WP_003111044.1|3369610_3370075_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003111043.1|3370254_3370617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003117275.1|3370613_3373628_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.8	9.7e-73
3371788:3371806	attR	ATCAGGTAGCGCTCGGCCG	NA	NA	NA	NA
>prophage 7
NZ_CP045916	Pseudomonas aeruginosa strain CF39S chromosome, complete genome	6797918	5037029	5121496	6797918	terminase,portal,tRNA,capsid,plate,tail,head,lysis,integrase,protease,holin	Pseudomonas_virus(70.45%)	98	5084941:5084987	5121663:5121709
WP_003085581.1|5037029_5037434_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_003101979.1|5037532_5038285_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085577.1|5038416_5038989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003123029.1|5039093_5039834_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1B0XTP2	Freshwater_phage	26.4	6.4e-10
WP_003085573.1|5039830_5040799_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003101974.1|5040887_5041634_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003101972.1|5041626_5042328_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003085566.1|5042388_5043306_-	GTPase Era	NA	NA	NA	NA	NA
WP_003085565.1|5043298_5043988_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.4	7.2e-24
WP_003085562.1|5043984_5044362_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_003101969.1|5044530_5045385_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003101967.1|5045390_5047190_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	38.5	1.1e-20
WP_003101964.1|5047339_5048764_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.0	3.4e-28
WP_003101962.1|5048803_5049259_-	positive regulator for alginate biosynthesis MucC	NA	NA	NA	NA	NA
WP_003101960.1|5049255_5050206_-	sigma factor AlgU regulatory protein MucB	NA	NA	NA	NA	NA
WP_003101958.1|5050214_5050799_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_003085543.1|5050830_5051412_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_003101954.1|5051820_5053437_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003101950.1|5053405_5053858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085532.1|5053841_5054096_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_003101947.1|5054368_5055313_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003085528.1|5055413_5056250_+	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	36.6	2.5e-26
WP_003101943.1|5056258_5057641_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085524.1|5057633_5058305_-	response regulator	NA	NA	NA	NA	NA
WP_003101939.1|5058515_5059799_+	OprD family porin	NA	NA	NA	NA	NA
WP_003085519.1|5059828_5060812_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003101933.1|5060860_5061331_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_003116509.1|5061341_5062859_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_003106435.1|5062851_5063889_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003106436.1|5064015_5064711_-	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	45.2	1.0e-49
WP_003106439.1|5064810_5065632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003106441.1|5065688_5066570_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003106449.1|5066702_5068211_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003085499.1|5068222_5069386_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003085498.1|5069451_5070270_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003106451.1|5070328_5071432_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003116513.1|5071543_5072440_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003085490.1|5072496_5073141_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_003098346.1|5073256_5073898_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003098348.1|5073932_5075909_-	alkyl/aryl-sulfatase	NA	M1I0S7	Paramecium_bursaria_Chlorella_virus	44.8	3.1e-160
WP_003098349.1|5076011_5076926_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003098351.1|5076929_5077118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085479.1|5077240_5077486_-	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
WP_003098353.1|5077601_5078051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098355.1|5078146_5078326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098356.1|5078558_5079635_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_003098357.1|5079631_5080447_+	DUF4824 family protein	NA	NA	NA	NA	NA
WP_020989334.1|5080467_5080740_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_003098362.1|5080739_5081432_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_003098363.1|5081567_5082611_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003085453.1|5082690_5083428_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_003098365.1|5083879_5084782_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
5084941:5084987	attL	GCTTCCCAAGCTCATGACGAGGGTTCGATTCCCTTCGCCCGCTCCAG	NA	NA	NA	NA
WP_003098368.1|5085774_5086500_+	zeta toxin	NA	NA	NA	NA	NA
WP_162836249.1|5086508_5086667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098370.1|5086737_5087793_-|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	96.0	1.0e-194
WP_031299630.1|5087792_5089553_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	100.0	0.0e+00
WP_003098374.1|5089708_5090530_+|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	96.0	1.2e-129
WP_003098375.1|5090565_5091582_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.1	8.6e-191
WP_003098376.1|5091587_5092289_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	97.9	6.9e-123
WP_003098377.1|5092392_5092854_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	99.3	2.8e-80
WP_003098378.1|5092853_5093066_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
WP_003098379.1|5093090_5093444_+	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_003098380.1|5093445_5093718_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
WP_003098381.1|5093714_5094521_+	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	97.4	5.4e-148
WP_003098382.1|5094517_5094979_+|lysis	LysB family phage lysis regulatory protein	lysis	Q9ZXL5	Pseudomonas_virus	97.4	8.1e-72
WP_003098383.1|5095056_5095593_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.3	1.4e-94
WP_020750417.1|5095585_5096044_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	90.0	1.6e-67
WP_003098385.1|5096113_5096686_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	90.5	7.9e-93
WP_003098386.1|5096682_5097027_+|plate	baseplate assembly protein	plate	Q9ZXK9	Pseudomonas_virus	97.4	1.4e-55
WP_003098387.1|5097023_5097941_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	87.8	8.4e-145
WP_003098388.1|5097937_5098555_+|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	75.3	7.7e-86
WP_003098390.1|5100378_5100813_+|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	50.7	1.5e-30
WP_003098391.1|5100913_5102089_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	99.0	3.5e-220
WP_003098392.1|5102145_5102661_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	95.9	3.9e-91
WP_003098393.1|5102715_5103045_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	93.6	2.2e-47
WP_003098394.1|5103053_5103173_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_003098398.1|5103162_5105922_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	92.3	0.0e+00
WP_003098399.1|5105926_5106367_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	99.3	1.8e-76
WP_003098400.1|5106363_5107629_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	97.9	1.9e-235
WP_020750418.1|5107656_5108838_-	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	31.3	3.9e-54
WP_020750419.1|5108821_5109913_-	nucleoid-associated protein ndpA	NA	A0A291AUQ0	Sinorhizobium_phage	43.3	1.2e-68
WP_128568923.1|5110040_5110448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098404.1|5110496_5110961_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_100209530.1|5110997_5111429_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020750421.1|5111494_5111725_+	phage-associated protein, BcepMu gp16 family	NA	NA	NA	NA	NA
WP_031804339.1|5111787_5112225_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	95.2	4.4e-67
WP_003098408.1|5112221_5112515_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	99.0	1.1e-50
WP_003098409.1|5112511_5112862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098410.1|5112933_5113167_+	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	100.0	7.8e-39
WP_003098411.1|5113163_5115884_+	toprim domain-containing protein	NA	Q9ZXI8	Pseudomonas_virus	99.2	0.0e+00
WP_003098413.1|5115928_5116201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098415.1|5116260_5116614_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	97.4	3.8e-61
WP_003098417.1|5116625_5116832_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	100.0	7.3e-33
WP_003098418.1|5117135_5119046_+	DNA methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	88.3	2.1e-259
WP_003098420.1|5119349_5119526_+	hypothetical protein	NA	Q38017	Pseudomonas_virus	70.6	5.5e-05
WP_003098421.1|5119522_5119891_+	ASCH domain-containing protein	NA	A0A291AUQ6	Sinorhizobium_phage	50.4	3.6e-30
WP_003098423.1|5120083_5120287_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_003098425.1|5120293_5121496_-|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	30.9	3.8e-36
5121663:5121709	attR	GCTTCCCAAGCTCATGACGAGGGTTCGATTCCCTTCGCCCGCTCCAG	NA	NA	NA	NA
>prophage 8
NZ_CP045916	Pseudomonas aeruginosa strain CF39S chromosome, complete genome	6797918	6742634	6776528	6797918	transposase,integrase,tRNA,protease	uncultured_Mediterranean_phage(25.0%)	31	6764585:6764602	6782702:6782719
WP_003158562.1|6742634_6743369_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
WP_003100204.1|6743371_6744340_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_003100208.1|6744336_6745278_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_003100210.1|6745274_6746705_+	cytochrome P450	NA	NA	NA	NA	NA
WP_003100213.1|6746730_6747612_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_014603451.1|6747640_6748588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100219.1|6748635_6749526_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_003100222.1|6749685_6750891_+	MFS transporter	NA	NA	NA	NA	NA
WP_024014929.1|6751446_6752598_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	1.7e-25
WP_013984524.1|6752617_6753580_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_047290147.1|6753566_6754055_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_051600567.1|6754066_6754315_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_016782893.1|6755091_6756798_-	sodium/hydrogen exchanger	NA	NA	NA	NA	NA
WP_000787151.1|6756801_6757242_-	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	3.4e-11
WP_051600569.1|6757231_6758377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993372.1|6758475_6759087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016782891.1|6759172_6760060_-	YfdX family protein	NA	NA	NA	NA	NA
WP_024014932.1|6760162_6761071_-	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_024014933.1|6761092_6761410_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_024014934.1|6761630_6763460_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	41.5	3.4e-105
WP_023383119.1|6763515_6763707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024014935.1|6763706_6766556_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	9.0e-129
6764585:6764602	attL	CGGTCTTGCCCACGCCGG	NA	NA	NA	NA
WP_024014936.1|6766661_6767231_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_016782886.1|6767265_6767547_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016782885.1|6767770_6768034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446199.1|6768048_6768312_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016782884.1|6768904_6770527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165886774.1|6770519_6772022_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016782883.1|6772023_6773634_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_051600829.1|6773626_6775687_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000017067.1|6775700_6776528_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
6782702:6782719	attR	CGGTCTTGCCCACGCCGG	NA	NA	NA	NA
>prophage 1
NZ_CP045917	Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence	468631	124655	132109	468631	protease	Acinetobacter_phage(33.33%)	9	NA	NA
WP_020191931.1|124655_125414_+	Trehalose-6-phosphatase	NA	A0A172Q0Q4	Acinetobacter_phage	26.8	2.5e-09
WP_020191932.1|125406_126501_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.4	2.8e-38
WP_020191933.1|126500_127448_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_020191934.1|127447_128176_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010794508.1|128178_128772_+	TerD family protein	NA	A0A2I7QY07	Vibrio_phage	36.8	1.8e-23
WP_020191935.1|128768_129959_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_010792504.1|130006_130456_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	30.2	1.3e-10
WP_010792503.1|130467_131502_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.2	3.1e-71
WP_010792502.1|131530_132109_+	TerD family protein	NA	A0A2L1IWC0	Streptomyces_phage	31.0	5.7e-06
>prophage 2
NZ_CP045917	Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence	468631	158419	217660	468631	transposase,integrase	Salmonella_phage(33.33%)	53	168131:168146	209092:209107
WP_010794450.1|158419_159715_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010794451.1|161834_162926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010794452.1|162957_164163_-	hypothetical protein	NA	J9Q6K3	Salmonella_phage	38.7	2.6e-08
WP_010794453.1|164296_165331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057390197.1|166509_167811_+	hypothetical protein	NA	NA	NA	NA	NA
168131:168146	attL	CCGACCCGAAGGAACT	NA	NA	NA	NA
WP_057390198.1|168151_168790_+	SOS response-associated peptidase	NA	A0A218MNF5	uncultured_virus	39.7	6.0e-33
WP_057390199.1|168959_169304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057382823.1|169379_169814_+	GTP pyrophosphokinase	NA	A0A141E1X8	Streptococcus_phage	46.6	6.3e-26
WP_109392703.1|169861_170137_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010794461.1|170370_170727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070091423.1|170853_172134_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_057390285.1|172289_173237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057390286.1|173536_174139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057390287.1|174222_175005_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	32.3	2.6e-22
WP_021263558.1|175147_175855_+	TonB C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_042933868.1|175912_176707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042933867.1|177271_178540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042933866.1|178680_180261_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_021263298.1|180267_180564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021263297.1|180565_180991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010794474.1|181186_181570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021263296.1|181668_182724_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_070091420.1|183010_183514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021263295.1|183748_184252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018614.1|184284_184581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165886777.1|184606_185452_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_057390288.1|185530_188119_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_165886778.1|188657_191594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019438696.1|191618_191996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165886779.1|192324_193440_-	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	46.2	1.3e-83
WP_028692951.1|193930_195418_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	87.9	1.1e-239
WP_028692952.1|195432_196284_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	63.3	6.7e-96
WP_028692953.1|196289_196643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028692954.1|196688_197651_+	SdiA-regulated domain-containing protein	NA	NA	NA	NA	NA
WP_031633884.1|197733_198123_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031633882.1|198148_199231_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032904191.1|199986_201594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028692960.1|201604_202762_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	24.4	1.1e-05
WP_001138014.1|202987_205954_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|205957_206518_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323888.1|206506_206674_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_141989053.1|206795_207533_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_085286980.1|207554_207827_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_085286979.1|207826_208102_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_141989052.1|208400_210785_-	penicillin acylase family protein	NA	NA	NA	NA	NA
209092:209107	attR	AGTTCCTTCGGGTCGG	NA	NA	NA	NA
WP_141989050.1|210918_211950_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023294894.1|212091_212463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091614.1|212459_212786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000741275.1|212809_213145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001172026.1|213159_213495_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151133.1|213475_213853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010465829.1|214044_214647_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	50.3	1.6e-40
WP_010799689.1|214630_217660_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP045917	Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence	468631	361918	379258	468631	transposase,integrase	Burkholderia_phage(16.67%)	13	376729:376788	384360:384475
WP_079767473.1|361918_363103_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_165886770.1|363104_364568_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_062842454.1|364569_366687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062842455.1|366686_367094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010794532.1|367392_368196_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000904906.1|368261_368876_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_010794533.1|369001_371887_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	40.0	1.9e-190
WP_003090759.1|371949_373437_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	87.7	4.3e-239
WP_001389365.1|373993_374758_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|375264_375765_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000946487.1|375892_376744_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
376729:376788	attL	CCCTGCTGCGTAACATCGTTGCTGCTCCATAACATCAAACATCGACCCACGGCGTAACGC	NA	NA	NA	NA
WP_001470697.1|376845_377499_+|integrase	site-specific integrase	integrase	A0A2I7SAK5	Vibrio_phage	58.1	1.1e-21
WP_001747814.1|377725_379258_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
384360:384475	attR	CCCTGCTGCGTAACATCGTTGCTGCTCCATAACATCAAACATCGACCCACGGCGTAACGCGCTTGCTGCTTGGATGCCCGAGGCATAGACTGTACAAAAAAACAGTCATAACAAGC	NA	NA	NA	NA
