The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045515	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4295 chromosome, complete genome	4673793	310395	319477	4673793	protease,integrase	Ralstonia_phage(16.67%)	8	299812:299824	322848:322860
299812:299824	attL	AATAAAAAGATCA	NA	NA	NA	NA
WP_024155556.1|310395_311637_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|312164_312542_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|312703_312901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|313113_315390_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|315420_315741_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|316064_316286_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|316415_318362_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|318358_319477_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
322848:322860	attR	TGATCTTTTTATT	NA	NA	NA	NA
>prophage 2
NZ_CP045515	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4295 chromosome, complete genome	4673793	675983	715631	4673793	integrase,tail,coat,portal,protease	Salmonella_phage(46.43%)	61	675393:675439	715645:715691
675393:675439	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_052909395.1|675983_677906_+	acyltransferase	NA	C6ZR20	Salmonella_phage	99.5	0.0e+00
WP_116585791.1|678251_680369_-|tail	phage tail protein	tail	C6ZR19	Salmonella_phage	99.1	0.0e+00
WP_052909394.1|680524_682495_-	hypothetical protein	NA	C6ZR18	Salmonella_phage	99.1	0.0e+00
WP_165799884.1|682494_683850_-	phage DNA ejection protein	NA	C6ZR17	Salmonella_phage	96.9	4.6e-240
WP_052909393.1|683859_684549_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	91.7	8.1e-92
WP_052909392.1|684551_685007_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	98.7	1.1e-86
WP_052909391.1|685006_685708_-	hypothetical protein	NA	C6ZR14	Salmonella_phage	94.0	6.1e-71
WP_052909390.1|685711_687130_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.1	1.1e-271
WP_023223387.1|687089_687590_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	99.4	4.2e-90
WP_052909389.1|687573_687783_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	88.4	1.7e-29
WP_052909388.1|687821_689117_-|coat	coat protein	coat	A0A0M5M1J5	Salmonella_phage	99.8	2.2e-244
WP_052909387.1|689116_690028_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	6.3e-161
WP_052909386.1|690041_692219_-|portal	portal protein	portal	Q5C835	Enterobacteria_phage	99.3	0.0e+00
WP_046722394.1|692218_693667_-	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	71.3	2.7e-206
WP_045718261.1|693635_694139_-	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	47.8	7.3e-26
WP_046722393.1|694151_694556_-	hypothetical protein	NA	C6ZR73	Salmonella_phage	98.5	2.0e-66
WP_046722392.1|694555_694945_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	98.4	4.3e-74
WP_000808099.1|694948_695191_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_046722391.1|695541_696030_-	GIY-YIG nuclease family protein	NA	K7P7S3	Enterobacteria_phage	96.9	3.4e-84
WP_000182933.1|696392_696680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052909415.1|696903_697371_-	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	45.8	1.1e-28
WP_024133454.1|697345_697573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235461.1|698016_698640_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000994516.1|698636_698825_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008200.1|698821_699184_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_052909383.1|699180_699471_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	99.0	6.5e-51
WP_001549091.1|699463_699676_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	1.1e-34
WP_000950973.1|699668_699845_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_052909382.1|699837_700188_-	DUF2591 family protein	NA	A0A2D1GLI3	Escherichia_phage	69.5	4.0e-39
WP_000113767.1|700190_700367_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	98.3	7.9e-28
WP_000679699.1|700333_700507_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
WP_001629218.1|700503_701376_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	93.1	6.7e-168
WP_052909414.1|701372_701813_-	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	95.9	4.0e-76
WP_165799883.1|701793_701958_-	hypothetical protein	NA	A0A1R3Y6Z7	Salmonella_virus	90.7	4.8e-19
WP_052909381.1|701960_702227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052909380.1|702213_702444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052909379.1|702440_703814_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	96.3	2.0e-243
WP_052909378.1|703810_704644_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	98.6	7.9e-150
WP_001125981.1|704636_704783_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000424166.1|704817_705096_-	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	93.5	2.2e-40
WP_000067726.1|705203_705419_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_023177700.1|705537_706200_+	LexA family transcriptional regulator	NA	Q37946	Enterobacteria_phage	100.0	6.3e-126
WP_125866875.1|706554_706737_+	hypothetical protein	NA	A0A220NQW5	Salmonella_phage	96.7	6.3e-28
WP_052909377.1|706757_707090_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	95.5	1.3e-52
WP_165885265.1|707100_707415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052909375.1|707458_707704_+	hypothetical protein	NA	U5PUY0	Salmonella_phage	62.3	1.9e-19
WP_052909374.1|707740_708028_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	96.8	8.6e-48
WP_006831706.1|708357_708516_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	98.1	1.2e-22
WP_000156731.1|708496_708685_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_046722386.1|708674_708818_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	95.7	2.1e-18
WP_046722385.1|708814_709522_+	recombinase	NA	I6R0N0	Salmonella_phage	99.1	1.3e-137
WP_046722384.1|709522_710029_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	6.5e-91
WP_001016182.1|710037_710586_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
WP_015995298.1|710601_710895_+	DUF2856 family protein	NA	C6ZR34	Salmonella_phage	100.0	1.9e-50
WP_071892267.1|710905_711076_+	DUF2737 family protein	NA	A0A220NQV6	Salmonella_phage	98.2	3.0e-24
WP_116585787.1|711072_711663_+	Eae-like protein	NA	Q5G8U6	Enterobacteria_phage	51.0	2.5e-25
WP_071892271.1|711659_712469_+	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	97.9	4.1e-103
WP_165885266.1|712470_712986_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	99.4	5.4e-101
WP_052909373.1|712982_713534_+	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	72.0	1.0e-65
WP_052909372.1|713602_714238_+	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	87.7	1.8e-106
WP_052909371.1|714467_715631_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	96.9	2.2e-222
715645:715691	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 3
NZ_CP045515	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4295 chromosome, complete genome	4673793	1709621	1754399	4673793	tRNA,tail,plate	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|1709621_1710620_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|1710707_1712018_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|1712264_1712780_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|1712879_1713089_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|1713110_1713224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|1713220_1714546_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|1714724_1715333_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|1715441_1715810_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|1715980_1718401_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|1718499_1719372_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|1719385_1719883_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|1720063_1720981_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|1721144_1722503_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|1722591_1723701_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|1724062_1725253_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|1725384_1726929_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|1726943_1727834_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|1727999_1728410_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|1728552_1730649_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|1730648_1731386_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|1731382_1732051_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|1732084_1732327_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|1732770_1734420_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|1734764_1736114_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|1736244_1736592_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|1737167_1737455_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|1737457_1738063_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|1738075_1738390_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|1738549_1739005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|1739001_1739199_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|1739188_1740616_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_110962133.1|1740615_1741140_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	8.1e-68
WP_001003640.1|1741191_1741509_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|1741468_1741597_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|1741693_1744048_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|1744047_1745001_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|1745000_1745210_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|1745197_1746241_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|1746250_1746973_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|1747300_1747663_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|1747659_1748589_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|1748588_1750136_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|1750299_1750659_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|1750649_1751765_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|1751757_1752390_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|1752392_1753874_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|1753883_1754399_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
>prophage 4
NZ_CP045515	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4295 chromosome, complete genome	4673793	3231317	3237121	4673793		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|3231317_3233651_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|3233665_3233986_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|3233982_3234210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|3234206_3234758_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|3234754_3235021_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_024155472.1|3235558_3236296_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.0	8.4e-79
WP_000984211.1|3236292_3236538_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|3236554_3237121_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 5
NZ_CP045515	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4295 chromosome, complete genome	4673793	3759996	3769167	4673793	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|3759996_3760944_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|3760927_3761659_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3761639_3761747_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|3761806_3762538_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|3762760_3764446_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|3764442_3765162_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3765208_3765676_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|3765732_3766263_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|3766434_3766893_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|3767133_3769167_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP045515	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4295 chromosome, complete genome	4673793	3837258	3843555	4673793		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|3837258_3838662_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|3838839_3839733_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|3840109_3841195_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|3841194_3842094_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|3842141_3843020_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|3843024_3843555_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 7
NZ_CP045515	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4295 chromosome, complete genome	4673793	3953841	3961090	4673793		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|3953841_3954261_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|3954263_3955532_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|3955986_3956199_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|3956209_3956398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|3956657_3957851_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|3958499_3958811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|3958890_3959586_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|3959659_3961090_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP045515	Salmonella enterica subsp. enterica serovar Anatum strain Sal-4295 chromosome, complete genome	4673793	4064372	4072135	4673793	integrase	Enterobacteria_phage(28.57%)	12	4066582:4066604	4078705:4078727
WP_000856224.1|4064372_4064603_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|4064740_4065115_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|4065115_4065991_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|4066007_4066361_+	YebY family protein	NA	NA	NA	NA	NA
4066582:4066604	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|4066732_4067812_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|4067808_4068915_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|4068945_4069176_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|4069229_4069763_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|4070019_4070187_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|4070251_4070440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|4070494_4070986_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|4071538_4072135_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
4078705:4078727	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
